Content-Type: multipart/related; start=; boundary=----------k13hhMHZSZvV30HfFHdb1w Content-Location: http://zippy-egoboo.sourceforge.net/tutorial_3.htm Subject: =?utf-8?Q?Tutorial=203?= MIME-Version: 1.0 ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=tutorial_3.htm Content-Type: text/html; charset=windows-1252; name=tutorial_3.htm Content-ID: Content-Location: http://zippy-egoboo.sourceforge.net/tutorial_3.htm Content-Transfer-Encoding: 8bit Tutorial 3
            
Home
What is Egoboo?
Manual
World Map
Egovir Libellus
Egobestiary
Egonomicon
Egobooty
Tutorials
Cartman
Tools
Downloads
Credits




SourceForge Logo
  

 

Quake Modeler Tutorial Part Three

All right!  Made it this far, let’s put some skin on the monkey.  Open the modeler and load up your monkey file.

 

Now, go into face mode and highlight the left half of the monkey’s head (we’ll do his body later).  Press F2 or click on view -> skins on the menu bar.  This will open the skin editor.

 

In the skin editor window, delete the blank skin that is there by default (it’s the wrong size) and File->Import skin image to load your monkey skin (a 64x64 256 color image).

The colors may be wrong, don’t worry about it.  The colors will look right in the finished product.  The Quake Modeler uses the default Quake palette which is different that the one in the skin image.

 

Click ‘Zoom In’ a few times so the image is a little bigger, easier to work with.  Your screen should look something like this:

 

 

Okay, now we’re cooking with monkey oil.  Let’s lay down the skin on the model.  Still in the skin window, click on Edit->Get position from model.  In the window that pops up, select Left:

Then click Ok.

 

Now you have the left side of the monkey’s head in the view.

Now, go back and unselect the left side of his head and highlight the right hand side.  Open the skin viewer and get position from model->right side.  Now, so that things line up correctly you need to turn off the Y axis and click the ‘Mirror’ button.  This will flip the left vertices around so they line up with the right side.  You may have to move them sideways a little bit.  If it doesn’t line up 100% exactly, don’t worry too much.  We can fix this later using Npherno’s Skin Tool (I’ll tell you more about this later).

 

Now, in the skin editor un-select all the vertices.  One at a time take the vertices and move them into position around the monkey’s head skin.  I will move them all into position and highlight them so you can see where they are in the screenshot.  I just noticed that they are lined up backwards (whoops).  This is easy to fix, just highlight all the vertices in the skin image and lock down the Y axis.  Now click ‘mirror’ and all is well.

 

 

You may also notice that the 3d window behind the skin editing screen will show the skin on the model as you adjust the vertices.  This will help guide your placement of the vertices.  Remember how to change the views from the last tutorial?  Ctrl-1 is line mode, ctrl-4 is texture mode.  Move things around until the face looks just right on your monkey head.  You may also want to unselect the faces in the main view window so that the highlighted area doesn’t screw with you.  In the screenshot above, one side of the face is highlighted and the other isn’t.

 

Use the same methods outlined above to place the skin for the monkey body.  Your monkey should look something like this:

 

We can call the skinning done now, or we could tweak things with a little program called Npherno’s Skin Tool. 

 

Before we do that, we need to save our monkey in a form that is usable by both Npherno’s skin tool and Egoboo.  In the main file menu click on Export->Export to MD2 and use the name tris.md2.  Select the monkey skin image and you’re done.  You could now copy the tris.md2 file into the game (lets do this for fun):

 

Open your Egoboo folder->Modules->Adventurer->Objects->grubbug

 

In this folder, delete the current tris.md2 and tris.bmp file.  Now, paste into this folder your monkey tris.md2 file and the skin bmp file.  Make sure you rename the skin file to tris.bmp.

 

Now fire up Egoboo and play the Adventurer mod to see your monkey in action.  He won’t animate much, he’ll just be like a statue that moves around.

 

Back to Npherno’s skin tool.  It’s a very full featured program that you can use to tweak the skins and paint new skins on your models.  I won’t go into a lot of detail, but I’ll introduce you to it.

Go ahead and fire it up, load your model.  It will have a default skin image painted on it.  Select the skin menu->open and find your monkey skin.

 

 

You will see a series of buttons along the top.  From left to right, the first three are:

 

Eye – This is used for rotating and viewing your model.

Paintbrush – Used for painting the model.  The palette is along the bottom of the screen.

Polygon tool – Used for adjusting and viewing the polygons that make up your model.

 

Zoom in on the skin using the eye and by right click and dragging in the skin view window.  Now click on the Polygon tool and unselect the Eye.

 

You can now select the vertices in the skin view and line them up with more precision than you could in the Quake model editor.

 

Play around with this versatile program and see what else you can do.

 

I’ll wrap up this tutorial with some Quake Model Editor tips that might make skinning things easier with more complex models.

 

When drawing the skin image, try to reuse texture space.  Also try to use as much space on the image as possible (don’t leave much space that isn’t covered by at least one polygon).  This will improve the visual detail on your model.

 

It may help on more complex models to hide the faces that you aren’t currently working with.  Or you can also hide the faces that you have already skinned.  This should help make selecting the proper faces for your next area to skin easier.

 

I will usually make the image as I make the model.  For instance, I will make the head and then skin the head.  Then make the body and skin the body.  I switch back and forth between the modeler, Npherno and painting program frequently.  Make sure you save progress and load your new progress into each program so you don’t save over two hours worth of pixel editing accidentally (I’ve done this many times).

 

If you want something to be invisible use the first color in your palette (usually black).  It won’t show up in the game.  Likewise, if you want something to be black but not invisible use another black or dark gray.  I use the invisible color for the space between creature’s toes and on the edge of creature’s wings for curves.  There are many other uses.

 

I’ll be back next week talking about how to model your creations.  Right now you have all the knowledge it takes to make furniture, feel free to practice.  Make some chairs or beds or statues.

 

L8r,

 

booger

 
------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=TITLE.GIF Content-Type: image/gif; name=TITLE.GIF Content-Location: http://zippy-egoboo.sourceforge.net/images/TITLE.GIF Content-Transfer-Encoding: Base64 R0lGODlhkAE+APcAAP//////zP//mf//Zv//M///AP/M///MzP/Mmf/MZv/MM//M AP+Z//+ZzP+Zmf+ZZv+ZM/+ZAP9m//9mzP9mmf9mZv9mM/9mAP8z//8zzP8zmf8z Zv8zM/8zAP8A//8AzP8Amf8AZv8AM/8AAMz//8z/zMz/mcz/Zsz/M8z/AMzM/8zM zMzMmczMZszMM8zMAMyZ/8yZzMyZmcyZZsyZM8yZAMxm/8xmzMxmmcxmZsxmM8xm AMwz/8wzzMwzmcwzZswzM8wzAMwA/8wAzMwAmcwAZswAM8wAAJn//5n/zJn/mZn/ Zpn/M5n/AJnM/5nMzJnMmZnMZpnMM5nMAJmZ/5mZzJmZmZmZZpmZM5mZAJlm/5lm zJlmmZlmZplmM5lmAJkz/5kzzJkzmZkzZpkzM5kzAJkA/5kAzJkAmZkAZpkAM5kA AGb//2b/zGb/mWb/Zmb/M2b/AGbM/2bMzGbMmWbMZmbMM2bMAGaZ/2aZzGaZmWaZ ZmaZM2aZAGZm/2ZmzGZmmWZmZmZmM2ZmAGYz/2YzzGYzmWYzZmYzM2YzAGYA/2YA zGYAmWYAZmYAM2YAADP//zP/zDP/mTP/ZjP/MzP/ADPM/zPMzDPMmTPMZjPMMzPM ADOZ/zOZzDOZmTOZZjOZMzOZADNm/zNmzDNmmTNmZjNmMzNmADMz/zMzzDMzmTMz ZjMzMzMzADMA/zMAzDMAmTMAZjMAMzMAAAD//wD/zAD/mQD/ZgD/MwD/AADM/wDM zADMmQDMZgDMMwDMAACZ/wCZzACZmQCZZgCZMwCZAABm/wBmzABmmQBmZgBmMwBm AAAz/wAzzAAzmQAzZgAzMwAzAAAA/wAAzAAAmQAAZgAAMwAAAP///wAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAACH5BAEAANgALAAAAACQAT4AAAj/AAEAOLBihQwZXRKSQfSo ocOHDB86RIRoIZmLFSlGlMixoUZEYwIF6iLyY8eTHBluRMny0ayXMGO+bHlS5qxr NmmilHmtp8+fQIMKHUq0qNGjSJMqXcq0qdOn1w6QIGhQhpUuGDtuXPnQIqJAXtdw bZkRkZdDgsZ8pfhorEeUG2e51enSpU2ZHGfRtIkTZl26eWPihEq4sOHDiBMrPipw BcGDObBWpDmXIsaFbOee/HhWUFnNOiOyApzX7t2GeknrhdkXL+nAN28unk2b9rTa uJcmSuST4GOrCSe/fotI7Mc1r1V+xsx2uPO9p1M7v+v3OWqesnNrLxo7du1p1baL /xfaaneZVtcGFjyocKH1t8gnOv9o8r39hzNX57eePyfq56mxlt14263ASmvYLWbN bQQ2mEgZ5vXk2HoISTZcGV+UAVFb9yHiiEaOJALafY+U4cUXJ2a4U12r/QWgaf3d l2CD2gnU2F2DJTYNgzRuZ16E6f2GkFcsmfgFDS4QoCQBGup0ZJJLukDDFygl0lAi jnSUiBc1uOAlDV40SVciX0C55Jk0WFmTixxt2aWXNYS55n/Stcmlly7EKWZHgg3Y o2Ks2CjooALpOA01f+b24DUP7vaFhBS2JxGGT55pKQEu0JQIDZdemqZEWHLIURlm XqoAlS2R2mmnNPBZZKmWnv9aU4sdqbqqrBLp512isxU6aEEr2BhIjoQtOI01vNLm KKMQLhrVeldZ+Aisq6LZkhfVskoXtZ26oOZJ2GZrqbeAcXspuaSZO+63DglGbLKE 3QRAsPPWe00B6QX70mE7HgsvUDRAIDAETN0UYRmMOuvYQUNOloi4ne7JEacQn5lp qhWfKfFDX2S8pAI6leGxkhufJPLIG7v7L1Sx2ViQoPdeE2xr7zJFTb8r+0TwTzsn xduDj/7sLFUVXtTQyR5ffFINIytZQ0sPN83kSTpI3SpLUTddMqhST92uaTXnbJR3 s7BCwssyr3DNCwW0LTNPUPULXo9HcKADUK3cnQUEWVz/I7BSjS6KMJCRSsYQ0hk/ fRLFWrfUNaYndSz11g09rjRKlue6r59ic4fgVI2lB8C9bRfwiBUwho3UjtLgTOBL RwQBxAVAWKADEIIMLHArAivgs3nnCf3os+xh5VC4Hm8tudTscqQuxFdLhEXX0Tv/ OAHVW/949qx1ftTmME2IdkEy38si2E/JveN4I3QHUyI7AKFzz9FAoIACNBy127KD K1yVZGRoyPIsVSZTYe5xLBlg15r3iB2sykvVuhzHrqckBgqQggT4lq68RxT3he9s 8yJfsFYwLCsBoF0CYsr65AaUYQXCCsNaDF84x7P7XeN+vhOK2poVvIQhjHhFi0jV /yJWogIqCQvg2h5LMIg9jiDPYldSwKpOwsTsOaSK+NkcB4PiwZeIbwVnU9vaSle6 v2ixKdV4gTWM5RORuPGFMExMTMAWjQG5QBBASUAOXTAUMj0IYf37YaTc05AsrGpP GHKBmFYiRYgpAIJLQlVHnmiqEzFuihJRoJKUpkklTTJbCrCkuD5ZrVAeaZR02pdh ZEO2nrDyKeDzC7BmGYhWkPGWKOwesVrpnfC47Wb+6skbA8EKKxjzMHOECQ0GMAAC DMAnzATKI/GXgJ9k50HlCZoPIQUcL5AhS9M6JFwyCTFFTtBrHWlkpyRZomyxM5zn cgjizpTOarFzngTkiDovdf9Pd+ZSdd8bTHcE2pcctfInrEioKwnqmlkCaxC3RM81 ZHCNr6nyorHU4iyO9YIXXGMarbsNIq7hRmPCkXws6w6LZtHMaPKxpdeIZk/w58oZ Bg2QCXvULH7TBbU0yVxbK45wHnFJbY2KACjB55K80KZqZY9bIGsIJZVkRaUqialc W1X2rEoArD4ka57KIg09RzbqmLWsPUloQsuKl9UEAlhWKJ1HAzGDayDgrggQxEoF lFHq3AZRH8VZKUhaUitcw5grMKxSeOmXmCwTU8x05jUIIAhMDUYB0biGIKgjOPQI rQxe/N9FwGkuJDrkC99STkOeF1UtoaSTBGitRIr6sdn/YvIR+4wkR2Ar24fQVkm9 5e3ibvXPsQKFrWdNLo7UutbomLEgbMMXAPBKXQTIQFfKbexL1Ke+hL4RhsY8EB5f aVCGCrStLjFFS2dw12u0oBXWRcAze0IDQeDPBQOo00t285PPvuQxV1mImuyZSE96 xCJX9OdwfksAxe22WhIB6hdyu8mOMNjB5LxtQxichchB+J8Bze5K7bJXm7SXuWqt zn9g1LZATdeuIrnrLNgr4lw5hLvruwYrvjJMu1J3oeU9r1lR2FIX3FUQ1bUrTPB3 v2VypAvXaMUXWDGLQXzWJVUZUgArlzH5BDAiqExqGcY8ZoeYy6uTqtaentetk5zZ /2Rqfoi5dADnValJl0PpomvwY8YV83kWDmhvXVFMZTpdJybSBYAV8Erlu5YiEAho 0Z4NHSCLzqIa1ggPK0rBCjf6+Md1NaieT5NKZw6gvdVlr3xxcr9qomAAeVmUYSGU U72sJzJe8FA7uyyfiMAWuLZ1aoI7heGHTHVJax5Zbx9SrWIfL87DvpSzpQpt9All 1Hw+n376zBG82vXbCYVGQtnUH9YAQAUAYEV1qXtdEtu40tu+dDXmPe9MI4sVh/D0 t3/c3r6it9Klhi8C2PvpT2dqFo+igRUfYR4xsiIRs9ifSwCMFTJYiauXSmq2JMhg JUkyW26uNlGl9k4ua1jOIv8HeUfUpSH9qE7PfqY0ddzdEBlY99MI0LGOZwGNd99l BQEw0LrxSquK1unQd7E3psNzjUGbgqTWQE/Ohz5qQp3Q5y955l1tXnC8yuAR18hQ yRtSnjIcqL+78SJkJJMljFtK4xHM8Ko+Lmy5rxPlUlt2tqz4a3Q+Yu8Prjaeazpp S1MHQTNhEarvOggEHIjK0Cjbn/t0jQCoQOhDR4CLWmF46swrO6rGaym+cthhRZrq d0l3DOlFK4sOgI/8XvdoemJB1JCpJ4PzodqBQ8hjn/whGJdg378lrur13e9sjjuz AX9ace2p+OeENuX5mvg/k9gmQkNP6K/7EhkgYt06ZoX/uMWfyhmmDefsdgjpIG4a GMWEBOiX/YFg+H1IE53Up1O0jWRGZUkTOfPrZhctxycR90M4ZR7dZxAK4WsZI0Ff FWZXonImt3HJh1TL9zjsVDGQBIF/V04VKFbItR/aZlaMEna8UYL2J2MxcVcskB0u WFG5BD44YQWYF4D4UQCSZn6zAADDIlEIcAU9gVeP8GizEAjR4G3X0IIqGCBFyIMC YQUJBQA54X8AWF1ntVK3V4KDkFM9wTAKoQZWMkRT9CBesAOT4lXOJxHKt1pMtCRq SEF414YR1oYGhnT4Z33m9zNfgFpBwxt41QqzcFdShwDQEH7jJ349V34yWIQrMHTa //YIOIgjBzUDNncIdsV1RPcIauVj6HcFX4NlVjAv6cEKBYFtq1GFXodwOnVWD3Ig B5h2MlM8hMQ01WJBZcApDkZhZ4Jm8MRPcYhBEqR8E1ZtFaiBc9iGSpNcMceECeJZ e0gmZbCF6BeIiwdQnWdW1OWJmhOJCTIgs2BzCMAC6iaICGB6ZdNpkAaOeKWN0jEL iZVYgVAoJARk2IiKQTZqD6I2QRNx/DVRsqgmzyMxtkIAktRxsRVsl4Jmx+cxxbaG YGUpXrWQiWN3FFRsd/iJhxcbvPEFgxCNHHke6Nd0d5VQOWdXdfVKIHhW6vZ1qBEo s1AALUh5XOQTAleOoXZXrP93jjpWkznnbrZGivkiimLkE6xkYlU4UXkWFGSiNrwR SBIiixERkPIEK99iSAp2QUQkT3T4TmvYi/l0NFuZZm2IKv5HK0fXZ+bXCq2AIR3Z lkGYZHBZktdQiGfpfjZxdgLxCDBTAOpYXrsCFKQ4KD3RGFTWaY02kqehB2+VNsAC lCEGgDiXlLKxGzt0DVa2P9ykZVmii0tVItzyhldpVRxBh6NJXGamVReIQR1BmqVR l63ZJ91BJm2JIT4xjvbIRf4XgzGRbgUwL48wS7ZEjQdFFKPTRmI0KLyEE8MSSwbi UIf1BBTFFEkWkvrTCkwZZQkjUeuxgBNIbObCceWkA0b/NC4Tg0Wg2SkO8ZBnwk4G mTEL154VY1orMp/Y5R2ySSnDA5jeNp1dRG5o2RD7JzMvgGVqg4ORBlBBUSh3NTou BjOEFQ35RpTC5EWMaVjGpFhQAWlhp45ySRT7U5z81Y9AJC3X805uBz1NpZqliUkD mXEPqKIpCocyYpf7kghtmYVDoWqReVzodT7PZSCsgC8p4H7vYlw/4TJWN5SGlW4+ 0W89AYUoFUeFMTytYAUnCDj5SIMh2o+DFEAnak/lWaIWRkFj504G6YDweZVhioF0 UZY7wRdid6VEwQp4BI7WZA0HQmpm6TZqAwC21DdwY6RDYXWhk1YkxaBvmVYXSlJQ /3YYfGhSTuEse0BrQMJTmPGlv9cQnFkxW3M9DrhrbLqiUvOpqdk0pGpRlOajyygY g5CfgupZ5QGYoyZpdzUDbHMgilYArXBC5tcUgskjg5keI0BSnPikOocYd5UI6HFM TMGDJ0hCqLVNz6KARoOpBqQl1/NaXUOq1hpPHSGR3ppA29oSOUijqmqWBtMTW4gv WUALRQFx+yOn1lSPjlcAg+Big9l/quQUN4MsPpFjEnINwzoCw2ogEnV2h5FkiWVS GKoUGAJxaCdIB1A8DOF7KFpnTbNs0deAcNc14joyp0qR5cQS+5FduWmHErU2PcE2 HooeanmsCxWCL/FjBUCKJP9kNgfAF02BYwBLlMP6VqODAIAAs4WRZMVUBRdKTEwR ODe1LPlCrRYnhk0zdulZjEuycBsrLtOmlaNae803kT7HJuDaYCtSnybbWO2yVim7 NrMwrC3UXrsBdgolmQhCXQcyQhNCAogwfUvBXdXgOuVzBAS7g9/XoQmLVzMAhazA AgwbQw6LWouCTQrzGFwgLSVCZmVoSXjiiy0xti5AtV/FZjRAOVditR5XLsWXMtfH Jl7JKltjtjqIeP7xEmvFX3vIkT+BZHjVgsoafoxipAPyhyJhs2FUEEQKZEbBOsob WEBBsAJbnLLhuIZBXdYAqUkrvUjRKLT5IAU4mJZKSKT/UWYSMRfjaSpTAioh4iGh Ik/lKyVe4LWjckqgVHInC3ztCyYWNGR1UmBRgr9lm5HI641TeGjKyhuXGXHxxyjo oVCxGmIGNbwOlVhg85dGyrM4k1gCWz4+5rYIqxgYHKvYixSjEzigdXtDUzgI9hwq 8WUqUSsosgMnAiEcESIfkr4cMiLvgSGZu4ev+4j8UW6F9xpnFWTXJmoqFhPl0cAF HJK8sYn8NbeMIZiGhVLGO0MaFRTAxLPVgCgxFKAhPBv7YzDymhQPSyZlxyjDox7/ A0CZERpt4RWX0RYtTBch0hYi8hGhgsMkQp+r65rkSqMDrBo0SsSLdcSmUcBq2bvV /7W2EbfAUGwUNOhQSnsNiKBWdiiJQKG8IMUg4PjFAuuYufEIa7AGUcZ5pKwbEDJm EXLCAFYhFXcRieAVInLDcgzHFWHLC2EcWGIlvAxOHIIlGuEVeEzD6ws1xOzLQnzJ aCvI3RjIOlGf5lUwhNeOYBc05YHA6GGnPSELCRN+zHUUECWNj1ebj/ZC8qlcxIJj b5lzInGoAPAEzluctXET7fwTDas/n3XGk0shVhEZC3gZtxzQF2ERF5EQBt0eGWFx aoAIwFzDdyzHlkEfH/EhLTzLLaxa6usIesF5oyHI1+dcfixzKVSUycS6mtOrq1R9 qVGCFRWrOAoUvTvO42wUt/9ERlsIQ27U0X4MN+rDvI/CzsT6E11cG1ZhUjE0ysY0 Uj4zOGX8Bd07rQbBAgxjBf5s0GPgTQNN0GBx0FzN1cLsFWWQ0GKNGWRwCJ8h0R6S GQz9IQy3t4kgC3dcx47AeWsSbyLmpmWps9YkuyWGzoTsFO6Dsu6DnUEBiFDxBX2A 2Iqd2N68iSYLFPTGdP7KdL5LFJ5MGCIxeo+c2R2cFLOglp/dyKAlM4+xAjHAMFNd 1V292gcdLazNxsK8HGARCILQBYJwCGeB1gw90R8hC7391sAtC5o43BGH17CrjDlI gmc0rwMMxCMtQ9QBiC8L2oW9Lwjb2UUxCFmg3YuN2Of/SGj6ylB8QW890TfXQN4o RrQKddnxEgijN1jCVBLEhN1FAYgQl8QIhzCzJAMrwAL7jdrs4dqt3QXGZBUGfqEE /toJMRJYweAj8RVdkG9jcNtp4Rm6TR87phEPV8kc/nCj8eGPINwgXphlU+IkfrZn u9cy69eCWhjY8dmljBMvS5Qvm1nHGnk4nh2CsLZZ0ON90ONA3uPeJd9EeLZdsAqY tt1ZgB5MN9/tfHbzXdl4g0eFgQij10aZHQhWrtRJcc3loay02YgxwAJjHgMGceb8 bAUAruYAfuBufqHGlOAGzeALXuck0eBeIBKdYdZafuEfsWMZDuh7iwhwLQtUtres /9AKskC7ysXNK47Ou0LBMUtQlL7XubE5stAKrLBJWCAiiRB1Mt0KyMLNht4TkfcT URd1BDAI1kAAiY4FLoAFWSDrtD7rfaDpghAIq0BZgpDpUScL0QDsmZ7piKDorUAA pUANrYBp10ANqkBYxDq8SaIAue7kOjfOsL7AOuYleITtLsBz4J7j4lYK4D5MpXAI ppDqoq7pBHDt7j5SG76W+j1LZl4QVOFQB6HmbK7vBo7a/P7vcB7nAm7nIyESJBEI IaHltI0IaNHwGM7hHS7ohJYIJJ7p/UfiJ35elB6Clb6IGl9Qf1mkr7NQol5ZgoAt LtAK0KDoZXPtZRMNrJBZa/91iIme6pQ1C6bAc9nuBbPe87Qu69YgElfQaSZe9FRW WcNOWbLwDLCgColOUo/HXNzOBwRwBTmtUJA3C16CpzpHALBO7eue6OIe7iWO4+M8 C3WU9TluCsIe7G4P7BsuIrTpG43Y31RxAHT/3/2O5sDyBOtx5v9e1AEf8Aft4Aef 5xEu3wxf7SKR618R6BEf8YbOXMbOCsPO8jgReXlaR4TsJ94oodO33Mi7MoleWSrP CrEuC+ImCMwFDabA+oaOCDCf6MLO+gl17LZPZbBO83jK+pquVoFwBYBAp6yf+2ol CNOTa5u+46wf7All+9du+ZpPWZ029FYvfnSK+ljw+wn/RVmtIAixbvnMZfymEG7P z/2sX8mHCP6sT/HHf/yIAA2C4BlAQ9oTUu95e/f7feb8DRArZKwQSHDgChZPBlpZ YUWGFYcQJUrsIlGPlS5dAmnUGMijoDGCAh0KJBJRIESISLJCGYglK0QwWc2kWXMW K1kzZbViNQvarGg9r80aao3otaFIkypl2tQpUahDo0Z1WtXqVaxZmc4URIAmFhes uhIgIGimC7Jlu84EKzZtWFZl45pt25VuWiw0XRLwwsoFDbRwZyJKS5YwlrRc8db8 6gIuWMdeCS+uKfds3rplyaL16pYs5siduzp2sRZmWrMupCggoECQoDJIDwBYcYCg /23bAA4cIKGboMGCv4ULr7IiRkPkMhRKfDiRIsYuejh6nO7x40jsHlkiKvUyZs3v jGm22glN1jVW6JGmT9/q2vmjWq9OXUpV/n38+BUrzusCtF+4CMDCtLYcYwUxs+SS CyxB/DsNM8lSIkwQRNCSYkLG1orps7m6glA8sARkS8C1UMgrrhNpsuzAsDLTbEC1 RETsQALCclDE10wzkUW/CJBirvSQ0o02225TIQAVfCOhyIEOOmg44VhAyKAnGLKy Oecmuii66qzz0jqRBDnElJFMOcSsMccMT7yZyIOGFWt4imYno4JsKpr88tRzTz6b Umwxu9wK1C4CSxMQrRMVvP9LgcdMRKuvmFLiq0ICNqRQJkS6klDEucBCbMUMZYTr NcscrMys/TJLMEEsPGXtrtT6qzGvtQb1Ci1L7STyttuQDKA33oos6EkohyuOoYKs bGi5LDFylsuNpuvoSy9FStOU7w4ZjE2cZrqplTrVg0a99GTBM74+01V3XaRQ2kNA RrFYxQsCViG1K3vphdElBmddhbvDVhFwFcQKLgWx0koB2KPDDnHszLJcCsRMxCSO eEKEBbEXpVLEDHMV/w4BS2J8RfJPYpYGFgkxgl0oqV4PQW61RkE6JpgAlE4Wq+BA cC65q0B0Hlgp3ZYMboUji56ttt+ILbZYhaJuDstmLar/KBArqNXaI5JWmTjNUlwy 0xRu25zJGprITYqoc9l1++09w6Y3bIR7xiJolwUMGucrInbMbo9GjjjikSvmOei7 T+rZiy5OBjy7nhXnK2wB+747ECnuJqkUAUUmgI9ARrauxpexIIlrvUPXu3AFPDrZ Mctdb9WFsE++3D8EAf/b8YiV4lU4AwIAwIDeADAaOKefJkhK5QSKetmIqpYua4ym 3+j6rckUc+yY/i27pjjZQ29O8q2JxihrkEofbvbbr8qjd73E+VOcVa+x/sJc7jst jwi4ouf/XcFlgRAgAd/yJf8FjQb9A1Pg6gdA1/2PfgMUif1SV0DF0Y90JXFdYS5X /8C+RTB0LpsgAQd4ssIw0IKy69//fMek2hygBAYAwAwDUBsSIE84woLSQIrjPOVg iWpZqogVLhII6VhHD1v7SNe0gzJTeO97Z2MFuMhDPvhcA09adF8XvWidaX3pf176 3wOvMEbrnNE6e6AWGqeFRmplBIxMpM7W4ChGPObRjnds4xjRCEc+qlFrfPSS75pU kNnMsIY0XBIMlVcsFsTgCUBUCPSqBpHpVSQ6WQvj1jqGMpewQlusIBu3vlVFWUDD inHSorngYxSkoMuLs0wXHdvougHaUpe6DGMnd/lLYAZTmMPcpVJwwzQDKDIANPzV 0pr2Gx4+7QnMk1qVHMIsIv8a0YjQ4lISmeg1jYVTbIiQIpvelEpU/kSd59Gi+Wj5 zrfVkY0a2UMXAPE/jeyPLFeoJxjr2c85TquXbPxnPrHHkT0AogsFvWUg2Eidgvbz CoCgDkX/xwWAOtQjFiVgR62jUDBSlJ4GraNDudDRhXYkpd7cyB5OGgiMduR/nOzn C5EpPADklARIUhpwhHO8px1HOZIMopUuKZErcGGi1FuiLk8STnutYiaj/F5OrpjK VQLFJ1TZIjy9qifp6EE6XNCDS+8ZCEDoYaJn/J9C05rUJerhpHK9ghXuqYd72nUP VlAqXrtAVnsuUa+DVahZo3NXpdoVaxjlghUMi1esWVS4rxMFRD3TWpF7Jham9wQE Z63wP7WStZ5l5QJnpyfYkyY0OnNlbBLpKleTjtazHoGtHoiW05z+KnhHoiFtaFOs aPYQIZNESFGtOUQtkXWtWLte1rbGnUCUomvhfEkpy8YTtPXkJ+Jz5zXG9Z6vhle8 4yVvedmFW/Sid4Yl8O1vh5PDRz4hBiyowlChEAMoyKAKUDhqXRu7VOaW9LkTE8lL QqktVF03fFsdV09YOYvumlfCE6Zwhb0aEAA7 ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=Title2.gif Content-Type: image/gif; name=Title2.gif Content-Location: http://zippy-egoboo.sourceforge.net/images/Title2.gif Content-Transfer-Encoding: Base64 R0lGODlhkAE+APcAAHcyMq2FhXhvWTtBEzVECraLi4VJSOPMzDJBCiYqDJKGeENK FphkZJRbW821tcSWlik1CCktDWsmJk5mEDA+CR0mBiw6CDpDC9TBwFtrHjhJC11m HrurpMGhodC0tFQBAUYAADYAAGB5H19vH0VaDS48CVlhHRgcBmNGODJKDE1kD1tx HnQnJ4xVVVZWOUoqFoI4OCUwBwcCAWJRObR5eUNJCyIsByApBiwwDigAADZAC1Ze HKRcXDU6ETE2EEJVDFJZGzM4EV9oELubm1JjG8WpqU1VGbORkcqtraJra9m9vd7O zjk+EtG4uC1EC7Gjl5+PhVBoECQuB0xaGaN1dYNtXrmTk93GxiYxCTZBFKOWiURU FuXQ0NS8vJ1vb9nCwUZDJtfFxUlQGCczB2IAANrJydG8vKZ+fUpgDhcAADpKFUhd DdKrq1lhDz5RDH5AQGMdHDM9CsmkpOHR0TY8Eq10dNS2tiw2D3QaGWZdR9/JySkt B8mwsCkwDltkHlNaDjE6Cauck0tSDVNQOeTV1SMnDCUpBjMmDDE2CDgTBN/Q0Fxl EFRsHC8zD4YoKDpLC9W5uW+BICs3CJI4ODk+CpRPT3crH82yslsSEsu0tOLT0zxP C0xjD7F+fio0Ds65uT5JDDE+Eenb20BGFSQTBMOxqjU6CXcDA4N9ZtGysjxNDH14 XVBfGuDExNzAwEpWGD1IFy02CEw5IiAiBycxBy0xCEFNGTpMDEZYF0tLL2RnQNnF w4IXF7JqakUVBpV7bUheGDlKCzQ+EzpEF3RYRDsoELCYkU1UKi46D9WysoEyJE5b GeXY2DI3EEZNFzI7Ew0QAys/CjQ5Gi0fCFhnHIxnYFxdOj9DIbmYmCslBlVCLWM+ Kte0tM20sjk8HJEoKERQFio4DjtHDMm1szsyFUdTF+fW1jkxG0M4GzA5Ej5OFVNb G0xTGTBHC0hPF09XGnEwMDZHCtzLy45LPtS2s2xJPj8wCGwQDlwMCzhGE4pOTsW6 tU9cGVBoD19oHwAAACH5BAAAAAAALAAAAACQAT4AAAj/ADVoiJeioMGC7RK2c8KQ IQEdEHVkmRgxYpyLGDNeRMCxo0cCIEOGHEWyJMl4KAWqXMkymMuXj2LKnBnzls2b OHPq3HmrhrOdNIM+qrGg6IIaLlkqXapyAVOBRJcanbrApVChPG+pUuWsq1dn5XCx AoZrq1mfZtOqVbVpk9m2cNu6mUu3rpsfePPqzUuir1+/awILRkO4cGFOiBGrWKxi 0YYNEyI/jtxvghAhE/r1i+Kvsz8hUTSLHr1ZiGfQUaKY9jxihAgRoUUPTHHrIEKF DXNHqwhRmG+NwDF6HE68I8gBA0iKC4kSVMkaKKNHf7rypfVgQokevcq9aNDrL5dG /2Upvbz58+hPptROtWiNlU4FgoeZvX1RcPjBbbrprIaqrDlt1ZV/W8VloF117aXX O3j99ZdggxmGRhuEIdaGH34swthikXVIWWWZiZZaaqSVWNpnoal22mWgmaiBbQbh 5sQFFzwU0W4W+SYMcID06KOPFAQp5JBBcjTAcMjBoqRIBIijHAHoRSnQUdSxxN57 VWZJXZRcmifSckyKFI9zJYFCpkloQleeliq9xF57SNHH3UxvGuWVVmkZCBeCdCmo l4N9QbjGDoTuYIJhFmKIoYYcLuLhoyGaaGJqnqEo6aVRoASjjDTypkM0GgnzzDNx /GiqqUSmKiQTQhqphjqwHv+JQEgD1BhmmF1yCV98bGK5Uq7nnVkSmLcWaywBoyT3 pDhOlgQLrOosACx6TNW5AH5b7McmVEe95B5NN6mlJ59+8tXXH+im+0ehhZrg7rvu Ksooh49u4NmHko4Ym74kXjqpPwSpYuZtCzlUUTQIYzTqws+cCkgsEEcMcQkUV2wx xaMcwwSrlGw8wKtq5EOcrBwda/K0KKdcXrEk2XrBKLYeJ9IFyCFX3Mg1x0wzcqM8 qw4oKZyscnQkFWXLFrhscUs8UA3EtHhG1eCrfHIOVQOeBR6IoIKCvPMOukAAsc7Y 67Db7rvUrCDCChlkyJhjjj5q2of8jrhabCXqu5lqJKb/hppooAgMdAoyOkHABTfq kBHDz6TjI8SASAKx5BJbYPnlFlxcAgNn0OH5xh5nMUCRCFBy8+kEIBezyax/2bqx zIrUcki2nm777UZe4FHNvA/3+rFcOgcKymiiyfTTLVklU7hZ72nXXl3/4FfYZJdt tqHuZqD22vL68dj331NmWaXkn4b3aH73PaKI/PYjzuCEJ8RQjbwpzHA6+Dv+sMT8 R4z5/5fbBhvm0QPPGZBiqhrSzXbGu9595HcQLNbLZicSBDCwVh7RHe46ksAhdYwJ AzDdBjcYwRI2q3jFGx61qqO8RzCPLc6bCztmaARB7IUEYRMb2dhFjR5SwwRpWwHb /xSlKPCB7zLl80y//MVE9K2vHTHCTY0ukAgy8IIGbEiFBzzgAAdk4otd3KIYx0jG Mm6RHtxIIzfY8AA2sEEZPYhjHOlQAoRFA4EdJNLGREgJm42wOCUMiQVp1MBCFlKE wwnSBzeWx0Y6UoG7M6TqbFdCGtEoWSh8UrHMIzWltNAmb4mhG2bIjhp67ZQ5rB6h /MCItTHih/AiYgZmOUsjkg8162vi3izFxBEdhFMQ2QM00vCBSchBi1z8IhjDaMZm jjEVaEwjJFqhhF5YQhKSCEIQCjiRLEQjcyUwxcVUBTpKdHBkf7Rdzi4oyQbmA2QD YJWQKGHOVDFSSJqjmCnoIP/OfOIxj/X0ICPTmc6cWTBZujtcIVcXJvWsiYU1wVoM BUFKIxjhlF5L5dgK5YceYg9eJlCU9iLBNluyqEW61BulzLfLFqmoM1EsGOJsFA1o yCAEvHjAFh3QBDP41AxdCKpQh0rUonZBCUhVgisO0IoHTMISscCmJJqBTQBizmL7 NODn9vjIVBGUI31EZB8lCTrQDSAfRclHPva4SCaY4q1vtZhW56pVcVpVn/60GDnl ec6vdgQ5OjjdJG/GJJKI6aFUq4kzmrcJN1C0ohdFpUatxy6QxkuWRtyAo0izRCfu q251u0wuVQQaghXMRhCJxiz+IYMc8KIDXdiFA7wAgNr/2va2uM3tbWEAA2VMYhKV 4MEkvmEJCBj3uFKVKubkyFy6ei6fXX3kIgM6z7JaF4TdZEIW1JqPiThXq3GEK3OZ awqrmve8Vw3nxfhZgugmULAkKw4iR7hJxCoPlDB0rBhIWcrIZhQIrCCCgIlwPbQJ cYhEzKy9yofSXaIIb5x58Gc7S9ooEKwhFbnIalkbAkdAggofyME/RkziEpv4xCge cRpCcAriHvfFxk1uNrWpzfH2oLzolWs/xxnd6dKTnte17nbTmoXvxlFHdLBxD2gc hMjJ+MlQlkSPkovey+lzx/50rz35OiQmUBeSuKtvSjTwnvtmTRBiEMRcftBfjAaY /xFwJgJlz0YN7SG4iJn1h2teM4Iklq9vq+Fl3lZa2vgVjCEIUxwFNjziEOBBxCmO tKRNfNNTWGIMmB4DjH3gA0QYFxHNaAYisAlqJkcOvTc2b15XndXvuloYWfCNkuVI hyyAIh/CoHGody1qqcL418CGwK5HnVxEEBub2wzv5UxB3orFNa9ajnarUIer6bSp Jlmby2Np6N93TLbA7vJh2xKc59aIoDWd8VulzP2a8/Uywum2cOGcYEdQxeEEJU4D CEKQBhlM+t+RJqYEaJHpTBu3EZ4+bsI/7YNeRzm5gEh1lf8XTjqW4KquNuCsN87k IDyjB6PaNacXHuySm7zkpP8ONZT/x2wcW4DZmbPcqmee5ehS+7Bj1oB7QCkXNEMW o5OdM6GAuL07Y0jBlRKtZl6q59dE4tydxVSE8WZoGtFUcRfBN4lzQAYQgCAHaQC4 2E2cA3zE4Oy0IHimG1HwX5PcuNdwgdxdYI2Hr3zi/9u4HOlujb7nQo4dD/XHRfUM Thv+8IZvhOIXj4iCr53tjh+D4jUNAUx/GtiI6DRyowwIGrscc3zvuy3wTvOaq6oj fU/9MZiEkjfVwIV4QrMY9sttfgiYFaygnoDh7FHsiZuIR89zZ1w6IvLtGd0UVs1J A22+hIjjAstBXMIuAgitjzgH9yDDB/bdB0/04fu0iMH/GLCwhwjg4A538EQMbHD2 7+MAB1KIv/zjf4I04EMKZ89/DLBQC8g7vhYJlw4ukAe/gA1y0AFIsEWQ8AWu4Aoc oACrcAybZ3cUKGXaJFWAcA15UAW/0AEdIAdbZAdKwICl8ASokAci5wPPEAosmA6I t3iKdwjFMAMCUIM2eIM4mIM5uAp0F3mU1wiaZ3JT5XCSMAzWwIEeCIIeIIIkaILW gHcTB10UMAp5sAod+IEK6ApNiAq6ABLRQRRI4UI+4QzuMHu0xw5TYHu3l0MCRg2M IGBnE0sYoj1rkwHg42d4mHSgxXy49FJR0A7MQiOIthsKY33/EAIwwAIsIAGY4H3f /9cHjXAHyHAHOBABlhgBCZCJUhABm2iJ8zd/NgANpPCJ+YcFWBB+PggGxHAGR9CK SZiAHrCAX/AFV3AFenAAGKAFApAFKEdqFYhNPTAD1cCK2IANHlgEITiCX9AKtngA XwAFeWB4+QOD1Kh49RcCH3AGSNBFyrRMDuBMYsQNkNCAraAHD3gNmNZ/i9d2wTZy yCCMxGiMHYCMS6iMzHiLz1h3kgCFVVYCdACPR1CMx5iMs3iPzqgFukAmUeNCW+EO ZXiGFgV01LNRZoM22jNLfpABI8A2dvg9efiR6zYCuDR8/GIaoAGIz3cBiAYRFzEq hoiIiigBEuAD6dAIjqh4ff9giZm4kzlpA5doA0AZlEJZAbPwifGnf0gZA7JgAA3A AFQQkB3AB03QBLuAAU1wBcygCQegB7V4iwfwlbooDHB3ciO3advQlF7AivN4CTxl lV+gCXNQi814AFzABU+QB8jAgsjgA9XYCO/3fgkwTCDAAEXQRQ7wCWbwCVO5mFMJ CY75mJBgB5KpVOVIl1wABc9QCzhQC1jgg473aeRwlgyQlkewlm3ZBG8Zl135lXX5 BPr4i8qVd9vQAqOplkXAlk3glnApl15ZlxygC0UTNWP4kBDZbRNJkXGYNnVIbuBj bui2Z+cGkk33dH0mnYVjES35DC+ZiDIpAfjDl4p3iQn/IJRBmYnkeZ7oaZRHmX+H IAEAwJReEABFgA1w8J760ABvwAL6cAZJUAm8ZQXm8JUC+pVPoAW9UAuYd3gw9gIs AAD6wDlD0AEtIAFvUKFvgAdv4AUMkIh1QAhcYJl1GQjegH44oHh/eaJ/iW8yAAIN gAQY8AV8wADdqYg0WqM0igc4ygNK0Ix1yQVfMAjvx5mnqHbpuHi1MAYv4J4PegYR OqEWeqEZuqEs0KEf2qNcEAhZAJtQlqQOCqESSqEWiqEayqEeCqJ2KQajIJzDOXs/ J1k6JHQf9S7Al1nQ2Wd1eksvBZ3nhm55GBpCID+dgp1x0DiGmAPcKZOQ6AOTWIlS /xCUhgCUhvCoNjCe6FmpQqme8ecLZHAP+nkGZ4APbwAC/7aiwtUJ5lCXB+AKD/AN vuCZx6V4lTcGe4APnAoALRAAZwAPHxB2khYCDWAApmqlu2ANKOoJ6Jd+fxkBG6Zv Z3AJDAACvDp2/5ADeOAISdAKqHoAkJALf6l/aWeK4LoHIIAPEgAPt5qruzppvgqs p9qjw3pyEygJtfABmMAC5oqruhqtKbauwdqjV6ALUYEdt9AVDsmmNLQMaoh7b2o2 bihEGfBDcyp8eMgiJXl81fmR+5IQlpRaWDcq6bCdi4iokbioEUCekXoDN2CpKpue 8rcHmkoGZPAGLYAPoiqtjf/GAzxQAJ3gCNuXDZ45BuqoeLVwCB/wAWTAAgzQCZhQ s2PnqwXQrlywBALgCVSLA8aafp5wicpKYvoWYjZ7YjkwCZDABXrQCq5gDOWHA3uw nkiZDSBQtEh7Bktrs04LtQcgAPCKXOIKt5wzt9Jatz16AKvANNrhFQ85Q1MwBctA BG9IBLm3sIXSQ4ywArAUsUbUIXx4PhWGPsz3GaKlN6KhsfTzKRjRIx9bYjDZnY/4 fSVrA5JqCCgrqeSJsrRbuyi7sq5btDA7pUz7tSrmdfuWCPsHrpjGf9VItLrboB/g u41mBaIwB0twAPIgAOmntda7tVwbAjkgA/7GvP+QBrz/IAqtAAmpIAd5YL0oigOH ALwfUK7L67s35bwfupUCQHknJ65e1766yrzxKwrzK7g6Zydk+JCvwAo9RAT88F8B BocVCVKWGzeW0bkNdiITzHT+4G6bsXSpIT8NUW+lAginu3WHKgE5qZPj+bq1K5S2 u8IsjJ4RkAhF+wH30ADve2LQcAInQJREicPQkGIrFgLZcKKcSQv8h6JE+7YxrK8k dsMnMAtOzMMoFgIdIApLIA9XgAECcL1a2wcVQGI35XX8JgPQMMZkXMZm3MMmFgIP YAdy8AAF4AWWaAPxV35rKwXZEALsC60oxsREWQhQfGJSTMUHcMX1y45ttwd4nL96 /2zDThyUTozGaTzFX9kKrbAKU2G4bJq4y7AMqGTArUENBFZZDsycEDw+t/Q3e4PB S6dEInLBm+EZKYk4n2JHHxzCjXao8FDCmYiJmQi7N+DLQMnCwrzC5LkHiQC8ZAAD vTtiN9yocuzMcvzMJwDJKhYCIZB/mpm+tXB2UpDIMQxpXnwC5leii+cJ7xcBJ9C9 W9cBzFAGYYAB45ALWszLjJYD8IAP2wcC05CJheDLsZsAfWCKmFgICTAL1BwCchAA NFAHdRABe0Ce8WcD1ozH2wfOIyYDJyAFaUfEQft+6RzJ7bwLXxDPPzsGtGDNiqzE GA0BnYdjFVdeFaDOjSYH5v9Qtq5AD9YgwGRohtz2DvywwKAsYEIHUomhAsH3PaV8 UnoIYSXZuSnyYJUSy7KMdaZry4doALz1BgygtSrsz8KcDVcABsMszJk4Dd6MB8uM 0bgLitaXBjkwDXP8fnuQlLVQC6SA0h8AAMsszn/pCeHwDJNozif60VuHDfKAARhg BoFgvTuZiYwWAlbQnXAwDbabAF79z40NySFQAJXQ2ZWADpVKCjmA0vAQAiYGDewX A7EQDsgQDpT4l0NM2Ndn2F+AAV0QCCUt2qQdAjJ9AmNAZcxWQAa0MbMg02qcqg04 BJc8wLP3CpqMsAuMezskyrE0LyoAKZ0RKSfCUurmZyP/6bnk0w4bi50ea9UhUAdJ QAXyGceQ6rqxO9ZvkArFMNYrvJOjTdHpusTQLJTl95NBaYkP3cM31YkOXcfztwc4 MAs5sOAggAf5zVqzYH7GigyBnb6VGAGFINM5kAmJ7QB8cL6N3cs3YH2Q3Z0ScAi1 awj9vMIqTtCWbX2GiqN4AAcofp6zkAZuHQJwsMgjdgIxIH+1YKyxMAbe+q2GoOGX 0OEf7pkVgOOjvePRKgOz4GkQ11ziRAEd0wjG7QGuoATckAwCoNNl+ArA0EOswMn/ BbnUbQJtoBiNsQhwDucL5g+Z0d16iD5JBBqrwSLrJgIyRW+EOKiNY94dgA1FYAby /xAIWgAFjN7ojv7ojP4LZ8AGnTDfK1wIZJ0A9cfgIdZvPX6ee/DQQNnf8xwBw1SU ntiyl/iXNuXWbwt23TsLJ2qsgj3r4WDOl6jOxBQGfIAERWAMIe7PJB7Z3Yni9E27 Le7HXIvERUvZQVl+gSkDOI7HOB7rqw5/bJuU+afrH8Drvm4MQ7zR/NfqKwatnv4P hXB4u5Zsc9RPHxQNuk4GX5AKbvQA9xEWwDAFr0DmZo7m3nac4OYubc4Jbw7nHeIY 2e1gfYjB8MZg+8IaIhAJKfkQTsCShIc/hggCepDk8rAEGPCNZkQPIq9GJO8KbFAJ lo6yhbDyCbDyLh/i0u7WRv8L62KMngkg6jZA6gA+6g4d0znv0M+s6pZYCBedA14H dv12AhZ+4eZM6454iYw2rfJZBIU+AyHeyyR+BN0JD+dgCBXw9WAf9mGf7NbXWokM AtlAu5Pa8hetb19X7eJsvQe+zfn3fvnXxVs39YWeB5tpikRsCG1/9HAPhOreDDVG a1vFKmNQYjkQAGwgB20sADUADmLBCvouBs6duP71ZnEW8O9i3Y+yCAmfyhOWIsrH Z0mEN53rDwsxuvmgJLAQCoOe8aLQBWWgCIrwBYwJmbwPmUtVTd+Q8jfQ8sRP0Ma/ k1p3U/ewb0ifwqN+8+W5k0B/njdA6qF+/QcO43CgvQv/TgrXS7VZK+G3XsLWW/Yg MJ9HUABVIMwkjg0AAAMyCwYuP/YuX//1TwoyLe3WbNmYDRAn/g3MASdEDoSkIixk yBCHFIgQY8TAUWviRIEDZYAogu1IgSq1LE7EkvFfwRAHc5Bq1DJdKJjPmjULEqTH TTo56TBhQoHCrIH/Nsp58KCAF1vgcC0t90qMGHbsjBh5V5UVKyJZiezg2tXEVxOc xHJSUVbFhAkb1PrzN6HfW7hRogjxJ2QuW38jRIzAy9auXL18+7IV90iNGh06siwW 9uxZunQm/4VooE+fgTcAJLDg3LmzIxaORIuexKPXpG/Fbtyo0LpCIdiwExRKkEBK /x9oQUPAAJEyx6zVwVcbql3ceII9NpQr39Nw4R7oC5dDlBE0R2+V0xr28RQOmScc zsUvLFR9YIgmBQoECCA8uCGTIY4w8HKmw6DYrvXH5n8u0cE0ghIqDVISMIS44sw7 CbuUtBtvoYikgC6ii2KwQUD01GOvwolyI+iDlFLKpqVGXgrlmR5moukmnHLiiSc6 FMxQvQL+WAaXcnJ0R4xXXpliCqqqegerrYhYp6s20ECjja/GIssstNBahC234Oon isGyzHIEIUbQS4S9tFRjgcOySCyOOBx7LDIB/0kjhzQUbHPOOdMg4xRHVNPPNUNk q02KCBIwT4YQyGDQvRuOU/900QTES86G5iJYTrmg0ggBxN4S4c6TPjr1ZCZOHxTP w8kCoOJUL2QprpA+CzEpBwCs6MCBMDjQAgpcc9VVVwWO8EICEHprUwZEawuK0A+C 7a1TZvtwLkIcHopQIlJDMBVVMDis9FJlEyGxEUTC9cGHmRABxBQLTDFFpxeZGCC+ AOqgoZdeZlAKGGBwfAUYaqhhZRkhsWKEEWqM7EpJJb9qYyyzzopyArz+eosuLSvW KxKMw+xLCI6FEOcCkBPTIY7GHEvnGclkiFNOOluu9ANeitlzv0axkMLACqwjI9lg E3Gv0Qg6XSiBF1xg9DhRJwVqoDSUDdaXT5vh1NNQGaL/WuiGlhYqBH0aaKEFbRC9 waSNzPgkjCXCcCATttt2u+0ihjjijMoCAEFBGSooVuscPkg2WU258yGcqiGEaI9o 95gWopw1AqHrr7W5qBa+/bbcl0bG0BwCziEYFxFJQrdgdJ12GmAANe44NoRKeHCd mB+YypHHH4EMcsir1tH9YITBMmFhsxZZ5OGOJ5DryojluuvLvMDM6+KM/YnCSrg+ DvnMkkMZIAut3ewtTpfD11nmmfcULr46eAZhGkPeqw2LPrAINIFEzChuIaEXdXS5 PV6FAwTLHeJThRvPpgg4Pwy1oAELDNt7YEO2ECzBDPLQRNowcEEMZhCDmcCGqRiA /40i9AZOpNDbDYiDBSzU5lUSsBwZDoE/rIkqAtGiYYQwVIkFNkBytYgW3/DQwkNo bnOIGNe4ZhIESYzOAj3QSRbyoQZwgENAOWjd67Ygu3I8JSpSuR0QvKi7I3VlB75z UsOktAG0vMV4csGL8pD3JS/tRTBxDJNd3jKX6UXBetcTRhZgkQ8mhIJNOgsWnMQX vjR8QE/lc41wqmWAv30gG8JBkKJy0AEt5GEQg3BBJzf5SVByspNgiAB0mvOqN/iN DGRoxNRkCMMYzm8PCspBZSyDAvf0STI5MAAc4KGPFmDmDcMkZjGHyUJlYcILX9MH OW5ggz/Frw8qtM4bVrnKF/82hH/POhwOFDctGTWgEpapBw1xgMprkqEWQhxD5zqH iCOyiIkuysLp8kGqHPCgEvucBzi2gC8caTEqUwkYKwpmMDH+TkmcaEMbhLcIP2xg eFGi2GCmR5eLVkyjf1Ge8qxHgAskpo9ZOBFkdnmPnfUmIpNyjw3ENgtorE9vM+NP IYJTrQZgAhP4wIfYEnWcmDoAA03wgAOM+ja2OcAMavMCHBLRkAS8ygt4oCoePHHV UHGHcM6ymid8QMBHVUsfnXmBeyoAHwGpLECHdFnTjkCrfegCq324WXGqRYWq8sKU j5qUhJ6zuMWJlTMSkAAOLoI+qvKCF1gYQy1a4k7Ohc7/XPJk14sGgE99fEOzyljA AsDhDGfsCCoDDZLACIZQriQJYZwwgR9c64dFOCxKyTse9bCkUdzWRS52hMUwrqcD YZTsGYAAhGR2M1hMrHQ57WvfM316gjRMgzWr2U9sHKmbAgAAHgAAAKIqaRxopEEC epDHFcwbBvSG4RNIKEImMFAGJGAiDdAoRNCYFR8rwEC/k5irszYVy2ZxVTrKwSxh CdsnSkrmTWtla8vS8IY5KCLCT5AGeKI1zajqJr8wmMQkJsWcUtrgcKUE7LQEywIJ vMCwGNEwhzv8rUa483Ohk4QpWFRZnlzWOpUQzTeUEUVc4AtfRCgYK4AkJC8CAYy8 /0MYGlj7Wj+U5WEPu+P0qlzR3G7UylEohxp8G1LgCiMOxCWucWGAYsJGhK82aO4z XSq2E5RwusGJzWxgcwNSgcABltFHJUx4tNoYIjc5aAEDcui1FugDWB84gyKKAA8Q KMRT40JGfL7QANfxYGoCfqV4kCPoavIUH75wIGsUnBLwNZhOOcAGISIsj1JIAyLz S0Cev5BpHmyTIckZcYlNHGqeYmLFMTAJCG6daRjLmFwzSeLo5rkTy1brDac4BS/w AOSlAGMKy8DXj7r4xd0l1Hetfa2UqUxROyoPy1nerUWtpAZ1gINMZgoumshsZjRL IAbKVQ5zWepTsdFG4LNJwP/YdIME+iQhCecAdMHxzFZCnaEF+ADBUwPch/ggIQl1 4DgYmrFVGTbL04LSSAgwwTOf5RKCwToINFz+cpjH/OVtykEBmLGEMoQhEH6i5nk0 zvE6oGPN0/F1iVd3D8slYtgZ37i80NHYx3bOiDSxyY1d5BMKIGBQIcDDnU5xD2cs ALShpd2PWMEPtL8jyUtObZOX1NrYQulheKkS8vKY28DotqNuvKMQYHEYLyum3mMu 8xTPbOB9H25S7fswwOksm4HTxkAmSSQDTlWHBv65OG1+OMQLQtgXjEdridw4DWgw A2aF3Ksgd44hrOO3YH0gEZy/gausAw988GwajHxNTWP/s0tsLAEDn+BDHo5DeTKU /vQfVk6JvwnYCxFkZ7D3xUhi0Dg3JV9ep9dc1N1JY0BY/eo+KYHOvH6KF3R27O7w EZH7xQgi8EPt4A7jDlS72jb44UnmTssGhICWdcuy5tEYO6KeKtOjPRK84BquwtMN GDAwCdiDxJOCDzME5vsZ44i82UAU7DuJ+giAAsiD5joO9/AQGZC5mSMITAC98SgE DKGCTlCPasAqGiSgAHMO5XiVFnCalEswDYPA3ZuZVvG92OieECAEPoibMzgOI6yD GCyAamC+5yu6aYmPHeyWMbiIG8AQJ1SPKug+RIAsGksidSlDaKOErMO+EGiBazoF /zgIO9Byhx3pkR9ZBoCpirULN6/AP+CRu4lSI4qxi8GAI+lRHi/pCyszQLjwmI+6 gMUYGcIrLsPLN1qIgecbugtcDdqwLwwrDoCTkQ44giHoAGMIjuNoLuLIjVlwuNUw DtcjCAMLvfEAxQJ4ADnogAGYiXDYRdbrNOjAJwYJAeBAFPyCwEMQQiL0vfhwgCMI gDOgAnQwkNWYJd3oACuwxQ5ohL6alhmaQomoEGAMgd4AAUOoECyQETmoxVt8BiES Q0mgCSWygBKYx3bRsQ9RJTJAB/ULLdEiLSF5hz8gAYFcA4JMKIRhErEwIyrrO3Xj GLbIO47KkkS8I+mJC38Qh/89ckQzQRPC26UHJCwWqMQJpMDmI8lJuR/nqA3HMyF8 8oIhKAIkKD7lYJQ9EDRoqI2TBJoIsA7NSLEQgxSGwCcG6AA5QAI2EADnuMFX2oNZ AB9LCZGUoL3VKEYDO8bWYBU+SUb+qBQQQDR9UJXmsgGhJEo2OMqSnJCIMCdz4pCm rI6mCcYKoQVaGEs5KEsB2Bx3ChcaSxdTmEd6fBEccEoAij0yiKLPIjuBMgJBEAQh EciBJMg28AqFKiO5ixIrwRIhsEiL8RK+KMAD3DKPwkiQWYyNtDdJtI6P3Ay57JRL tIEIAJQCyh9WFA6VdA8j5AMkyIQm4IM72APkYD7luAH/31wz5+BJFpwOhjBCJECC S7CDbiClqwqHmggCwgkPUVEcOImT60CIHAgBUniuHzSwYhhC2CBPrXTBknsDeFjP FyiO5DCu5UwFO7iEa6BCHqqIybEIKSCFNNBOEOBO75RLAaWFDgyB+HTOa4CsZRMd JZpHU3gRSogD/tROEBFHEHiBZeAHHEHMLfoBD/2BPwhIxyTIPxC3JGGYypwyiGGL dpPIuYAjz2TIK9kt5QEF0byAYcgHHYVEQEAZDEnNkFzNkUwAZ3HNpOQOZ5nNn1LS SaElL/iET8CALwgE4Pyw5sDE5TDOFJvCSIkAWmIAB+iCL7gCDpAGHPCEO0jTO7Cw /2gRlf/gToToT4SYheB0H/zKt2IoTxNKRtuwGYLbQqbBBHiAA0ItBvdUji+1AzEl 03SYlmixPg6hCMN6UziV0xwwhAGlBc350jAdUw4QBgggomUDnXiUxxJ4UJ6gBErt TgAFASZwhiiKw6cQBDfwUMb8AcdUMj30CtVC0bKYKLVwi4pySI0SgUjYixWwO0XE TORhC1gQzWFQA1uwhXiAxDTxSDQDgDEQ0Il4vn3rgzM9oKH5sARQjmvwBuDcJSpI L3lQgCp910lJDqYBgY+URRLrpl3ygjAogzLQgzJVS3PyxkhJBOzozhBQKwLJRIM7 DyvAU5t6jwM5kIFjluKQKv/1SQSgeZRdSoJduAI98NdGlQhzsj65RKFoIVjfSAmE JQV2Yqd83dd+/VQiAh0a6wF0MdUS8AlKyAJfgMpg6c83SYTOEjtZhQpB+FAPdcwR Jcg1QIMdcDuxKLezUAs0AkBixa3A4JIqm1GOuTu/SEQb3aNhEBmO9FHdMAD9egMG gIABlUDFwYKJoCFPSBrmMwQOmIEqJZXJyAR+lQdF4IBrgNd3pcAA4aUWGCZtWAiA jRY5YTV5KAN5kAcOAIPFtT41wwGUTYn/1AiVodMqjQ9s4C4AeANvGA4lbUVGgZPq yAFMsND1+cnlaFxsiNzIBVyR4JBMpQWTRdlxzAHOTYP/G9DUlt3UKZpdyJVcWxjD ZhsddclZnwCEnh3HzR2QNKCDoY3DHRGELTrapFVaEmDaNbA/JWmohUnIFF2E/+s7 LeFMRMwj5fla92XRuAAFUFCFwxgGkCJbNDGuOkgCKngrCKiFtp2ITgHY8QDOCKgH B5CFKu3ARGoCRVgCCVMEVAhc4IyQSJECb0ABfAgBS3GAUwmAPPCmPbhPc+qeiItg CQ4DVKCDycFPc3yB/3Ea3xUQaIBX/GoABmCAAMiFSqKkozmEN5XTgwiRbNhGKUDh EGi0JVhhVHgGFBKJWkAhzcECkUCHGVaWGg6KExhednLgJVbhOWDhLFje0fHLEkBD /yx2GmERkFm43jh0Azl2Ay6qClx1zD8AX644yCYxX/5Lo36YgL9YN2MVgTbSzOS5 zAJUHlhQB2fosmEYhke01u4BgQ4AIQyQB7VxAA/oZE/+ZFAOZVC+hCLoACQogGJA YohQsA+wuTmIsDlYAi1YhVwArIUAgzzIg2rwAgbQh2ThGjhIgiHggBcGWMk4iQIg BEVYZkXAAAWwBhSKYpEAAxTADHjABJbbYo2YwA8rpVeBgU4IgCEwg1VwgVA650/K hTwghjegOJU4WEulwCuNkGPOgQBQZmZ2ZmuQYna6hkGwZmwWoTaBBuFtJ0SIMQho Jwio52RmZkUIg2duUL90hv8ZAOhsHuhy2IJYLdotIqh38N4/qL+nbbLy9WPZSqMV vYuv7RLBEMAY7Ts7ol9x6K0vE5mR+QkBAQE5uIRdWAJ5MINMMCqh/mShHmpRBuUm CAM+aIEXKDq9nQwrYAZXa2J+DQMMGIdbwRUFwIYhsIIOOpUzOIM3CAGh6M4PgAdi oNzFjZanDoGo1oQIw7mcsxWtbsZlMgC8Nog5kYEIaQi+Gr0PGAIkwACcA2qkQio+ CEUqaAB4SBYGG5BZKDEeauu3juuqpmso6JUAuOu81uaBgIYYgCzR5hzKZga4juDL 1oKstutgymuyHmhY2ALZlp2nGC2p4F4SENHHDF+3Wyj/P4YtFV23dKOYOGrpiplI RewH+gUFmv6tM+meHCADGJADVwsDM7ju6+4C7d5u7u5u79buL1iCJvACeHgB6IgW CrmIttaHJOCDm6vqCzLsxO6AIRhFufEC2Nvr6IIx/m7rSuiEJSAEubbqJsiEuLGC 9aCCaoC017ZhG7gIX4PueWCDVy4DMyhqDC/qS7jkAmCA//Hsf4CGCKmQ+6wF/wZw AYfvAo+bjzAVxm5jG5aC0R5tSTjxAB/woTJwuUnwFweBOYGGAeise8mXLDLaxURa 7wXfpu1tXz1pQK6oRKyoQvaL407uuIiC5YaFZwUZJ7DpOOieeTWAw11PMl9P0dUu /zM/czU/8zeoDM14gUjlkDF4ajf5gAaAAS+4cU02gy4wg0vgAz4oAAnQKR9vGWjY g5ZYJ8fi70Y45pNggUpoATlghjkoAwwA6rgJAANgOTqBhhmKlkiNkA48CTLAjJ6E QFQ3MDjIvUKiE2KZCBM2p0ZYJ0fPAUiXdEq3dEwfAk1v9R8P7RnvHOWt9Vuf9Eq/ dB3v9ekd6CC/3nLgRzGQY6Tt3tweyDwmSCZv8ocRngBcX79o1sFY5NrqKLZY7rAF GTBjDDBXNXYXEEv5gBS7CN2N5mjWnBNgGetg70TLjNEV3bsJnxseg5YIQ85xCciA jJaYBXyv88VGWwBAMYoDcf8uFqKWwIIBZUvxkQGN33iO3/hDkoFCUEtGJ5F1Z5oP aHgYeHgJiHiXOQFJoFnl1UvlpbEKWPhEQnmVZ/mWuYEa8CylwJFn70d/fIc7Vlrw 7W0nK18ViLsoUQv0HUDjFkD5pUj5va2+MHeM/JhIHtvEoPN2/3pLwYcX8OLGatk9 8PqvP5YTAHbPKaIiegkEGIBQQAbI8IFGQPt2h4YbIPuWlcsxIIW0Z3do6IORH3nN wXvBt4GZX/y9LNWFDvyBtoB40IAa8CfZyV5pFwTFpPalZdolgVo/XgSqDVZBJkT2 rQvc4qir1ZICVAWsF4et9y17SISFh/wGa5qx53vRrgD/xIe4E7gB0XZ7t1eTUMgC BDgRmjgnyIeGChhtvt+DRHhs26eTE7ABu0/0RScR4R+XyJKC3gf4GyhV8R9/8h8D R1c1aKiFeJh8DdCAYHiE9XOHOa7Vzef83cZ20E9IiBp9qgUIfwIHiogkYoSQflEG MhQoJMrCgUKEMHzoEGI/VbZsweoIaxjICwSg/Stp8iTKlCpXrpQRohiEmDJn0pRJ 6wQ0GSxTyoB2QoqPoD4QQZAkCVGzpEqX9ngm7NmzIEEAGR0zK+fOkz5jSJrpoybN MSeyklUJzecsHI3WNiIaE5HQuEERGa0rySrWsj6xWOjr9y/gwBZKEC5M2EKFvGSh /xWiFO+xhsg1Fjir7M6dGDduBLFjZ+QHaBKiR68pXRoN6tRoOLHm5MePikUbNkyo vajhiNwSIVJs6C9Kv96/owjnfbFfv40cPX4cdkHkBR3SpcepHgcQ9uyxthfui6wH eKlBliaV66MRtDSJLNS06/69jQoncJ6tP39WoTGSLNhFStcoIOJJBZ4wBRYIHoKm BCaFfPTZN98N70k4E1xuxTRUTYiwhUgtawWFDDJBsTWih+aZSN5/dgESHnh7NFjf WfOdYEN3fxl2I444UrAjjzsiMIYNszgYYwUVjCHOKKA8Fk9kwQTzSA01VCaIZlSC dmVoogEhmmmnqYaGCW2wtv/IIiqoMFtttvmG20EDjXAQcAr581BEaz6EHHLKLecR SCBlMUwWgWZhoHXYlZAdIDlagCCCQbi3VBA+yDCNhO85WimmmApmgSk9KNhXp8Lk A8qgjJqa4Kap/kVVpl3JBJeJr/qQTii1hpLOrOnoiutQiMDqA3lKCbgfqKcySgey ySabI7M69vgstDwiMO0FA0w7LQHZagvKKDUw2eQjj9yyiZSbbOKGGFZi+cNopHX5 pQnxmuAHJ2a+RluaE2ywppsitOnPCAbRCZFxw9kZZ3J6MtdRn34KOqh1hWL3LI7I 0LHpqTjQoirHHXvMaQ/I4qiDMIEiawqOptCBcrOGffz/13tIBUueicA+E8oAA4Ty TDP9NSPggKZ+CnLIJxOmsrKFUcIE00xQEi3UUUN9LdUIVCuStto+VsMoC3hdw5Pi VuYMleh25pkgV7brrmmpySuvH2XGNhuZi6TJ75pv/juccHROVBzCUei50cKwiAMd ARdkMR11EVeHQI+h8FgCBS2XsGiyPby8eV8lqMyy58qKDrphSzfNxLOmOy31jpYf xnGnnpoSoFSs1gW0gM/QAVXQmvt1qoEiF4b0yoVRcDrTT6v+NOtL90gJ8z1WPX3V V2e9ZDxcf+1kuLdIqcq5Yohx9rrsrt3lGjuo/3a8r8Gmgh+zyU8mwP76OwLeueGP //eceBKHsEIWohxVEBAUBgSFOBKYwMSJhHGMi1jVJAe1ZiXNdRa8oClWt6OlRe95 yNPgBqHXQaiNMFrMEt7RfNcX8AzNL7EzlrEKlIV8FChZM8yHGvKBAMLwiIM9/CAQ B0AJ6lUtZ0Q8IvWydoFRiCNb2JtM1xYAtu6pogbuAF+V2JG28pHgD+1C3xrQsAP2 tc998ZMfGv1hv729CX9t3B//foOnOSKnTuDYSJQIqIoDIlCBiCPAdBDgwDgQ4Iis exYID6nIRXqwhD9kAtWMiMTpOVJq0Dtd8YZXwRsRT3SeRFag8pEPkzFthl4bpQg7 qDqnXYsSOXslLAdwgSNWy8lak5xe1nJJACQpCXsamIzXpCiuW4xNEOfSjBbLZ77z vQs1bQgTGp4pJjPBD41pzJv99AZHftGJjnSEyJw0oxkC1qCAB1RgAvuENQfqQJeT PB4j46lIpj2raq4UIiVrOUtqxTJn+7wlEnsExOSp8nSpNAzxBqpQpg0Ah/kYxgAY ik8E3BOWz6FeLZEYS10SQJYc/SgBsLekKEVJA9zr3i30eJl0ZfEHbljX2rjUzC+t pjXUNJO+5FcbfuWmICLgKRwT4s1vEqwfAQEAOw== ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=Titlemiddle2.gif Content-Type: image/gif; name=Titlemiddle2.gif Content-Location: http://zippy-egoboo.sourceforge.net/images/Titlemiddle2.gif Content-Transfer-Encoding: Base64 R0lGODlhZAA9AMQAAF9vH2BwH2B4IGB3H2B3IG+AIGB/IGBvH19wH19vEG9/IF9w EFBvEF94H2B4H19oEFBoEF9oH1BoDwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAACH5BAAAAAAALAAAAABkAD0AAAX/YBRBkCSRD6k+Yuu+cNwC wHEEeB7Q700QgQMspTKRhiSTEcIalY4R4kpGrQICBIFhy90KBgAYLRxLKk9NV+q8 FCWhoocUVa3PBoKCfq9XfMl2aipMaYJsSlFvEEhTMXIxVwNAQjUBkgOYAzqAgZ0t ZoeJT4tDj46NMwECCgV/VmM2PJ1zhC1Sh4hEJ6SeTrsvV3mtYDJXWQJaAkCcVGtn ULq4uYqDdFWKwKp6rjFYBnzDzDJzbaLSv9G4TNeDhcbImuIikT8/8fLN2ObSKKDP 1dUKyQk4r8YBWb0SuhnFIp06f0qgQLRmq51CO7QofmK479xDFLSWFLJl6mK+Q+te /9By6DEiIYK6NAaiEQtfxTTOno0kWaQlypTOQFq8aQULvADsfiViI/MFxHOjUsYp 4VLqRqWQVCkwAGQcwK+oZDx9iEZlT5cjpeycEQmHuDkN9XliuQRg2akrzoY1yUgo 1RUDCca5xRTk4CdNgsalinYt3yiBxz5sInkXzpjV6uZlvMvqYxdjz+pcqLkfWJ+W O5azlZCIwGh+UVLmKIgz6qp2sartpCht78jVrnY2Rfc2WnPQhtLAcbDvTtjt5JSc Wni2caiDVkNORcCAsh29WDat+FP0dZ9wxKjyommHTbyZSzfKeR71aaxZLWXxrikp neKWBfZPfR+ZpR0VAOBRAP9XSJEkHShg/XVfgJXdJhNmM93QHhkZ8bOOYtQVphpu hek1n1wX5fRVVdBlV55tbdD330TrmGHVdJHE44h0PApIoIVM0GieZhElZlEwCwoA 3lwwXpdbiT/+Y6RIACCAxxdCwGcYfFEaMaWTJoJVkookJDAGIPSlBuB5T6L3YW+B 0LgThNas2aVxm2knXW2M7SWcZ3be+c+QJmr55WheRcdjhZ0x2lJKTVYH26G44RRQ RpH+EyKbFD1QIp0QUlodaXWu+KiLYO6k6VJQGSkaKnAOtqijP463appM+SYhDLGe kimngDl2a6YX2iiQYCoRJmh6dQxb3nTKAjWUWL8SCJj/HYji6hmrx/kSYLKMmsap Yy1kC+O2QWkEqqXVqknroNCm4GmRm9Jr4F2GSEmafajWV6qJs4k5q4S1VGQjpO0K KqmNjV46cL/6OsVRoAqT5Sy+eHkI0INh5llxrfFFONmeymK32McoAzlnn0M2nPLL jbK41sE+vtwmykdMms/E7w4aGiEcp9xOEXRUQsAACAAQYc/HiQdopK+2TCHAESSY hwENLJCatx9JJq58psJLcxT8nKzvOw4gwMDWTwVb8jP6UpzawUFq3HZKywGQAG1y mpWwZUsHDqW/6EZH6IRAbusrni37qQY5MLNYBaYW59w3RuFKjRvU48FJV6yYOka5 PEexeWj2Q75uhqqEr5G7L+OnR934eDxZ5PROeSNk8M0vSql5xHVgFuTl3H33nsHj vr60mQgAsSSfnIkWAgA7 ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=Titleright2.gif Content-Type: image/gif; name=Titleright2.gif Content-Location: http://zippy-egoboo.sourceforge.net/images/Titleright2.gif Content-Transfer-Encoding: Base64 R0lGODlhoAA+APcAAE8pG7Bnb890T/C3gb+/weDq7086JU9IQM/Pz05BL1hYb5BU P7CysPCXL8+Wb76HT5CBdWBnX3BoUL9wb6CgwK+or2B5ILAsB5BlJoBnTdCfcaB/ KuCUZl8rDnB3cF8vIVBQQE8bDYB3UCclAH9gS4B4X5CXkKNzOKB8YsCQYIBYR19X P4CEgL+GYKhaLpBHYL8vBn9mX493UHh0Z9OJU89/YzArEBAaJv/+/zAyNW9PEI94 ZWgcDJ+UgCAnJeCgb3A2I58nAE9IT/CYgG9PP19gb19oELdnQ4+Kq8ByQK+BX3Bs YM+AP3AyEI8iArl/Tz8sId+Yf9Df34BnJZBbMIBTMPD38K9dRM+MYM9qYI9nSmBG D6BkP08vByAvD++gcF9IN5+LajoYCZ9FMM+XWjBEA8CXcK94XxAXD2+AIHBnQP/f uE9APzATD347M7CEO1EQD4hYIA4IDuB5dJ9IP4B5bz8hEP/Ir49AL49gQO/o70hI YPCraHBXQG9of9AwACoIDy8gFVBQXz8PD3BCIn9/kB8fAL9wUB8YHy0oMbBzTaBX P7CIb19PT39wXzAoIDAwHz9OCGBPQJBwUMB3UV9vEJCAXF9gf49vYGBHIFA+D4+N jz84QEA4IYBwUC87D5hQL8BiU/CgUHZcK4BIL+Cmf5BHL38gCLCdlW9vcL6PSl9Y X+6Hfm9eX386H89/T5coD4BvYBASAGBfX6+Oe19YUHtcEF9QX9B8KJ9xUPDw/0BD Rd/g4JCJgB8QD34rF0AyDm9MMH9PH5JAIB8XDxAQHx8YAH9/n5BvJV9vH/+3gGBw H3+An3B3kOCof3Bwfx8nD2Bof1BXUO+ncPCwgG9YT2BfUFBvEMCQb394j++of+Cn cFBXX3BfUFBPUA8QEHB3gH94f5B3MNCfYPCfQGBncG9nb29fP3BgQG9vf19XX29v j5+cn6CgsKCioCAfIcDQz8/X31BnH6BoX//I8KNQQfDw8GA4EPD4/9DX4B8gD1Bo EA8PDxAQEFBoD19oHyH5BAAAAAAALAAAAACgAD4AAAj/AP8J/JesYMGBAo0oNFJp mYWHFpL9a5atmcVn4MJlA5ct27p10aJdCrmu2TFmzE6iZJbtmZ8i+/zt22fkn5GZ MvcljOnPX7+f/H4KHUqUKL+jSPnlkOZhkwl37kyw8JDKXLlZq4TsyuGjq49EYBPl GAvWx7t3iND0S8pWjtu3A5M5fLhMos2ZePddq2RwYEeLzTB2zFao4keRlz6aRKmS WeF05WDmxZlzZ0+fSItq3rz2qA9vHp4yIMCgArtNLFKHmyUkx7sbiGIjOku7dlq1 bHO/dRv3YRq6AifjrYlQ4F+L4CgeK5TSIshLiddlU9m4ImRuN3lenrmTZ2bO4Iki /9qVil2F0QRIu2NnYtMmD6t2+ch9FDx9+m+JF3S4rO7AhQsVV9xxgBXCHDNIHNPM c9GkI91JjbH0TDSSadfTTDVl19N34XXIiTkmjIZAPAikV9p6m6TiTQ6I3Ofii/jR JOCMxe130H/HVdTMSkggwcyCIjX4YEorFdLMdZcliWFwMSXVYYeJzLIJAQggwAsv VZpYGgsRyAfjl2ASR6NN2ek3lwX+aagRYBYdiBKQQTpImIEHtkShN0rmpaE/HMoi y5OaecMClVfqcSWWJRLATjjS5NAZmJDSN+ZAOM20n28PJaNQXuEkF9hHcyoIJHQN PkNRMwY6lk06RQjCE4bZWf/Yp5+ADvWOORXEw4se9vRqj6FZmpDKLu9oFmmkk/63 T0MQQVTXNcPdRMA64IDzzDPpmEqRYSFB50e2HLXpWDPlxHchTXtedtQNaqEhizHG yKJWrT6Yw8CV9lih769XIsAAC6s4WquxkCaLUDKYonlXTEvOZO216USc7TMfgdTt JeWAG464qzZSizqthLzEEuaUvIQ1K0jCTzGIdKWPPobEbAi8aNQcXr33FmAPDjhY wS8vig4778D2uWhwXGf610MPYTRtiSUyRO3Jw9iaExLE6YSEGMbmpHKtp4WAE3Ir MZQdQyyxxLBEK9bUonIx7+TQCSeddGKDDTLHTLPNRb3/s4oJVOrBc8+98vKvNz4Q /aTRAj3t+NM77ADB5BD0YvnlllfueNSTeJJBBtdC/G226fih9SVFpF5OOV0LSVE6 Z8eCiSO00x6DBG2r3E8gCYAAwgEJdAIF3nnLDC8xfPfzzi4euMMAAvnwkq++CLgz rOKA3idgCdxz70gd4IfPAuUsgN99CZ6k/zkJJExsrcQRm7566vSnbnWDhTwT+Q4o 7L+D+t1IWVAeAQYSaCEDJACDAaAQCHjd7W4jyNvx0KCPTtSiDpuoAKEOxYBweKNY 2Ftcbmi0jJEtAW0zCJ8KzeeBGSxBAjD8XAa6QUNwVSt+fkjF/Oo3ix7SLyTZQEEv /8LACEagoH8y8Jwa+qA7KFRBES1ogRJIYAAb6MMYxLBB3er2QOLFTB+Q6N0SWMAO KlUJAewwRw6KUYwQdkhSMzqTCedIx5HBEIY0pGE1qkFDjIAjbBErmTnql7pVGNKQ Ckhd/mjByCIi0XPnOEdQ+uHEV3BgGtTIhQGIQYx+6CMBRJBEAka5RWA8MII2CKM1 xsgOBpRmE+pIBBvdGB44KmtZcumPRCJQxyVEwBrADCYwu7HHPXajfX6ETGTo10Nu OPOZ3BAENxSggGagAAKOREESM6CGc6xgkpW85AA0SatH9OGIudACE0cZPC7ezQuG 0CIIJBA+a8inZvhMHi2BMv/CW1ZGQBSIgEAH+stg1uKgxTTmMbumzELOQh3QFIQg vEFRb0hUmpI7YuQm8blIrkAoUCCFJTH5hEzAix+Q0MIPtPEDB6AgA30IJRhGaYC6 mdIGqOxEAnbRCUi8zHjwCionkZfPfL6xn7E6l4AQ9pAeOlWYB0VoQo9JgmUWYRXO lOZFKSqErnpVCHsQRDkwgYkdzC4DEvDoR38STpISQgzxSukPqEFXDTACEwisRh9i OtOaduKmI4DGCAYbweIZ1rBBTSwnizo0ttwlSTkRk0Dm8puI9LAW0sisNKKaUD5S dRZZvahEd7GHXZj2tKglrdliMEMarmAFIACpSC9JjSf/CCMEIzAGMFRKjS/8oAUv JSsmckFcLZCgDzNt5/A+0cXmOveUhT0sYuHlpz8dZWGTkaxAcommGxkBq8/k7B5V wD72ZQC8E0WFekPWjnasrmStoGEryss+Pdbitb7rR82AUYWRUqMFoOiAHcTQBS1s QxscoIEiSCCJvWZACSnAQgqkyFHk0tQAGN6ihje8RSgMz4pXTKzMCBtdQ1TXT0dL Vqz2EU1BqKMWxaSvjOkr31YQMmR63auOiRBKSfjud/0ghiH4O9IBYMEFTRDwPU6w jWkkmAvBwLABCogCLMy1FA5IgRJyAdOY9hgMYE4AmMccZnYu8BH6aFd142kDD3v4 /4H6IMaJ+5LiGQFoIC+O8YxpnMdWzCJ1qHtoLRpRDUkY+tCSAMMBFs2MFgR5yP0V JwcoAQpXdIAQuWjyk4MxvBHYoIBKcAA1lEFqZ2gAG0o4IgomccDjEqEPNMzAJGY9 6wMSIQGQQIRQ/GSMQEBCp2YWnhWJwQ8/0cUudU7xHvlMzM7yMWSDLOQqDtqIRiD6 0AdgBjZSkIJHA2MURf4CB5IAiia4QhHaQDANuJAJCGoRDJjAxqhJTW9nlKIUpzYi JtgXA0fsIAzY0IAGHEBwJWgBDFBQiy/gNQJgZCIYJECgqxX4iHegASm/8Y9B6JwQ 7dbZCJ7Nox6d3cNVFEEBq/94cbVXjuixYOPlP0EDpIvMUhpcwRWmoIQ2esuBE7Qb pyMIIwkYMW96k3oA1MCyEbVgzFjsgBYaoKvUsXHwRwSZGGKwQxeCoYVQa3nLWlBB lKHQBmL4gh/dJciZFIZdGSVbQyLPYzEPOm1DqgOi3PDGylcOZjZwIgcDcAA2Yg7p JHDgC0hHMKVBoXOkT2OKmsBpPDvRByUU3ehIt+u+RZmAA9RiCSgwg9SpoQEU9KET P+FkIKDA9RY4gxrT+AEHsEAJLoCCEB0IgR3a4IuDOaSyadKTxyelIe6IvG1R/djH DHmLilZUCGY7wFZyQHDCA8MVV3jFD+itDSxc4QqUmCv/NQaAjUlIwm6e/gQYLG90 eiPdDCioxgGgcJYc7MIb8R59CvIAhkDo9wZnwQbVgAKiRg3asA0/QHtcYAqu0AQA sHvEUCNz4R//sWI6cTTFd4ECAUzUtnK3wA2a5XzegGPF5HfU5wDtYgx2AAQuIAAc QG/UMGlHQAmHN34aMEUJgFPAoAmj8ACX537UQHVgwAmPQAwtkwMHEAvyRg18MA0P QAUGIAZGWH+NoISjZ4AKyIAf8IC8l2w2cQ1gyBdL1R91oSmUwR0dNxOYJQ0i6HxC UEjqYG1gphUnqGv9IAuB0ARjcAQvSGq9hQU18Ao0IE7O4ABTZAA7qAPIoAo/eHT/ /0VFDKRfPoCEGSBvfMAHosAELgAEIQAAAAAFiQAGXSd+UpeAh7AIeAAEW1h2/JBs ctEsyyCBzVIJFrIk/1ApOtENbUhRh0RNcdgIiiZ9nEBwdigLYtABwxAKfeiHLMUB zohJmdcCkzAFU4AMGyBq7Xd02vAEVWAHI9BJaPAOicAGlciE5NAAuOACw/ALv5Bk hLAAilCAUqcNDkAJV2AKbrCFdtBJrVhnTJUGGYdsBJEwyyAcGJJdApFHtWBI1XZQ WVVRvyOMw+gAP/ENxBACv+ACywiE2uBbCLhS1PADZqAKD6AKPzAA2agMA6ANLbAA HcBAxKAPUGAARJALojYNov9ADum4jq7Qky6gCFZ2hRxQA0dQD6n4iW3QGV74iml3 ML4RkABigR7HgYO2i4LQVYvGBqY1kdXnC3bwC4tQA9lIDdtQlrJHkg+QAuMwDQMw DU2WkirJkouQj1CgDzYAAG6wCDTIhNPABzSgjq4wDKawCIcQlKNXCrR3BXiQj7t3 dtflhZPyj8dWHLEyfEiAfI3ghhSVWqfFlYLXD20QAguABe5HattABqrwBKp5AhjQ mifwBC3AAdsAl3GJDQHwAm5QRV1ACKBwBNo3eljABT1pCi4QCjXAATs3ehzQAkXp BkAAAIFAbEixXQZBhjfiihMokAgxfAMBTJm1i94gBIv/Np6mdQcER3AkQEEfoAgo qQwh+QNk8AbIMArBUJ+ZsAVboAPCQAVXoAhPYGXteXRIFwVzMAHzYFx5cAKUcJyY FHuTtgg4xwWFyQGkSFemiIqqaAe6lhRq1yzOop2QGaL/IEzW0A3C5FRRZWjSd55n AAb8IHOE8ARztQ0PoAjzqQOR9w6PAAw82gUd0AG/4AqkQAVaoAgpMFcqmXilEAUE lwJk4AAUmpyzZ4+ggAf1AJQ/cGCjp3hXMAb5CABJ6ViUBZAAmSk1kktlSBCvmKYi 2p135AkwZEKpMKcv1A19sAK7MHAOQAJW1zJOlARPoAonoANboAmmpA9CEZOBYAd2 /xACjtoFXfBwGYACLSBwlipwP6ABP7CpWYqAiXkF9TAGV1ADFVqKWKAIGPqAG4oU RNChHsqmvfGh/0BZZtqmCTEyJbADMmAJO2AJlAMB4VAHjjBDfTBwKOCis4EWUNAH GIAMOGoD/sdJRaF6bdAGYtAG8PIIoLRn7KMF86AI/vkAD/AElJAESXAEM4gFyUlX 2jAEQ1ADh3CPdNkGk4QUJOCFtIoma9eUIhorjlAClhAGqtA0YTCPzrAGa+A5B7Cn VvcOZiEbYDAFtqAJteILnEQr+vUIGruxj3A3APABgRkHGHACJ5AEr/AKqmll69qu Q8AKWXAFdHCUdqAP8sJPk/+gEP7YHx76oSD6dhbyr71qCVdIDc5gbx+pBAnAD7Px sGnRD50wCpqAqB0Sk0ARHn4iBmLAAx1wDzpgCyMLqA9AA2RQoe3KCi6rmK7wAV0Q QfGCGzU5HPiaMD27VGh6nZaRJCPzryJwhdpgb6XQUnyKBqsHBZ3wMoZrf1Bgh+Bh A8BQU0XYIb5grXawg5qgn3HABSfwBmO7pS07B1lglEDQBXagN7jBDySAAnCLnfxB gcmSr9qZLj0xCy8EQ0gndYUodwfACZywC4bbuy+TCPQXHt9GjSRwa48bHjFpCA3X BVtgC9aoCuPAuazguaALAGxbs/yQAJOgBDhrq0dTnR7/imybYiGXkXzUBmPOVg2n 5bu9CwhGKJ2bYQBToLlkgA0ooAVEgGGfCIG+QBRoYAzKO7mVOwUbAL1NZoCdGwr1 kLaj27ZAQQRKoATeS53ZKYuwyKawC1n+0IZ715AHtQuccADs+zJyAAiAkBtDUQw3 8AgkoAqDqA0D8Fu5YHvOyQP7WBRowEm9xrg8KA6qsLllOwehMAaWZgfxMhRQQAJS ZIsiKplsF6vAJyCUocHbwYYi2MEItQsiPMJuYcJyQB8/cQM3kABvUK6vgAUOIHs0 IABd+gsfkJSccRTvAgy2UMDjwAdBrJgOKAYY+xNsMAlRdCHc+b1MdcESwZT8Sink /wtZM+EOmmXFQlBRHtwKW8y+XQwIbnEf/bDCmYABVAAKppAHLYAFsxevpvAB/tch uqWIb4AF7jq9n1vE8fInQiEJKLBtBpm6hKyzsIhsc3uLi5wnRpBZBwXJ4WlRHqMO QjDC+vAWXvzFLoIGDYdhUEBAKBCSHPAKXNB/T6IPwLAFcXAENTAHAhAK9wgEAsZ7 SHEDiVANLSB43cHI3MlxSNPLxIcXVMzIMwFVbHhR3LAKs9AKS8DMzozJR9EGPHAK SOEnSSELRzEvvEMCmBsHBhAItPwixGAHmrAFpFAPV7AApEAI9wCdrLjJN5ADMXCe C6PBbud7snowuWS3ApLB+f8MWR7gAfRQBp/gBdAADcxsyZd8wvzgCzzgBKdwCrAA CzZcXS4ik5lgqCbGT/dBDCMAqR0ABKoIAHYjFPzwDWIsCCigp/jM0hq4Xb9XWb9s MCtW02xdBj7901zsFohgwkgRAkFg1EEAA0n9CzzAAyEgBl/yKF/CcATWBafAA0Th 1TfQCIyQqQ7A1mjo0pPpvTTN1j1RBl4A13EtB+8wCOrMD4PgBBfgBHn9B38AAxcQ BLDA1359rY55LLkhC05g1DwAB4MACEPDzimNgDgA2WUdF/RM2XmRzwa505oN1HKw FoPgmG1wCjAQBKVt2tKN2rBw2K2NtdXaBrux3dwtB07/AAu0Xdu37cVhzAmY4Le9 XdNMLNzoQiPjS9baFQmZfdy9u92efXYIfQH6DQPSPd2ondrh3dcC3te/AAvdLQd9 fQq/YN22bcKY/Bb9UAwHYHnagAP4YNl6YqsZeM9TnBPoshBlAGL0TcK7MQjLzQ+A AAd5DQP83d/+DeBHPduqndRJfQFJbd0DLuAh4NkOvhu+4OB9IHrUgAO6YNnb0dIY SJnC0b1tRxMdLhw6PeKG+xZI4dlDDQen0N8ATtoX0OJ/AODQrd9dzuL6feMDHgJ+ 3Zg/Dgi+4Mxr/swDwDN6YORH3t4cjuTxbIu4mCEdDlmR8AlvPeLQXOXL7QuDwANd /27aTsADWIvmCT3bkJ7oL27j1Z3Qff3Xn93mb/Hmz/wWPFMAdK7Pg5yBkpVUkXWG btfnSfLngU7f9GHlbYDl373oYqBfCmetjuroXN7iZH7j1o21xiDYXczp3D049hDq 55LLwnEuxGHqSiLMTFLTrC7l+kAftu0Lhg4Htc3obYAG9mdaYwFCkSsGjo7UYg7e h/3Xs8wWDt7jxT44cx7q3OHs6p3qwZwTR04cqn4Z0y7l1u7ZoNkGJn7fn5EKquEB EbAK3rAVPqBrkcsDsFDmhw0HcBUvSIHtbQAI450I/dDdg4MPvCDvbrfWkK3vi3yQ Z9js994TgE7t9IEIcJCU2P8+8/2bCNLAAs5jIlExFRGwIojgCxhp431t22XXGRgv 8CYOFh3P3fpg7FKA4eudhisvEyrP0iYfLZWNFy3v72wxHtc+80ORA6uA8yJyRulR AeEgBO/gC1k78V+/Fkc/8Ouy9Nv9MoNTAPmA4YOMXcQ9GWSt7Pu+JMbN9UjxDnvA Cf1g255drf3bD0tB9lVyKCVyOGsf6+LNe3AfuQM/CLvBD91tuMae974d9RU41ixN 5yM/9UsSCTbQ063+00mxPIlwFHBQ+7V/3/3gA5ywCqmwCe5AANKjByXiDh4gBGig +fd9dhi/+Uhx4G4B+vAeDyK/91m/7H9v+n2/D5Hw58yH9fojXPiJgxQvY/vX/hOI IBZCMAsGzw5QcRrmsAs/gfH9G7kCr/j4wfTQ/+nwgOzRAhD/BA4UaMTIPoT+/CHc Z9BhQoURJU6kuE8iQnmRPkHT19Hjx478+KFBJJIfSJBt2vhi2a/fuxy7vEmT5m1X Ipc5fakcBMenSaAm5QwdChLHURy84AUEADs= ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=forums.jpg Content-Type: image/jpeg; name=forums.jpg Content-Location: http://zippy-egoboo.sourceforge.net/images/forums.jpg Content-Transfer-Encoding: Base64 /9j/4AAQSkZJRgABAQEARQBFAAD//gAwQ3JlYXRlZCBieSBHcmFoYW0gTGFja2V5 CkNyZWF0ZWQgd2l0aCBUaGUgR0lNUP/bAEMAAQEBAQEBAQEBAQEBAQEBAQEBAQEB AQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAf/bAEMB AQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEB AQEBAQEBAQEBAQEBAQEBAf/AABEIAGQBLAMBIgACEQEDEQH/xAAfAAABBAMAAwEA AAAAAAAAAAAABwgJCgQFBgIDCwH/xABOEAABBAIBAwMCAwIGDQgLAAAEAgMFBgEH CAAREgkTFBUhFjFBIqEKFzJRYXEYGSYnMzdiZIGRscHwI0JGdJKXs9IkNEdSVliC lLLT1v/EAB4BAAEEAwEBAQAAAAAAAAAAAAAEBQYHAgMIAQkK/8QAMhEAAgICAgIB AwMDAwMFAAAAAgMBBAUGERIAEwcUISIIFTEjQVEWMmEJJJEzNEJxgf/aAAwDAQAC EQMRAD8AoJRUSbMFNiAsreddVhCUoTlWc5zntjH2xnp1tS4X7ht4LR0ZWJR5l1KV JUgV7OM4Vjv3+yO39P69Oz9LTjhF7y3BARcowh9hw4fCkOIwrGcZdTjPfCsZ/T9P 9H9c71+5CWPWkoy1q6Rp2k9bsNMQVajrLU9bzUxOLBQ867OTkhcYGewmck0qU89E wZDcPCgNAxrapQ0Y6xTZ4eVpUen1vXP/AERl/t/mj/8A5e37uvP+1871/wDhCW/+ ze//AF9WH/7OPcWMqSnfWuV5R28va1hox7GMZ/LPdrXa8ds98ffv2+/Xuzzc3UnG Mr3nr5vyx5J9zVej2/LH5d04c1ynKsf0479v16PDyuov0+96p7/3Iy+MY++f/RH/ APy57/u64qX4XbkiCUDEVeUQtavHtkR/v3/7H/H9fVl57m1uZpPkRvfXDCM4z+0/ rPRTCfHt3znKnNeoxjHbP3znOMY/n6dvx45O1nMLYTeRer47e/1BqOnNcW2kgUyn FYecNjRJKBm/okKHXia25D5PnYeaj4h6cDnhHIORalYmxDSdGPDyqvRPTR3tc2G3 xarK5QtOM4z8R78lffH5oz/r/LHSr49IfkHlPf8ACsn/AD/+qP8Af9ft/I/X9Py/ q/mmI21yv5AtATMZKbWidaRsaYZdhqnq1yL1zLxIjY0w6JCx85V4OP2FKQQwL5Qs fE2S1TWJJYkefLOycuENJNs/juf+xJUpwGO5L75LKaUtKmWt1bHTnu3nOFYw4/Ls MZ8c/b7O5x+f37YznGBMWE8GYDPHPBEIzx/HP3mPtz9uf48zFbD+4LM4mesdQIvy 454+0T9+Pvx/PHkd969MTe9NCdMKqsrhDSVKVnAj328fvn7+GP0x9v8AjuxG06nu FUk1xcnElsEJcy34OMOJz5d+3bGMpx3/ANvVrPT/ACd5GtJQ8zsuRujE4RFyEzRd 1yudjPmgwMmWx9LWi3CTNgrEfNZKfFlXaRPVuUlAyAnFyTZsfFvx7+KBwf4+85Io m7Oh1nWmxKHCfiLbtUOJHi4KMiY9ltyZ2BXJCVIx7mu2nsqzIFSJWTaY84zH2Z34 xkBPWPISEhEhKCEoghIZiRIZjmCGY5iYmJiYmJ4mPvHnhCQEQGJAYlIkJRIkJDPB CQzxMFExMTExExMcT9/KYequHG2NoqZVC12SfbdynxUgV1WP2vy7dkf0/r+7t070 L0kOQJbCHk1WTxhacZ+4j/64x/kY/wCO/VhLYW3G9G4XXuKkZT6VRamlp4zbNvqc OVZrK/FNzLcoULHXOLn69DUeQHcAkI9iSrQ1zxmKaNPNhUHH1oeOGc5vW+qyz8DJ cwNoDlDYHzn2OQFzQItBAzJTa2H37GK243ht9CVLTjwS5hbeM5yjPRMxH8zEc/aO Z45n+eP/ABEz/wDnnkRM88RM8RzPEc8RzEcz/iOZiP8A7mI8j1sHpRb+hAnSnKpK eLacqznAj35Y75z+aP8Af+XTQ7BxJ2xAS+YkmtyaX/cy3jGRXu+c4V49vujv+f8A p/d1YT1Vy93HPTTU7SOTlxtRUSvI2BrVsk7ZVYdXMgmx/tyFbtSrjT5FSWXn8jfW Ix/4B6B5ADLEmAOSLJ3qnfGnJepTEjyX0J+J9ow4jCqTNaqj4aMr17cYgW0Nq2Eq YkRk1KRkp8XBcnP0qAm4ZQU08qJokWmCHj5siYKOYmJj7xzExMcxMxMcx/iYmJ/x MTHhIkM8FEjPETxMTE8TETE8T9+JiYmJ/vExMfafKdcZwO3fKDoIYqcspC04VjOB H+2cZ/8Ao626fT53r27/AIQlvv8A5o9/vRnqyHMcqd6QExIBtbA17TEPkvHDVcPV +qXw4II5958OMDdsNQnJ3MeGz2GAdnJiTlHRWWnTpE4hThT2GnmPvlWcYTu3Xuc5 +2E41lojv3/m8f4vu/ft+nbr3zzyuOv0+t64/wCiMv8Af/NH/wDy9v3dchZuE25q yG4YdVpVtptOVKUoR7GMYxjOc/mj/V9urNeOYO/VoUrG6KCpCP5asav0V4p7ffPk rGvuye2Md89847ds9/yz10tK5J7NtRii7irWu86W/wBo2WgF0+kV7xZSdHEyBEJY deQMEXG2HEe29HAGSzVjgwsSjhZtZlX2A8MHh5T1D1JdDZbEOzDmqK9z2vDA7nl5 d+35ds/r/X/t6elrn03N5X0RosKrSqm3U4UnPxHvvhWMdv8AmZ+/VvSf0H6fet4a p7yilk7BOvSJAuF1VXRIhF6rp0cO8skPZYJUhhiiCiTGBoVw55yVdmkk5naJH3Wu ClyjUe+6+WO7omJJGP2HWtI14JKLBGU7Up38XsildegsgksRc6CO7s6aGkMFOyRs HLXCXiCJk4chkAZoCFZjD+P58IiZniI5mftER/Mz/jyHX+1EcgvHy/Csn+Xft8R/ v/8Ah/xj9Okd2N6bm8qEI6WbVpVLbSMrVn4j3bGE4znPfPhj/T/R1I4j1EL2t3LC OSnIdxzC8M5S3tXbSk4dznCcNefzMNe5nOcYwjz7984T2757dPX09yk3sfEtBi36 vbrrpaVT8pUdtGY2GcpyyV/AgY8nYTRsbLhRwUDMyYMHE3GKiR5gIgl6PIbPm2JL ETAp4ExKeOeBKJnj/PET/HmZLMIiSAxiftEkMjEz/iJmI58qSTuvbNASSos6NKaJ S5lvKFsrSryxnt+WcY/XpwmquHO2NpZZVC12SIbe8fFTYrqsZ8vy7dkff8++P6P5 urkQHpm6C5ejvbtoGI6qRVb7nbQrdjKjwS9arYHJkCyZ817IwWau6GCfIxFuz8eK kYwI5ROIyXiLBCwyUXvbONGN4rnFeNp9KpNVQy6bte31SHKs1kJimppMqSJHXOMn 69D0g4VYMkCzI1sa5YzEoOPNhmjZCuD5eYeV8QvSQ5AlsIeTVZPGFpxn7iP/AK4x /kY/479amwelFv6ECdKcqkp4tpyrOcCPfljvnP5o/wB/5dP0tfO3YVGmi4CS5Oby ysT42EGRe4tpmRRfyRRy0YjzRS1Dl4Q0S227kdS0NvpcZyrybz0oOoOcG3LBPDzE ByR2Ao8ItEZFgbUvk5Za9Plzwh8XgUWqbKGnatZX0Icewy0XDnOxp6gJIJI8iwEW xh7F9oHuHYpkYHsPaSGJkhiOeZkYiZmI+8REzP8AE+Z+pnWS9Z9RGCkuhdYEpiBK Z44gSkhiJmeJkoiP5jyvNsjjpsXWxDzM5BHjYZyrC8ujuoxjxznGf5Scf7e3SCOt OMrU26jKFpznGUqxnGe+M9v16vHts635PVoWh8h6PV6je5JK42L2zWA242qSC0RE QPFF3mOd8WIWSnphE0RL2OCbjahGOnRKcV2vwLcnKRlcHn3wNt/HC6TDL8SSwCyU /wCC8sLSjwStXbtntjH5dZ+YeRVdHXm42ppam147KTnOM4z/AD468Ojw8Ojo6Ojw 8OjpbdW8ftk7hpm7L5S4Ug+vaFoYl/uxvxjFDIjirJEwiYwY1oZwBuaxFlz1wbCP KDyXWaTbCQlElx7YZCJdIKuVxt63k6FO7Ws3cLZRUy1VTRN+Ps2qNbJVlWlRPdRP o3K1pXaIhimjIzMwUCts42/TrY+5aqWEVMsh1rG2WrIU3kV7dig9tZkx1YKblWxX b1nkGLmCiIkZk6Ojo6X+IvDo6Ojo8PLH3oMt4VvSAzntnscL+91P9eP17ffp1Pq1 aqFrMnxbgSQykIulqusO98RTYjygcn6zGOSiRceGwCrLUinHn7yErTlWFqwhOe7W vQX/AMecD/14T/xUdTuev3TYDWN24Pom6+BLkSzXImSg42QJyG2RL16W45IYy2jI xQpTqEzSsNsFtZaU6tpOVYwpWFMWzNJGDyDgFhkpa2CKygTmRsKmOJkgiIjjkuSi JGCiZ8kepJCzsWLrsJYA5zFETRk1xB13D9xgTmZnngeAKYKRmI8hez6efGSQbdV9 IkFjCIQ/KTS5gmTSKheVeOJRcbsIfLSsYxlZJCWMjipbUt/LSM4Xjny+DHF8WXEG Eo0K7DKYTk8g57krFyz7aSM+48wyJIykS57rWMJaIGPyJ3z9x1ZxhTnXObustlAs FUP1dLQYdnAIiDMRsbXIokbJ6Wx0FjkgWBzA2AUK+Ql1CMZedxhokdwd8gdyeLjt z948UPQOk6FanC5S00PUetKVZ5JYd6JckrJWabCQU2Zl2M1xMiOOFyoRL2faki/N Tqcpee8vPNC6ynO5ZlsMxvNjBDXBc14LJS0bENghIu526YxK+sTAiRwPMcdo7THS m3P17BrpHhPjipsRWiaNkhxUpKrKZGRH1DQuzINgpiTIRIpgoIhnrE1+prhpxMLy e3R9Q2USQbElCYkgKd3LJeye0KQuIwhiVsKEqyiRQKhSSxlDqQru89lPdDiuXnbU nxp4iaEr0bWJab3ZteMm2abXVgECSzkYbdJmNq8mOklr2VAT4rg78HMjPmjmw7P1 eLUUGaBKpnotHqrcP6aO5K2BqSZgo9QL85IBQmxinYyKIOFGMPxl7VgcNhwEYhZi Q5WehlF+woZt5Dy0d4QOZtxpNr9Qfcd+2BPggRupdj3vU1QpZ+a8wkac1DZ5rUxE rhZhrZeQnC6pJ2NhODEE4mbG84nAgjPwhpmoHabSu5gNss7cVhU4+mpx/VDXsEE2 omHhdtsmGRXFchJL49kNk+oRHkAcad8yOPwZ6VU0gKrYyV9yFjTmzWAhp8TXPH0l xKptE2CkWwXSUiESyZlqUNwukLRldp5JWGF2ZsWZhxcIpUxJT1Op9DeZd81MtWWn y6nrKQwIw2ETLHhPCuO5LbQwetDEqpUG+OfHUkJtq+a01XjAQ0cHDjUiKWNBZaBw sVt7NxYiK8ZYzZDK0ZN+co7DzjWH3DFqw8rpymrKuByh5BccOLetbhIwhO6r+YBM zI845Fvx1R15WJrZ+wH6m63VbvFsWdujVeek6TmfjZGuy9vjYiEnFMQZ8rJB2AuU r/ASlCXTihtGTqdHkY6HlVuA1uN11XJbVlk2ZWpklNzpDlrSNE1vYqYm+G2iNtQU Qa2ybZHSTHyyDZYJcRwmC2rc6NnN5vYyw6huTNGUOs1IKwsgiVjIvrhVSw+Fm0Bb YbMSLSsMN0+TfPbFpmhZGlr2D1ReebNIP3GHIq3TCu0JkWskq9pt1y1/1QQZpqpi RlC6ywQPlSK3cUKVTMGWvSwOzNUywamiRm67aypurWc1l5BrARNbbOsprvylttjh KZWAKG/hpeY19TDjGZReLuztc7k0JatnTZyYorUYb2NmMy3shSEa0wIQUAaWwQkN lkmWwGbGDiqc8yJuNNEbW4pTK3eOi+N2g4MAEQb1MYdZg474wTz2ntckMJJeW4p5 59OOV31AhtSiFNpSzNNmsYzhAx7DyUOJ1nM0Hh1x04b7mieHVwt9+tu9d5aUrW5J ezWqsyE01Th61ua8UGPjS6CAzGIix9g0KRTJEuhYvthTb5KOmbLNVxmAjIaeaiGy 4b6797vIu1V12nXksmq25pgPIRAy1zpIpAIgmP6ALGDMcQExXm8s1HYZxv8Ap7G2 cdcZaQqz0w7qVZKmEIsmShNavC1wZl1XWlhkCigvyZBMA2TtGa5dXaVi6ZVAjNE1 U94F+SOMehX5aURhTJgkGY6Hl3JKhVLHKk8iu4GaIeSlpjJDDA+tD1FpOvJXDHcb wYxRmGyXS3FV24Sjw6kLTg8Mm3Wb6pgbzXj3HQg/jI7IceZQteOlR1pFWzXOuxY9 +C1w1E1eCS6/mJmZrCmyMBvSBqMxBkD8p83C0reOfIk0JQ66tK3EJwnOLH/ogcOY PdnGGscs5SAi7ZsndmwtmS1XKl4NgQ3WERrCyXzR7tarhUpNyMYEYSVXtiyhdrhw qrPytWukbryx/XI+lwxb8SoszW+7BkUpvNo4+rAtJ4WbZLgZMQT1Qi2pDXTA+yFc CtMREd+8kbJnkVa98aaxiXvx6sjlLsksazalCGEUB3fJWLNF9hCBkoXLuSY8uZ9f SIUqoDsPXPGhiVUxDiv6qsQLouYq2RtbnR5EQkV7C2jY8qtDgVN5eXU5wY++Qc7n 21/HdFz4OJezwj3aa9e4HUF32Nq69U1xTVfi7QCYfBWgF0ggseAJm4iZl5URxySP eAjilRhrLEe08kgpJrnmSy/r1leL9U4Tcl+N111rFB1Gg79ptwhZXUFLrrVbgArR puToUIqygkDTbUVFRtjgtrVWMcqleq8LFRkhSpCzOOSc1eZ4lmMrlDXpCZ1W/IxL AUDPVFss7KsoekSnIxwMtEwyzZIoNksBbo7qss4LcKHbJbacythxCX0qxyeV0nOU sNYvWribDlQVixbi0ogYS5kBXYrsuKgokB6halSJb7B/2yMozxOD+QdcyGeq46nQ fVru6VqtAqjwYoDiDJ1W0ug4hKGHBMqC+zCPWUcEJRo+VfGqKunqA7ig9mG2GA13 Xa/SQ4g6Fs7UbKZnzNbUaVYxCBNIMcQgZ2QMfkMHR7jK0rWtns4Q24nhpHiRryMa eaj7vf5OGYwtDUi/dJzEgy1n2srwuCFqBaS8NoeRgklskcdvLjeF4SlaVK7faapz kVzVatm1Xw0g7G4y8PdtWfEc65CCuW3ZfB3jNsGXcEZAxhIwa5iyuLHFaZw02K/l tCMo/Z67DX2zNd8H+WfHjdNkRBM6mpatnFWCNrhVjzmSlrFq66UeLBlER0bbi/mJ krFFSCTcRJLKmwCUZw0tvLyc82d6/un7KGdfSiy2eiUp71UKI3F3KSsCZ2pEZlgR AKmOvaIEeI166vHY74/nPs1ytkCqKH2PdZ9dyw4VVR9cCNYwCpBFAqP83QUF0mTL mUSa4m6+OBFfhdobGrL6WnHm5KVPEUHlDLuUZcajZVAiicZXnspX8hKe+Ft4+68Z cGPsXjFYa9sRvYT25aQMTj8WxsBXYuPIrsK04M/JHSkTFynvygz8cFho+VFEW9GN tfMIW4y08w6uHqLc/wDTPPC+ce2OPUVKVqehnrhWNmH1pF1HsEjUJOQpEnWi5afP 1vSHcQtT9jYOIgZB0t9OLtk8+yLHIlSnpRLxuNRNjttL1voec5P7W2ntOX/C9F1k 3YgZF62SRUe+RNIDOlYMIASDhYVBRdin56TjavVK+zJ3O5T8RS65YpULXaTl9dz1 SiGbbknOYBVFftwG54T0mRh64N9eO59YgHEk/UUNE1+xJbadjB7TrV7ITrqcShCj G82cswE1zjtEH9M0l1rf4L7l7UA9XvGUGDZU+H18wuUNA0lx81pfajgRy+bzoFL2 FQavIOsNyjVTvkPiRiJHLWVpdKJdIcTHoajmC3EqYOddVHJQObiLqcguYlqwbP3/ AE3G3+OObTLHAjWYGDEimThmC8hGhWllbpSghmGW1LGLdGYU37jzrxCm38OE5pWS k6P5lr0lJ3rN3Vw51pp7jlUL6zr+TFxJPaa1FSqXeJBMY8Fbjq4iP3EnaafiRxb4 AsuTIJHnZVDbcwb0uiLXZubO1tZ8VdR3EWQum77gLR2C2Rowkip1yOj5C27Cvj8B YJyqjzjND19A2q8n1d6SgTbXFV+Rq9XJdtE1EhPPu15XP3cmjE4/Fi+t9UpLGWSu QknewV91lTZVmJTMNYTJsEPEwEiHqP2R7SsJrGPw9nOZXNlXtxUZYSmpOP8AqhRC pdINC8q33h8SlUJGqPPUi7Mhwepqw2xNioZGhjtC1AEJhxnLEAE9qI2NfU1+SVBB uMBOK7YSl5p1LiF+LmHmvcccz0plFgo+hFxlrquuZ/XVyAMUYTCKlQJGsyTqiJHL pBsSq3TbceV7J6gmXoTEYywKw4yqNWQ+shq8PefR44y3fSrmq3dMQ1arXwCoCBvV VCEE2nV53ELS4522R2ypBiXtxt1OjqLQkWOduBti/jLBqUfCbIZvFeHlIYijyTSp Os33a+q9qzcrFbE1Ntm/6htcnQLHazqoRPaytkvQZwitDnRkcYfEkztck34qRlom MkjAXhHDY4MvJLTTPsODyOrBWv1LC6yWMCbDcdOQEgtRHIhKm3m+1JctmD6kyesl 0A5iPH7VdixO6Nt4y9UZaetRxWTlIxRgVOZ6kwHpxiYQ8eqhJfYV/nx3YMTxN5xx uNT3BSLqXEShtek63VoTG5INDhwAY8KeU/ZAUSntYbHmq+7L0Vc4IhaHxkyNbDOU MNJxzTQkTnKGVpO77PGiyV7uFOoUHmVVFx1AlWIabm0PC/Ccfk1SQBKUJIdW5jDj TBK/piHBiBQCDvMFq8jY5zSpXIatwlm2POx269LxFBr0mVHFGkYsbW6tPX1/C49u CJTKuN1mkXWoNhGpEwOLeSSmjPNbgp+1oWubvAQMCW5top2QKAEfmKxN1aNkSIst 5OHCBEmhGAOEeLqs4yhojDmc5w3hal+eEuGb221ZwWJmvll1H2VSVxyq7wbZOIkR EOKzRrxED7LMSAD7mAmCTx0Nq1vRadfZc0NrDOu1KjoGiltisxNUJICJjZK7Wm1y RyurwwilCmOkXzPda6a0p/FmtxRz7NaDsTz7OGvrN7Ei7fIPyTCcqb9oqwgSPgT7 TaXXEhYj2ncO4VlhOE4748lTtW2UvKq5Z4emkfH7olK/T4zBKc4U2QyypmGfFi3B 0u4Y9z5YDjqmkvtvpx2SvNgf0OPT5rfIDRkXzQ2LU6tsKybQ2FbQ9EgPtrnoehVD UuwyKu1Y1QdkgRGIDaSdrUO0GCWNuVsTFYpkFUJOoyNMnLPtIWbZJ66/B6G4Z23T nI7X2t6TBaH2Yt3UlwqkbAVqCrlT3FEREpYagZGRZE1lKWNmUKIsaXIeo0qIrlfk 9RnTU7Jm2jZ7GH2luh7AujGbLL2juSI2DqSwnOUqRiQkWOn1EYj1hiCCFiIzPcpj 1i+K+SdXdkp12MJTHHiRVgvikK6HOguGcpR/WUoiGZVYFzGmU/YB7ewmocbtgu6v lmKluXYFduFGliIiJr1sjoOSgn62/lxmKaTZowgg8aMjWhGxXslxysR2Gl++7n5O ZJuJlF5mccU7H4sWQKfF+dMa/Yabgzi3WXjs1t8R1sWJbQphBbgcA+Hlsch4kvAw kkBEspDBjwGFVwLhi41uoy0tK6RZqdfKh1vKkh2Ki8KseSHUkcyUYjZxKRhyGiB8 NkkR7pYa1IcRhK8IxiyNdOdtAJ4D8fo2MnIzZm67/wAYNd2TkBZDY6bIgdZzTevn Gb2uwfTxxHbFsZeyq9Jpd11EHCni1hBNvmZKFj7BrJvYVyfCOD3T5Qyo6hg6v+os 615RShDqKhComuT7tnJXZsBjqNLHrWdi3etvr1qiCn2mtQrjykvnO7pvxrTHacg0 tfwvoj60XoyBzNs3AmmmhTZW/cLdq+bIRWqVk2H2nLmVQxhNLyg/tSuKq9xmIvKP D45pDXj2zjt4OZx27Z/m7fv6Tjp3/Kao2bO2cQhEL713mS44Iuv15h8/LtqkcsME REIMw4aSb5y7ywo1ll0t8nGWUIcfcXhSpCtDejFZbbVcze8NjLoVhLcysOm1EOMs r8WElllWHJ6wuG/SnJR0hRLS4yEakY8UZgUtNgNeOeAjIn8g/Kmh/F1Gtf3bP18Q F0yXRqiqxdyN2VyENOtj6SrFtiEewPqLPqiuiTWDGixqgOk/kD5S0T4vo17+656v iF3DJdKtCrFy/ckJCGnXoUlPtMQj2B9RZ9UV0yaxY0TaoTg26cPp7ibyP3/VrldN M6gt+xK1QVNtWWQrog5C2jHQ3j0xUPHuksSdqm0htJIegqqHNTLDZcbl8FvMrGYL X3mR6fGyOKWV2kOSTsPUzpQYeLoIC3GSMEfIreQLHWiBSfIPBNOPN4EFsAr78MaS 8EOQuJk5MGJcnY/gx+u4e1QPKmRyUO9MO2fU8YXG4dfySNGhRd4KjDXmFMpGSwaV JyzAzrRDr63I8pJDLCGxVk1F82fqMxWi/p+z/wA46Baw21U8S/ABXG2m8ykz9y2D E4u7UyCUWMdkMXdRUyBsALcAxFma0PqNW4RO6/05h8f/ADrseBUjY2v1DMVM212X wjUpv1H43CXMilLKuRpuNVkLKawXMfbrVrQ1nEfZP4Mlcbvx11N6ePpqb9oNNGLs dkuWsLNWLHY3AVk2vaGztiVx+jhLEjY5koxqJjHZZx+DrYCCx6xWQJGUkijCsWay yFLNSVJVlKsZSpOcpUlWM4UlWM9s4zjP3xnGftnGfvjP2z19Gv1frwfww4VbV2vV ig4nYT7MDSNdvkII95m0XiZDg3JOPUwy423K1qtEWK3RmTfAF0yAaGIy7h9I7/zo pWUPm5SSmpUlZknLnmSkiW4lCFlHnkOFmErS0htpK3yHXHVJbQhGMqzhCEpxjGKG /wCnLtOd+QdF+S/kTNTYybds+QDZa2jIZE23szlKeIx520LxsUVIrY/HKvVwrW0X DSw3NxyKdVOLGJ6a/V7e08st8dYTTiXTxeA06atTA1KAKp4uk7JWoS6cj9Yxtq5d ZXaT0NqAwIUF51qy7IHMYHR0dHX0Y8478Ojo6Ojw8shegv8A484H/rwn/io6lw/h EThfILYHp9x7UhXGI6uynIcicPsi2SQwYg0zjySa61GPki4lnlDw7qUx6CGVk5wl pLzWV4cTEd6DGcfx5wOO/wB8nC/udR0vXqu8gLGSVxzzAAs2X5MlsSDKhHSxWMyD kyTrbAI3ulNPsJafeCU077rSmsqW17ufH9lTNsH1X7NeilK4tEoATLSEQEzasO0y ciHIwUkMHMBJREFMDM+P2sfSfv2Nm/DZpi4jsQkTJhAtLD6jCxJk9pGIL1jJwMzI R2iPG7vag42sCuy8PWNXZSCvLkhJ4jJ5LxDjKVvEPJQjYJcYKhDSML+CtYI7eVJb W8ynGVIcJAcFuW1urtXveotdQDlEt9Zg7ZUC4S+0ECGmK/ZYsOZhJhmIsV/ClgFm xRgjyRzmRyh8ry2822vC04jvsVf5Q1t9Tdm4jz2C8Mutx+IomtzoAzbrfxlYw1Xo 4sZT+V9v28OpdRheEISjulXTr6N6lPOLU9KpOvscZtox9eolRrVRiMfhx11X0OrR AUEAvClUZ3GVKDAa7+Rj/ivP3ccxjvmoNcw1K3Lyz+d+oX0CakKy+LurmJ7Qzngr ffoPWAIRCB5IRjiBmb22jYcnRisGsa3FNvc/rvbgsvj2h1gPTMyS6Hrkyk5KCNkl wJyUSRR4rFr9Nn1Br1UJDWzVKgqzH2lwSLOsE5sXXpsaG7KmBCEzs/iJ2LMSzcDE DqdMmcwNcsFibjBHcV2vTsmgKJJb9umw7BuXMjmw1Bx8RaB1crORB4rBg6yvZak9 37HkfiIyuVjR8Lz8v3H0pcS73Uhak5xleVq1j1fOXDTCjzNAbPAix3O5cpJV/AUW IyjOMPPFFvUhllLbOO6nO5DOMYxnGXm++FJS7c20zdiE1Tlcw3YYpzfMeoC1thj/ AFduLuuuHc65S5kZcUqLhomfq9RiJeKbLPNkH3h7Q66kaPBbYTIMxi8XV1+1WwJD fMLSrrBdAshcx0RLCKulBT1gljIfkyRP7cLGY8jOAzeYubRSubKBY0CpNx6TQRql sfnYFQhafaEu3RhwXELkl9Z5YUT4uHpvT8xrD1PeFsjZqvX6QsSY3Ue+UxHsQTjr 03x03LVI1vLv1GSaJQfKSg8WGhJY7r8gSMM2K48QylWx9Wi6zx3qL8mDp6qSGa9b /wCKO2VmZesrlIdnARNE6ppbsrBSGSADZeNHnahY4BZ4D641qYhpeMURmQjDRx49 LfsOlyJEScnaj0Zf6inJUHIk2eCr5gi31MuFgtYgyRo4TC220qGeebIfbMbbbJaS zh51cr0b6xrcpBKCBgDpK4+2ppseOOj1xbr+DEtpVmyNfPjR2shZy7mQVCPiIJR4 YCcYVl1GOJmpf1osTk5nGNQ87RMmrbJJR2OSNIiwGx+LPt/VEpkvwg5A+NmdG/jd vHN4gQyyrVZdIUBcx67Cy6LD12IJTkxPdc9uEkMdeTJfdfMUw2KQ6SOuXir8GW7l zIwgO77HJZ7oSlSHm1tWDDDjylJ88KwcjOM57e3nGcZT+y1UryG2JcxvkTH5BJS6 E+LaIuwoYdStLrb3tmnWB3DqM4y4ypI7ric4SrOUZzhSVL1/NTUVbth3q1TtKlLJ s+yydilAnZKVMaBNmZGQlzmWpKYUa4WQWfJFFlv4R3cJcU4h1flhWVAG1HZ9qTG2 YljMZAJJ0g8im/CjI+UFhthxezKNcIrMeXLjhAV+UtsTX7JTHZD5o3x4WfsK1CGi NSob8QpJc/Nft1B/VZiyUuP2lFn1LJpLTXImmExMkvtJWAKIk+3XjtOb7k1Ne/eM jWD2KNUPqrXWEqfuctQNfbWCQL+BbEdaxjyK/XJQXVIas/WZmtTjQOy9xfWkgGBB Q0kTTRyiHHo15P8Ay0a1VoqVKxl15KcPMqw+pec+297mEKzeL9FjmWATwv4ezGwU lwUdrnVc1qMoNLBr0qaLohu4aSrZLoZTmXUzNsRQ4g8lJTooI8lMOOEPR8c0t0ek 7Sa/dbhTIwcqQ15BQimVRuD3Cy0WHLjLbTKpJqRFgjYzBilONr9xMiM2yThTbo6V JeStVeP3KTk5wmXIUuQjJTemq5eXTKRstrJcRdZiNeNbklmqkKGDJwsqLJGEqZIl 5tkyMizixcPFOyRhvvpkmj5arRymTr27dZMWpAVgbFDwaZKImGihCiguS7K7SwJK DiDX7TVEPkTCXslh8RapUrdkqkGbWAl08rsABTyk7FhwTHUJFsiKjgZCZW2UrdKR /CLtqDXW78DXnbINDtV0rfmZKUdJzjEQJOzXHhY5BGUq7i4MxXJD4bz/AIMvOR5W EKzkd1TURV9loMzVN0Ph9xCWF78PnFoBiz4Z981otSRFJlWgJaWW477C098+0NnG Fpy52xlSc5NsnOYHLHZIW97bFUOk16pNgsU+i7as0qifedFZKUmTYgYsFsSBIZJJ KKFaLho15KyBfkLnzWMSjvWAObWuE4PQ7NG02tT9wfjxR7TGSsTNHBw4MmKVKTgw MhCwipoGICjjDVw65dp2SyGQE062VhnLLRtt1Ga2WoGKZUusVZqr6qtVDIj9qA9X rNDGFJdZkiSwpVBQJrhgmIvmkY+zr2pXTzCruPW+ncf2fTvAsAhL2e/2rsqVEDJw IQ9Qi2RlgNlJrMkuDau9o5GUsKszOIMUPhZwYSaWuJDkHSVQHBHi9BpjBlyKmxWy yMw+WGcqc8W3UdlpzjH7Ll6m5ZrbsKvaqoYB+dw25ywsVuAuItark1PIrcKdY5h0 GcKSDAsMJhYmTMYeIKwKSqPKFQWg34oxKa7ssLxXNq4xtOozZMUNSae3XIerWBmk Dx8PAa+pMCJHxQcbkMNoCKGiW48OPb+KIOGy0Kw2hlttPWOncVk0vvPU25J3S+5k yetQre1Gsx8Um6pNTZ6nYqt4pyxbnlZaazPPvKcwXH9sYylLKs98O6M7RrZTdxqZ GUpqMd63MQ2iux1BzhJhywjcwCkOJ9iJhUD+P3gplRreRt4b47K9ife++lAuQuwn INq+w0VWLSEKAEKYEFPWV2RlxFHbjsPVz+3K5yI0HGVmR3tAj0iAnTToiIlFSNas 0GRJgh/MwBJylWlDY+GNKEW+THRhJoEhLhxUybFR5wNem349BSL/ALw19tjT/KPS b5BVw0uVKTUaTVPhPtIHlY6QgZNUcDJEsOyqpGuzUzCS0M7koOahpEoR33m1qaTp OWHNaZ5k0Cva0sGs9n0ODiLnD3Z2z2GjS8cgAyKj7JDEtpjmF2PJPnCz5GWDPqYz bJDrzRADraGTOseI2pqKW+nxzsi3MljpEBjn5ytWOYbDaDax4Nntw1YAjlg4Xhtb zUkoNbqU5TknGc57oMxi6er5mrd1ebFsqxGxhzX+pFP4DBf1K664Mg+7Z7RP9MV8 9GRMdnDBZi/uWBt4/cYq0RtwC1j9VNUn/nyP9Kw2wS5XALmYkShss4g0zBdNNXDL Vs3kFyk5FgU4ytxu+NxbIv0Q5tiAFipyMjL5frPejY/MUFaGZESMEIsGR1JxJSg5 boqltlOe3nwXDiJb4zRHqj8INl2WWpIEQFZLnWx8VmvPVw8+c3FrS/6WrCB0mz0v 9ZYXbL5BNmqGPS4CA+UeiNzhkhb/ACNoiNgwo2mb7NyVYjoYiDOjLuMsqRefLsK7 HazK1IMsjzuGRWpOjF19tvuS6kdyBKblMR0iSlEl57I1tdLANB2eDssQ5aqnLN2a sY+vYVEFGR5AzowpDE6ESoMzzZZUHJRhPcM1tJKXXsMKyxmeUvYXb6OWy8IV9ZFe w1aoMQBLkBAjLbKxmSFZD7CCFgJsKOIiC64rwtDP6LkMJhJsu+hKzVU1srNjH1bE yZQmo0oATaJQsGS0yWseSmSCCv1yHLaMK1VXqpggbM4BbJcp11lwtp0eDZCZej1l ZdaWKY9KSc/NNIUKWysEeAYQSCrJzJbnzXNvvr3pzU5kWCi1fSNsjZ/kZuzYcfK3 wg3BszA3Lbd3nokuLUZGkORrsmFKjGvgmh4W3lzK1ZYbygUd/tj9RDmZbq2vV0Tx 6vTdyk4WxQVimCZCqRNKZCNrzIQcuBtKSVMVyZLwW+aU/EtxMSTltDQjMsaa8tYi PcdtGC6vqMiIo+svXaWddsN+lwqTMhCBvE93PoDVgaWF8uGjWsLSIlgNTCnsvvpx 7akOqnG9bfiwxIDjrNW/cZK2JULyMAgyDlr4re0hVCvYIGY9GNIASZFDCVXnxvou abm2HkqlzHUVexVhzKwLNkgJf0q03RUDHe2VEawL2qSDGPAI9YtZwbreVhPxJKWX Tmmk5qsWxNSDVXmSclxMOfMxEALOFERdUejw49+enYaDHfPICQiVlosFOUEycegn DgyY1AbU+1qfcMcCOI4fmVg5GYlKwtOCXnEnRpq7EiOdHZaVht32WEtJwwteGfJS mm5C4vi/RdnyG/5mWJcg4rZ+pIzVwOIw3CQZaTAt9C2SPMiyLy5AkSHi7XrWtCyY 6Iol85oyUFDNjpCKcRnnNUDTdxgs6lhoOGide6pimKpawp5+ymTL0h75Ta4WOYhn ofuaa2kx4kiSZLd/ZdYQIvOcrchOUtzjdbxmeuV7UqyChbaGStoVWULYR6664sOY 832GKGsJLAXi4GkQr4mbAw9YcltWY12lZpe3GOlFQhVRtWLjiXD4bZbNOuusCK63 TbMHFKCQSehMEvLOX8Hn5N0+hcE+OFfMk05j6Hf98QlxEcwcORXE3jd+zLuGQYKg Ikl9xmmbFrdwaGCGIVIhHisMONvE5Uyyn+Ei8qKnbtBaJp9nOAYnLDyXJ23HCOOI RDoEp2udg1iWyloiQwYtIc1t+r/HGwktvIWS1Gko9ltBcJ/Ha5759Pqc2IFVafO7 c1XdJaBmScUk8OQn6eDDKlmVNE64kI6Ln5Y5Ykwy0uQipeNjMgxcew/IKQOlIPN2 apbu55boqu2eSEZZ6XqSvPDO0nWZEeIfbZ5YZOWstTX1COFiqnDmlsPLNiVstEmN ISnAMkc6/ZF2WzddadrQ2oyqDW6kK5Ws+bZcr4JcIkZaFgwjmFGESuTE3dVCbIqR GgbYnbvo/wBmtLYm/LYY1f8A2g/1eRYVjmFHVWwuCcBzDYCQTBvNaTTaJ2KVtZpO uqdb4TY05dj2q0eiNciWlRkSYklUvJYjyTDm3Y+FghZKXfcaw04U2G2IAObIPDB4 kNh9XQ8LVANaBxS4esvxy60llrKA15GlsOjHlOlpFfRiROdMKPOkXBCXSJAgg8hk l51zDnU8QtQ6dmdy7V29XILVlGoUX9M1dVsV4WKrrQctGkOlXg6ZGTERkaC9KEP1 hiMfFlCXyWmZBgtltCA3Cn18j9IwUrruxw0ZJhMtWerS0YHNg4akmBkzEWQGzJD4 HJYbMQPkhJKG2i2cP+GEJIa8vcT9c/8Ap6aRrvx38Q5PYGYqR3v5qxly3ViwFZOR xmqLS6hg8cPZYDWjJXhsZeyYmNWypuIhyxZQ7efET/qOfq7DM/qhwfw2+yVvVvib I4/GXL1ObzsTkNscdXI564BSbZtFiaVmrigUyDt13py0pL1XYiYFdNwsHYOZ+6LU xmIXbKlBGOVs6ddYTBVKLlXZfFuv8ytamHhYyvx8aFDFnjHgry3a8wrj7WJ7BgU+ 2huHG3tziTVnhh3DBIwexZiHNpWm361AsmGIIEZMBB68pobJMfXJmUEPCTsHZzEt bavKPyNqqNYuVPIqwr0DnD6Ishmz9R2SzRhUVM2Tmpq3B9eICipYZdYu9vqWjLTm XyXHGNyoNXg7ZfrXU5hvKYYWXZhrq2mQixR8k2ipRyMRyNiuPxU3eroRHOMX47XO v+RceKbmAbkoyChy7rq/SdCrm8pIM0OzIOuVa3AoDiXkWepg9m2JPysqKJXPzI/q Q+LflD5b3vZstoef1jBUMRdHVspkdhXnslksQWI+kq36uJwmDx83LQmywL2CWTpU Vndy67oHIHZT9Z/iD4f+J/lrI7z8kbPSqbDkMVs1fS8dOTGMhi6VepiqFhbaNhde wdWrZJ9qyE49XtZaZbk7rlO+nUz/AJAcGy9jceTb8frLcFMqWzquTTzCadeBb7O1 2lyY5DQdsO1SNO3msGQ9tFaDFblIKpWfYUPC2sCYtMbRXI61SlJqv8L71G8OvUcG 00HtBq9aCuezQ9M7KXH2aww1Bv8AXZ51+FgnbvFROHIWyKps3P5FmI2bjZipkPt2 eKaPYgZd2wN3OeVu1JDizsgXj9x7yNXrVcJ7X8rBaLvszr6iUbZzdkMr1Xsta4lQ uz7dpyuyVuj4hiHImoatbdrtFibhOuHQ2vdibBl9gRw1JPmjHH8yeeNh1vxd47yC Npu3G86uL1bp+Cg7QPe7hRrndCLBsuCMplNp0nLj2aMZOt1sl7jCln1uPjZCTlrm TVQhmK4/fps+IPlzTsx8lfHPySNHafi/YUZFGE2LHvYNGqxE1bWHbkcLsz72yIym ORPoo3sPlr+t171Ryytjmqf1D7KyfxdqfxfC7ujuTRuFkQqWaOOorUGVswMqI1Xq NKnDHjXP03KNkTbKbgQkZrsKCf8A/wAIS3NUaxt6ncMtHOhUnW2tq7H2rZGsaEyi t63Dulgw3K1CPzS4r4daAnICAKLsSyYiIFy63f05NMNNw6xHVwOrBnqW8HNy7e9T DkLOWCv2rUFU2FO12w0Wf2Pr+3V38ZwqKPU4hyUq4U6BB/VgQpYE6Ml3UFMuxZzC Bn2VPO5Q0znkj6ZN5040/NVO312zwjiD5RqPkS342dHEedw5FQQ2G48mKkyxBcZS XPGSsCxIvupwmEiEDKWV298Wa5V1jQ9doIqlWtWcejLZiXIhF2xnMqoLmUdkPwBr Lg2WlWMrPawCq6q7Dn0jERHPWLVjK24tSyJrsKqlTJOIRWQRClSwP/019Z9kAMCE kwjiPzmZi56Oss8AyLMIj5Ad0Q0R1TJA7yfFba09s/pnKVJUnOFtuIypt1tSXG1K QpKs4nVg+M/h0dHR0eHk/nok7ChKdvGvuypbI6MnjYzl1eE4/wAMn+fOMZx+vf8A T93XR8h6qfI7IpdY3VEzcHZNL2jJkxCOobHPIIdGjzkviFs5NijIqdSHDSMdIgfN h5eDMFmoKSJj3xHD4P8AUG2Z7VVlBnYYt0Z0V9t3Cm1qTnuhWFfpn+fH8/8AP1Oj SvVuqknGQ6tt6o1ZtCah4gaDBmNh6+qFzlRIkZ4otmLFkbJDyRbEcyYccW0Ey6kZ sk0t9DeHSHlLTXKq7tZ9R0sFb1ysyUcrZET/AHA4+4lE/eJ+8f2mJiZiVVG43H26 91EKJtZgtAXLFqiIf7MWX2IZiZiY+0/3iYmImO3lN5xEky2y2VeoxLTaUIxE22cj 2UZx3WtfwGC8Rby1vZyv3CAXFeOcJVhSvNbuoF3OkPDLWLJdjhW3FLeHkyo97BiF 5VlTJLwMfGlKRjvjxzkhWMqThakZ+yUdIj1X+O2cffi1xs/o/vF6s7/6f7luvP8A tr3Hb/5WeNn/AHF6s/8A5XqDx8Y6kKZQNSwKp5/ELTAke0cTIGMQa5/v2WQlz9+e fv5Yk/L27S6Hldqk2OOSOko4KBnmIYBcgyPtx1YJRMfjMTH2801n3bH2uDNrp0jc RYo2MOh/YDmTkoGDkxFjGPIZUTgcwnydddbRItFDK88oW3jPZafbpKgbJuGhthV+ l0K3bNoOjqI/aNsWaKiX1jVOty9id9mbNU0vOWzgjDC50duM+TNAQVYtF+yKJWqR apuBznPVf48ffx4tcbO/btj+8Zqz8/6e1W+2evdCeuEdrllUHqarVLWVaJlXZoyB oFbhKdClS5A4YREqTF1wGNBekXwo4AR451hRTooIbDjqmhmENvWC1DCa79TGNVYE ba4U4LFp9oJDiImBFxlAycRHsmOJZMdj5KZmWDYt52HaZqFln1iOk33V2VqiKjBP /wCMySBGShfM+qJ+y4nqHAwMQjtSsNAACHgrrS6beohhTzyXrLRKvNukGFmpYHyU 3KQ5UhHx0NDsi49qFmkMGFZMeGhQU+yI5v7Q3xdmpLyjdUUeEiHVsYLDjdbxQTjy U+3h3LBcUVDZBb/wngnAJbvfGFOLe7+GFnN9Rzhzu50ec3bx515NWbMhNzUlYYBE trudsMzZiRzZyWtsvriVqchcZI00fBnzrUTMkilEyRATo7stKLL9meVfpjePfHGm L7/f/wBqe7fz+32/xl/p+/pstfHuFfYKwi1mMdJdplVC9AJgimCI4XYRZ4LmI6zz +EREBAxEePFP5Q2CtVCrYp4LKCEAMOyON72JBY9QWTaz6vIRHPaJj85kpZJTMzLW WBtHRD+X6vqapxanRx1OPScI3LEKK+qEFPeQ5b5jYRDMfgQUeQhD49aX1POJYThj 3D5a+HPCvae6aJP2GSuEDxzrDMDmV17K7VqUzkzdNumYsCXrqo6NCkq/Iw+uDIgm P+bthiOskeMETDRtGqt3TGzw1ZZkz6onGvQYuSeOuj6DSLGMbKSUbcVhkWm+xJUx DJr8kzD365l2G6Q8aZD4eBdhoudEh/aOllJBS7MSrhkd+1vVl3deLNmXTZpJCEv5 dSlJTuMYx59+2P2/3fb9O33+/T/i9exeJOXVVOO0S5Udu3ZfbsGBEJSPd7DEInoE TCgXEwA8xPHkZzG0ZfOBCLja6qgtFy6VKnWpVQYIkMHC66gJhRBnME42lEmXExzx Dst/a2nqBd5aB2Xryb1nelumyeGiwZSBVMZRIS8M/ZYGx104BmyQEvMxslga412S moGdfDMNjpGUbUp3KDwdTrCEnrk9j7uEJIKHX2EvWSAe2BUPEZHHlYSby4Lgl1Qw 6jMNHYWw6t1C2XGnluI0v6yC5GvRdN3jVaftWrx8iLLD1/Y9ZgrtCDy4gpYI8qxE 2UGSAakWApCQEZObYSU0KcYwh3DRT6FqVH8rfTOWO3kvjVFqdylOVZ/jR3Wnvntj v9k7KTjHf+jHSK/qOJvG1sfVUmvOWOOm4R9hScsKZXYXYUPY55L1rDnj7/35X47d 83j1pSX0d9VZUJrrvVyL0gIQsIhtVtV59AGBD2tZ0j/bxPEwikFsHFRGUNDW6zy7 ecuMt4scdUyXm28Njt4fckI6pxMoStxHnjHuG4S7hnwcYFylt9502hNW8j99C3G6 6b0/fdnBU+vzxU1aAYsYKKGFrbcVLTNSrEgVmJjrJenxpqCNY1vVHZvZVpDxEvAV 6Zajh3B+Ge5ienBXyAZyv8aK0qVhzg5QBExeNpWWJdLjyGyx25SvWS9y1fnI5bzK EHQ85GSERJi5dCkgSw33mHONtvro7DDl4mOpjzFcqleEAh4CvQTDETCQsJFDtAxc RExcehgGNjI0IdgMAANhgQMVlkcZptltCE68PpeBwtqL9eux18e3S5aMSaEGMgUA CQRXGZGZiThHsmJnk5582535A2XYKc423aWjGlAd6FQDFJysxMZNlhtm1MQYjPr+ ohUSMcLjjxO42+RUdsew7NyIOVYJqGFhUOPiveTArKRm14W8l3Dyl4aCYbQ62ttC 2lqadHz7fuvdn/ZCzbTy1DhR+G890JTh11vHtZUhSsZQ7Em5wpXjnGM5dWlGM5yn GVqUrOeJ6t+nZd86at/HfQdlsc0cZLzs/Pae11MTUzMSRDhklKyspI1wg6RkpA15 4s04x94ksl55991x1xS87VPqv8ds4x34s8a+/wCvbRerP91V6TZHQNbyl5+Ru17L bNgpJk/VtgImZkpgA5mAHtJT1j7RJFERxxEK8V8m7ZhsfXxmPtVU1awQC4+jTJzA jAxJnxEmXURGSKO09YmZko58403adOsJaj7VUFmkpS2hrAtingxs4Q3hKlkhw34f BKXlffPYoR/GW0oRnPlla1ecdb46aPj6hrik5Ek7OVEwA0dU4MyRtlumJEiHZDiR RR8GkSRcjLpejgYhAknk10kEmLEjZP22m+tX6r/HbGPtxa42f0/3i9Wd/wDR/ct1 z8h6xlXprcnI6e1PqvVthk4kiEMnNd68p9Lly4gkkQ1+KJkq3Dxpr8c+ZHx5joLr yxXCgQ31tZeGZWjxHx9rKGAf0tlwK46V33bJ1hkeOs+mGCBdZjngokZmZkhmeOMr Pyht9lbAi5Ursbz7LVbHU12yiY4KPqZUbI7RxEkMwcRERBRHMTI/cuEvJWO42Vnb X0UK0T9lPUxO8bazEykrueh1CQbhmqPaDa8Ist2VmCpRci7ZKNCxWbVrWPcqUpLj vFY2EBrOLBGwIbCUJMGk32RRnEsJhpWbrpCltMMJZxlqHlYsd8wl/JhLxzxA7SF5 FGwJhjDzuG8Qnq7bwj7t+IF2aSyjJPu5Tkt3t28/Lt/K/f8A6/06fkn1P+Nm9gEP citI0G8WJ82LkpK4YDJq18lSoeGVARzMvfqYZXbpMRgkPloFqFk50uHw2DFLUCp2 HilhvOX1zEZsVxfrcsSErRYSw0PSEzzIrNcxHX+YgTExiCLrETPPjBg9rzmvEycb bgVPZ7bFawpdmu9nHHdgNEpgp4GZNZgZdRgimI484OP2TXgm2h2bheW2XXGXSfll NSzrLiltIW0ydJwphKwB2cuKQl1p8pWU9u7uVdlbUjkSX9MHiY8g9oVCHsEPntDP GlJfbWz7BDYbA0d7TLKBcYbQNkV7sQw8K6064p7tv7Kz0xvHv/Y1Rfl2/L+NPdv5 /wDeX/p/L+jt1gL9T/jZokBbvHXSFBo9iYMlJGNuCgybTfIoqZhkwEizEX65GWG6 REaXD4dBdhYydEh8tnSq0gpdmJVwyMo+MNWU4XPVbvdSg4XbeEL7RzxJfSpqsZxz H4sYQz1GJGY5iZfY+YNyagkVnUcb3CVk2jWZLekzHIj9bYuLX9omIJawIexSJQXW RkV468I7Zc9V2uc2lsVnjHY2oR6F0ZrC51skaYmbbGT0e6bO7bizPYsdLosiBHTl Tixg4xN1LlJ/OzlhF1uswle2pHNs8HYvG3Yh9ZvdRP17aJNQ99PiAzo5+ItSp6Ib EAsoFoqJslDTwj7gGQ5E+HlJYRMzH2CHk0tWIGVZCjA2t6mu573cFT+bLJJxgrLy cYLexjGPPy/Pz/rz+v5/19Pw0X6w2Xq1F0nd9Vp+1qtHyIsuPX9j1mCusIPLCiFg jyjETZQZIBmSYCkZARk5sdJTQxxg6HUtEvJcl+QwuMytIcffpqfUX19Sp7BCpBZK AlEBCayBZEIyJRxE8eQXF5/L4bIFlMbedWvMkpa+Opy6DYLmC4GCYNE2CJGJjMTM c+OSoe8JHYz7tDqQKn7fKjrPfLm1kujDQMUyCJNzhBShpFsYcB6VEWMwQthl4xKA cKYzIDPo3J2ur/XI+DmPxbtRk59kU+vWm8aivNc0XcHXHQiRU1u7TVFjavO16T+W lNKfhNkWZT7MnHGMF3Vpptk9rmyeSfDqeqCQtFVif0NsOULhoI+20i/WyUkJylSt ign7TTZATYDO2wcxEtiNjpMliAqS7DMvwY1X+QTXJ+xQE3Jhv3kVSpnZ/GKJf0zv He2+dQ8XJbRvMbmFRtfRW39YSdn5Bce2CNH1AW+1yOl6s3H2o/Zjk7a5KjD0pgUK 3ghtTl9j82GNEhY6DquKhygwyMjFyWNOMjP1LBhYgK61WeoQoJKRGC/N0tYoZln9 OAtjH7ztG0BFm7sdzCftjaVRTMOsKtUJtNYb8hk5JjDeSkKbZlMemt9JSvOllaFn 7ud9JuqckNmWqNK4+MjUrY9T29fYqwXC46JqF30kC7G2CJ2ZOVWftkFfIyRr19tM NVg9M7cnYKrW+fokRZKCTAuMyWycXHD5uTnHDZjm6LHxdtuyqc7v3ctIsj8TbB7a FozXdpDfxbZep2GI1VANbXLi7nLRYt7/ABYC/UGrFvJ/We35KvbH15VtY06MrrPv T/GY1/zfu9ruMdVtYsafKtOw6Nsu8bCdnh1yuzbvs+r1aIj9QUQpdn2JJ3ib2pZK rp6jxEvqOUJlbnbE3pG/7ZD6aqmvJBdt7lgdnzeluWV/0qRSuXURq2uAW8vZXGPl JpDbHHyNmGLRFS1i1hTtxAZpXJaH0RKbolaXe7VAxBUBUAr49tmVlhogqvantFiv zu4ItBZxeZzFCzUwlTXsfcxmRPE2quJx+IRgsfj1WqFqpZijWxNWvSYHsiXIAvct 7iNh1tj9X+HsriQxu465rOTq5DYLGyZ6hmMIzYK1zIX8w3OZfKBVyGIvUq2w3Mnb vZCndrhDqd9inV8nRTwpVWXljvqf4Rblv3HmfrxLO7tUPQrDsjWDgTqDGykxTYu6 U+erkrMxwMrNxrDU3WzkBzFIg/kDrKbeHa9lDJVxTgS1xU5bzerfVLoY9xxsm8Ve ZENhz9g242q0G5kVer6p2dAo18dIYrUXNti62r0ETNhQsdm0RUBAWllJA8oIcTSq 2zxC29t/1OJMHclYvluqG6bPtHe6pqFnjLVLSWjqO1Z7FIIetMs+kts6tVasgV+R hMk5sgjJMFD1cI+QnKePK2ouItl0rG1GPb1BY8QNWFjqv4xOuLVL1cRIkXCMD1Ua xwMUcC60aJApCAUJYo9uX+nCiRkijLUeOMPxx80b1rH6S2YrF5DRt8YeaQeQz2Rx KJsjWhiq8U6kqy92hXed3uqypJXKpLonVtSd36lUC3fD20fG3x4GVyWAw1nYfjnb MtdvY11e3XzVmvlNct2KNWxj7dmwNJmSwq7zsVloruRYU6wI2W+xQJNSfXHuvHHj 1SU89Lgm0TvIWvha01tx9oTF6l4agT+2aHYdjXTUd5sNOjhCY+fN0mZsHY+xm/ru PoEwwIiqyzD78rEJ6YB/BW9FV2n645SeojunIAUxPzsrr2t7U2FLHguxFFqMexft 3XcmcsYwkJmuWKfkoIefvb89KOJktdWmOOdgUR0yucwPUF2nxruZCpDZsXVN6zAo krHDlW6Gf3DHaiqSplqPvVpEAYfIfrbkK3g078KU2Rq932NM1weAjjxG60bYqZHX zq9S53Z/GADgR6VWrdmRvDLVtQrlQ3DuCv65skJMXQeWnWa6LXnm60GK3XKjsyxz 0cTfJ26Q8JcdwX+2kQZcNERpEpjYc7+HflgPlzX7+Wx+t7HruKXbrIHJbV9BSa6m Kzc3rRr3bk01oZ+Ikx5Ktm1vpcfosDXtOhvGo7NnMxsOPQunjtYrEGK1qfpW7BmN gydaYbkL9WmdkkSqpWibFlrDVTropykycbBKf7m/bNCcxqfUd78qZ+T46SLlN2Hq vilXKlcbVb5dFkvC6dYU7etsLruv0TY1rfDKY1WIjVlNlZdsaMMmBxyrGfdY8iAZ Z6jfpKcstfyNPjeO6rByAolwAIEmn5h8IC00e0wFHUeaPJttKyIuF2XOQxmKbItC x1YqtksDNYuMnVa2PGWo6Rbi1u/kbI604sWLjvobWO7dIGSkITsK937YQlXtlPGq 7cFrKcN1TVTo4n5djiAoK8ngkTh1eCmg5ODZjz2QJaQMRH96r/qYcZlwNs5U0KR3 rr7nPp4/ZvDvTun9iDQ2u5isSthh7RET3JJyivuk3rNLjKFe7TJUOyBzDNTtN3f1 oNsWglWCnVaQo9ja3lclax2Lb7J+ss0q7X14kXV12LKQnqdcZFlMBd2kiMykZ7HM TEkBTTOa9grOJrZPYKCUJdjMNfdkoQ/C5Z3qpVrWUKpfsKfTzbiU+U1qSKqhgRRS FgGtVhMSdS9C3a2+eHwfN258k9J6grVz+WPpTWx4U7LWi4Hpvrep1EX8siQgQaWg e5JiWrJJ1uP2DJ1+joRKykO5KxI9WfiK5j8GN28IbJVYXbP4VmIW+jWAmg32iy5U zTbs1TpJiv3F2AKko2FmfZrtpWVXicy0JFEEFAuGCjORpIRZN/7gvV7Ps2ucarpX Nwt0XTWodJcQY+n65/i3r0zWtt8fSuD3G6Wjo6NmJ8lyYh4mvcjZPldVpq1e9bZE 27r2HUbCc7eNOVYug0RfUy5KXzkFyWssPZZ3TBdR0qVK601/WuNMfJRfGyqpFknT r+rSDEy49LSFKtOyX7RaRrMY6lu1uSmZ+KAhIE2Jgox4qFnrO1E/96rf6frYq1Ws 69+1h9VOVdcqtp5L949wsWutTVYq/t412rsfVTaOyDEAnym8xrScRqeHy7Uv+qzd gG07JGuKx011zl6kiD2k4geawe1yaZpco1LU1JBYZHl0dHR1MfIN4dfuFKx+SlY/ qznHX50dHh554ccx+S1/9rP+zv1++67/AO+r/X16+jo8PHN634ecmdv04G/631bM 2yoyRZ4IMwBMVppJBcYQ4IcwkM6cFkULYIaW3n3BEYXnGFNZWhSFK6xrgBzFfZyQ nSFiw1hS0ZW9M1JjKVN9vPGUv2FtePHyxnPdOMdlYzjvjOM5ma9NTYmvahxh1hH2 2VdayNebDIyI6HlsNNgm2Ml1SnFjGiEOZbG/by2taEY798KzjHbMaOzuWXO03ZWw 8VO1bGTWH71amq6HW6KOTBYhUzxqIceHczVHHDAUgpFSGQ8t4otrDZJLrxLrjq6u DZtsv5vM42hGtUq2MsNBVnLpyIzZWNhiViEpugJMEAg2FAiM94kQGOIm3m6jp2N1 /A5bITtd61l6qWOq4Z2LOK7DrJcwih9EjWojbK1gRMLkZiWFP38Yvs/V+ytJWtyj bMgS6jamY6MlnYYg+MOfaj5gVJsaQt6IOkBUfKFWh5LOSMPtpUn3mm1ZxjpWaNxE 5UbIg27JTtUWqThnXctNFklQ8ItxXghxKkBz8rFnKZdaWh1h/A2WH2lodYccbVhW Vr43hXTmFy5gZbf9qfmz6rGMylqkZ4GOjzX4yiYGAioAoISMDYW60SsSPcQ+M2Wh htzDjuVsJxiUnn5yrmOLNC1xWNPPxI182MLYS1yr0DEFhVKnxSXYVlUaMxIuCt2F cs8MRFfUI+RjGBgD2zAVrWw3hRltq2GnkMHrtGli7+fv1xbkLI/UrxSD9bGFKFk8 bPp6Ja2SY8zBfSIFpnA+JsNp2s3sZn9oyV/L47XMfZNONrcVGZiwMNSoYsMFBVfd 7LCk9VoADZ3IjSseZhJtfDrlNUYYieseobW1GC5aw8sJ6JnC8YdUtKVIi4KTkpR9 tGG3XH3WQ3GhmGnSSFtDtOOJa8lOVKSnHburOE475xjHfOe2O+c5xjGO/wCuc4xj 885xjqcj08+X+2NnW+x6o2PMlWtsyElbOPYTG2VnM5HIAHfjn2x2WW/gvpK75Q0h DOMI/aZTlRDhLUPUn0xXNWbnrc9VxW40LaNZzajYpkVI7I80NKkxcqalTZpLa1yh LWSXUNsj5y5hRZCyzjS3ul2L2fJRsbdYztWou6aJsUrWOC19I4BVLiA4fLJGZWLS g5aPBLlZLgjCZQ5fUMUerK27W7d1lBdgauQp5U6f1iDNwVxYuawqgxhrEgQQo/xa LRbIgYiiTHCTlU62y+LqKbdZfYZJZeHmqq604yQ0l5lzDjU+pHZxtaVYxlWFY79s 4wrGcY8iOGnLENl99/UtmbZGadeecxI19aENMNqcdXn25lXklDaFK/ZwrvjHZPfO cYzYf21e7dSuOVyM1tEZMtgWpxlQRIIwJJYs87HRQYpocGtEj9ZkBMvOkCBYHJad JZH94YhCsN5YJwbvHL61bNly9wN3QyqswDoKWLdEN1J1qUfeGeEIBEzFxbzylj++ 3ghwNxp7CsssltZZJwmMVt82KxjcnlJDXEIxrPXNd0X4uWikQKIrJC0ffn2CPMzH 5QUcfiXEwt/G+rVcth8OLNqsWMur2xZQWNmjTHsYz9U86YeuYlRzxMf7ZCZ47RzC PKBWKHkn4SbDlYiXGdbYKi5cYmNPFddQ2422UIchh8ZS23W3E4fQ33bWhz+QrCsr XKcV9+RNSmr7J0b2KpX4huel5jNqpjyRIp1xppsrArNjdPJytx5pCRxBXycqWnGG fz7PU9WOWp5+7NfRMI/BPXCEouB9gYiUiunhychOGHwwc6WKjCMnJiH2jWgX3flD jnIOdYbRKtEFyZcmI6tt8MtxOCRIiDGtM17GXWooJvI7mC6qjD3yWey/ccWlfuOY zhWFKzheF91J6ebm7X10tSuKooTOwvlVhNgXNJIRbq14aggbW/By3G5RsA4kSTPB Rz3YaHx/i3X92ovyNl/+mK0OqvqnXSLzmlbtEqyBpt/mhqAQ4FsXMGD4mQnjpWep VMtWw7JG1Cmxjs1Y5dbjcbGNlhiOFLZZW+4hD8gUIIlWGm1qxhx9GVePijyXnCcq TtHjlvDS0HC2TZ1KLqsNYZImIhjCZquyGTZAMRo0kdAsRMyJjXsivNOLdfHaY7rS 3h3Lv7HXa8J2RX+T2qWTk+Yi5aSw+j3FteSMQMorGMLb/bxnC0pVjx++c4xjvj88 SPeqlXQ4jTWkDBCCFfM2Jd2XRXX8PIayxX4JbbzefPur3UvKbyv2sfdjKcqz2xjp 3yexXKW14bBLCrNXIqhjjYpxWIni7PCmBYBYf+2H/fXOPuUc8zHVjxGrUL+l57Y2 suxcxTpUhampGqUdsePLlnVNpzxcPn12VfwE9eBnvGpX+HvJu1wMNZ6/qqdlIGxA DykNIsSdfQyeAUnzHJabemWnkJcx/wA11ptxCsZStCVYzjCRbH1jf9SWPFQ2NXi6 xZFRwEtiJLJBKI+nyjanACFKjizWE4JbTlaGlO4ewntlbacKT3st8YRH0ccdLFtl WYZjOvq4p0mLKHc9jKhU5ey0y75JT45w4jCFeWe/dKsIXnthiPPzU59x2dx1sgR5 gyLZZEa/OPmRRm7AwW1JiGCSS0R+MOPRsZCIUvKHi2VDPtufAYUt41bcexW+3LOe djb6qCqYMyChYldkHwVMHtCWGdh6/wAgQQkMKiZIxIZGIgClOZ+NcdV1lGXxr8m6 +xWLcaHtqMrkN5lZLYWAVa7Y6MtCQFLSiACYKDme4R1w3DnkvYQIyThtUTRwEyEJ IRhDclXG0FBHNodFISl6ZaW2hxtxCs4eS2trCse6lvPfHSLWqoW+hW2XodmjCoq2 wUlmHlYRD4xxIspjKMZBw5GkGDPkYU4hvKBn3uzuctf4TCk4tbQvyaOIMtvaFZQx FiCDN/IaZZU2yw2wyw20ylxCm84aTnCW1eOUpUpKfNSu3UG9zsFYb9SS02a5nQcp Cp20TLPnJaQmFPNUGy+A4odWVseDx6mPkCvYUhb2XR8MqeU2znfrm65TMWckD6dM kU8ZauoCoFpdhzUMQIJKbDDGIMG8doXEyXBRxESM6Nq+PMTgqeHOvevBZyGYp42w d5tM6yE2EuJj4GulZxIGqJjs0hgORmZmYKG0i8ZuSxsYLMDal2CuNMQlY5Koghny SvOcJw4y9lt9hfljxy2+004lX7Kk4znGOuPummdv0OL+tXejWavxXyEiqOkhMoYb eXlKEJeyhbmWUqcW2zh13CGvfdYY8/eeZQuwZyosO5NtavrtI0bcIeuSBtnElbRN ok3gBTIMJnDkZECSAkWe+kciT+GUayKO00aIK8BIEvAlFAmtD3jyZ3JQdfIou3NF ZsYJ0CuImbY3sMSdg5QVhKIBmXko+OphKIB6WJd8hw52SXk/33RPYe/5bvqxm557 ITW6UsKx7rbFMxsXZq3grrkYFglceC2NbHs6AoGFHQTMBg5gduX0DXMVFyG39gUi vRS5WWmgN3HMtNiZNRhQrscpSZlfdjmJGZMgBhEEScLHXkla0Z7oUpOf8nOcf7Ov YQphT76hW3mRVPOKGZIfQS+0xlasstvktjiNkPNt+KXH2xRkOrwpxI7KVYbT6erR j+P44/4njmP+J4mY/wDEzH/PlOT9pmOYnif5jnif+Y5iJ4n/AJiJ/wAxHlrr0l+H ugqxx5G5T38COvlwfK+oys7Mmnita+YahxZaMpdJTHyYLYOJGvTSZbbNtm2nTZMI 2J19WGomvD32Ruq2lZsdE1NA8mIHhHUhpfZMvfH4ne2tavosGv2Cfdr2wrzf7fWc RNtTuiM0+JS6LsC5jyxtPE93V8DkzHzsHhOSTLvRFiOKdi1Dv0rlrzRpWnIJmVqt eidCye2Y3T1n2VG1zBVth5o6xuSUDdpmIgrDJmDVGH1lYI+YQYRbYe0ZOr9kjoU6 VbUtc3s5pmzyVE2dpG5cQZbecFv0aIkF7DY3JM6go+xYH8f1KsX+BtlR1zpewbB1 dQLLD2WkhUWOxBW2+X+l7FRrmyyVyzXE1pWUmJXTrCYWaN2K9tDSsWqmTCVRSF+L GqXsoOg2k26Nr/tGKXFirNdpvU1p2HG1MxUC2tZ1cZmsLObRlgt4/F38PZf/AN9X q5mvYW5NwQhcdFoI3IY2abvqVCPjWvTk3nq+C5gh7A2/s21RGxVyNYjNYlAKMRA3 aYtRF0rclRboAFByNXia4AXP0gbW7pf4flk2w5yPFthM3cLAFd59+b2xo7cFU180 9VIi6XGsbWpto1kmzS8/F12s3iOZlgM36XFgzo/Nob1/TJK4W8CmSRA4NqmIiOhx 5OuTRURaYSLXlhsz02uQO1OF8zwYrOsEU12q76qW2ztRa0I1fCzNdN1zWEUuAuGM VymyRU1CEuSBcGlQ5EtTZBk5stUHMEiJd68jYmzZJ+txtqn6fLQFSlpWXZsQsVIh 3K1JfhDoKvhzcewSxWYY+IGlpMmxTcOgkG3H5Bfiarr8Rh8Am+P07/pr3j5A1zR8 8pVjZNeZvljX9zstsDj8jVoIt47LZLJsi1ZFsqs0crZrJCnLXIsVQFSRW+uAVx+v f9Yvx5qXyl8w4jW8XjfjvYH/ABHiNh+JsRhay9i1ZWcXrt/T8DrlZ2Kxw02NxmS1 vFZO47LJrjfr5KzN+w+3UvW7TptV6StLfB/l9yJvscNITZmgeQmuNfQ1dhJBAYVI r8HaXLn+FjZiDY2BLvWu8xzdRImSo8CE2JFajoWx6ZUIuKtQ/wBQhHrepNTX6wDU y9Vqjz93ho16RTUbrBQh1tiIl4kcUmSxXLEGubj4skv4jajfgshlLWHlDzmHB1Kk c5Rc59r3Dh/QOH+sKJc4N+Khxaps6fh5Sis17alIhWVjwdYr96K2ZV7vWpW2qjAh brr6V1Q5TLMxY8VKW3MLRgbazdmFSlz3dxyoUm1uVzZ2rNYT87Wa+5I73pEfY9Oy dibjpCxV2vVdnklSrvqNiddBiZabIjKaCPMlPxEnIyaHTIsp0biD9b+k7lQ+QxT8 i4/5O0HMZB2Z/wBIX6eIDLRYwuNZRwNQaFO7msXlsli8fjaWNoIylXInXtqEFJO0 Y2WJp/cH6Lu3w98Sa/8AFuc2GzidD1D35jb/AI6weKzONRu+/NHZNrbn8ZjLmCLE 53KZtmQyWTxrHYx6TtShFCK4wwdDyiqUJEa/ttVcPjB7Rb6Zc4ioQDpTKJmyS+a+ W0mPgIpKlSU0Zh0oVKhIsUsnGX2cezlTzeFPO5IcgOLGiztU8NeGZr1b0xoanFHM TFaiKmWBatoW+sjAfjlFnlYuXkrLs/X8HJWeOvQNgjxGGLncrEBf6pMydchWa2yy m682PyabOP0ZQrTdqlsc4ICbuVcgM0jjfOnVwdNcOOWVUoSrccwSoUBwlq0iUaDT OyS25QbMDP2otccekknrRHHLVtk2ZskmhXvVevxGx5KsGRuR4sI5uSMErEJr2efj yXrA2kd6EqkCzOVeLk5Un37SVM1wNxyuA8l69jAo6DtXx9im5/P3c6+mq6nMUsbr OUupsy2qNKngZymcUP7gMFU6ZXKrXdQVtIeprZSrpT9DeMufGdDPuyi9rXi8szH2 Ebbs+sBryXljfc1tapUq5jLZCvVIX07brNV+QXJ1EFZivyNYlkpfK3aXH6sX4fVN js+r4+Gu42ybRsyoTMVYG5zStU1JpSkKqERrjbknsmmkbJDhdaXZ4y0WahT1nmpN upPB3+qwhktX5bF2j6dVo2F6zFEG9TfZewb9xYVUKTsCy7Is9uiQ83ChwVMkrJea PFydMEo8ZqfVNV2JDbQsGx3oWL1zmgadi7JZYMoG2WWmS1hSWZao100hZeQOvdP7 l1DT1VcjY59ithVR2VWSox2NenlFia8sNx25ER9Rwxh7KKsXTqrWJGNeHhnofIhU cDieTYW26L6x2nOMFu4gXCJ2HcqPT58bmBoWtVx+u3yhUfkZqKSqG6KrXNw3CTqV doW05ijV/dPH3UlaukjZdQbPtuzovYFhcg4rV1b3vrC8vh/M7MjAbE2xjslVsa7j Mdr1LG5OgmGUmY7FelJmVTKW6tu062uXZFdLLQxoSpS61NxVqw9hb1Ov5DBNxys/ FjtbrZnG1qmWgqRri3ZVdQNKyuoYrirZSamWaH1cvVLIsXxlszYeFrvpqWXXesNT WTV+gagITqAK00Li69DVqGsb2jp6ymTMKTM8a657B1jpT869JTMlCT9HnYKAsMnd RZNto8u3LL+O9vPVZOmdsbF1w7MxFiFpl6tFVjbBDnsEi2KLhjk4irKKIpAcqHGW GHLjZWPzLREQVnBL4BAIcpGSscB9WuOoOm+L/p92zdW6tOD3iZ1jxHnNv7e1TNAw Kakubo+vbdtm91Gr6jFGC0hTZUyelLDAnS0BSo6TtCY6rLv85bC6tDSYfyxuWu7g ORXIG/bah2dgDQM9+GIiuD7T2LYNrX1quUqn1+jwP4iu9nMkJY8p2Lrgr7MXk4yO qwbo9VhCX4WFj3V9MYi8q9BsQLpXILImNXCT7SIyIsSUy0WQE8TB/kPSQOBKIjzn S2toqCHWAmUF6U1vY1kitkuaw0T0lApBsTLYgwIm2BNYNiWmtuXR0dHT143eHR0d HR4eHR0dHR4eWDeBldkpTjzrhxtlpwYmasKVM48FkEYHnjEpYS2oEjOMP9k4TnDn dffxRlOe/jFvsLl5yCY2Hb8A3RqGEjrjYkRkMHVabiPhxx5opA0eOO9XXMOMiNMt D4yV77z6GsqKceccdWvW6v5m7d1DW4GrU8aptRtdceeAWcBNkFLfIJcLeeIWzYRW VLW66vv7TDKUp7YQlOcYz016alSZ2YlpsxLSTJmSPlSks4cwykmQKdLfS1h5x53D WHXl4bw6865hGMebjiu6swbE6y1WZzd3KVaNmrdabKQsWqwS+9h5n2BgFAkSzXEk M8zwUT5ZOc3FTte1zHYW7kqdzHIBWQJLG1QbK6lZQdGJYJGIOB0wJcRHYTj7zPDs OGt+Hgt+DFz2WXV3UeVii5B4zMU0OXIvJklk5UGz4N+8SPhHg2z7DSXFY9lDWPdY db6gerrbZRqFaoOCsUsqAYPgDQxHJazO5bkCfqCSm1vd3xkMv5SwgIURxRGHSi14 GYj3FOxKMvPDvNEDuuMPsOIeYfZWpp5l5pWFtutOIylbbja0pWhaFYUhWMKTnGcY z0+TXfPzcFPYjo+zDxV9ioxh1pluS8o6Sd8lo+M08eyyWIgIEfChxxAooNXbDLq3 1LQ98jfmMLkBy9LOYcK7X1VSptRzJSLQhbFRCyn+kPZTDX9+nSYA47ffhPgNixRY DIaznzsprXHQ9OQQqHmlktS4vaMR7igXJF3I95OPYsuImIlT+BetbzVLpYL5Mxlu rAeK8XBhfHgMrkXyiihHVZIDkkjqHFbQPlzzwlTysJwr20NOjuva/wBRW3x83tXW NTRZZewytHqTQ1hzKRkSJmGJsM49NCRiW40tzL5X0x4WQJaKS1nDBwK0PufIdQNj Wr1L9vHqITR6hRaM2ZBuRhJSwXrJLtSTqSG0zceUVmPjBXQ0LGdjwn4U0Vswdx4z B7D+BGY95Cdl5mYdn52SPn5gopsw6RmzjJI6Qfb8MYWccSQs0lSkNobU4sj3fbTh KXE+Kc4T4zDZa1nS2DMoqVGLQSq1ZDBewSNJV+GMgZGABZt5gWn7DZE/gIdZUZfY cHT1oNXwD7l5TbQOuXbSjrKkQeuzMqTJwRGxykx+SVwpapiJYTOw2SL1twig6at9 ubt4MnO1vXDknAwMzTyhGTJhsAQWMbefFkRU5EGfdbIcTjukxpr2cONqewtv0cb+ Tmd1a0RaCLzWqxdwAy4uWHNrvymYaUcYIYCkPeaKayppSEILXhtgd3xQpTAq2lDo chrtvNvbNzo09r6Vg9eswNhg/wAPmLAgpdiQYBS6M60oMlyxvoafZWK17anGHmc4 8sOMr8vsj2nt33HSUpKStSGgjnJcFIJYdjCLkY7wQ82+l5sQeQAT8nCm0pw64p3G EfbCcKwlWI9Hx852Mug9ddeSm0ttNgElgyjoIuSckmBETmSL8hMuwjMmQzI+So/l CsnNY9tV1o8RFI031GtwMGz3klWFxFgjYYCABEwYD0M46QUQfmPuKkWHXu2LTWrP P4tcszPvmvXFwkohq1/USlFuWByRkHHXCyDCXCMS5SjTm25dqSYVJGqHWU5Ym2lE yGyuJmxIOizEXZpSx6sj46PCjXgxUSRceTFlPCpfNOShl5CY19tWSXGcIyxhJGW0 t57V7Nxb4tG7nIgm2wNNAPhUvtiyFZiDYgl0cjx94c1CpYsMtKlNj5S88LktlIzL TBLbGXmne40vy52fpKEVWoAatzEI7IsmLTPxizpMQZPtoIBhz1kZYjUvspcQl5ce atpTie6XWGGB23vPa/mcxQwb4KqvLYdwMNJdJq2TBiC9kEAh6xKay2SoBXA9zUM8 CBzG9b2fAYHJ7FW4uNwWdQaQeEHF2qpi7A+mVtlntIItNV7mGyS9YOmJkzDxW+EG ktto5F0maJo9grgNcXISR8la4WTggWGHoo4NtWFyIjK3sqdIQnyYaeQ0pbeH8te6 1lTzvVzw5BUPQ1XlpCHdmT5242cYKOUU4RiJRHw8W4WQpSFDtNKLU22zhTyXH1Zc yyhzA5XsIfO+qvdSa+RG1jUdXrczhA6I2YfssxKiA5bfSolx2JHChXC3Xh8voZyi UEQwS42U62WhpQrsdu3dvX3eN5lNg7Gm3ZqfksIHZTjyajYaKHU4oCCggcrcbjYe Pw87lgZCluvEPFSJ75sqcecVoq4bYcts2Pz2aq1MWnGKMF1kPGy55+tor/qAbAFf ey0zIpg+FwsVx39sb7uf1fC6hk9Z1+5dzD8u5bXW7FY6aKw+2ubfwYC2Gz100rWA iQctJpN5X6SnvhLlYaV6cM5M1QtuIkWOOwIDEsK+axLhOSpEdHPmRpjS2XATWmDC cBksLSsZ7PvjrS8hpxCl8Vbtja+hdSWKRiQ5ySCima8o6RYHdkESMA8iKJNT8hKv EkpwP5HuDONeTmUZwvGEJzmD8znDuI3TJ+h1x1EaoR9PjqSttiCk0SzERFrGdEdH kFTy0pPw6K266+6O808vK8rHz3xhOFo/mpuDQFcEq9IEphccFNPTrDlkhD5UxBb+ GErZw8zNApQHhLCcJYaabynycV5+SsKwyWtDyb6GTGFU4v2M8zIVTl8/lTaiVktr YGCEoZMF0jsMcT/PaeJFT+SsNWyeIMmXixtbWlYu4uK8cxfVaBsNUqWdTCVRI95k S/zxxHM9tN3wFsTeG8NRqqIOA9Ry8RFiSUj7SFSzxzGEluPsfBVkbDJ7DzIo+UkL UIOkzJGVP5FGg45H6+m9r86du0KuYh4mbsmzZsQBuVKICiRyUsYfww6SiPU+1h1T WWWMfATlZDjTOEJyvGeuA1Vy42pp+03651ZirF2HZM05PWQ6fjZKTUs52RkJVz4m EzI2W21nSRLy1PqJIcz7fm+rKO+UovW1rbftnz+3ZJ8SKuNinl2Qt+AaeBDGlHPD zWCO+SY6yyrKP2mHSH0KStbavJpWW+nvXtRu4LK3LFaUJrswaqVd0sNxTkYXSl1h lcpmIWdlLmyIn/EwIwIzERHtn3jHbHhcfVtDZdZTsTshaRCwSP7XLchCKyrIxEy1 dSwhEFIRMSMmUkUTMvy2XRuTvDSs1mzvXyLuMHJzrJE7HkMkTToMkyAhmMCnD/lk SjVfHyrxGSLMREcTKFssqakcveDD++OtRJ3Bq+pWK46mFzPWUaSVLEB3UqtPYZbd LYekGo6QBKTDe2ClamvfIIy0lavcU53VnMdFP9S3bsSrLdyrlcuQLAAAccExhmGw w8E2tn6gaRIRtnfkDXWVeGXcKFzhThLjvvqeT7Wk2t6kG+r+DLV+qfRNW1iUATEZ FrAjZNhah3oh6Mk4zFkLZb+KzIOEulYKhIqEkgfaCYDOb9kl01stYHa8ktdSxjcX XtQ6WPzyrS0C9M/YUFUpgDiNUGX5GEiYrWPYZGCJ7obPpeHad+rl8zapygU19ZbT baOs6OsssjeyJsriD5Xx61n2WTWFAkJyIMXs7MaPZbCPDJaTEMTkszFJZMxIspjW jyEApakEqWk5rAqWsNmYUrBSMYfwrOF986Po6OrYAZAACSk5ERGTKeSKRiIkimZm ZkuOZmZn7z/PlIMKDYZwIhBmRQAxECEEUz1GIiIgR54iIiIiIiIjz9xnOM4zjOcZ xnGcZxntnGcffGcZx98Zxn74zj8urMnBm7X7hn6elz3NveTbxqDkmq0g1mKkpCwn 7CyyfEDa1rNkp8dMbF/CJESyW1ISEzX4mhQ1zmqmMiwk22di6zT6vms11mvyUiUK ECUeaSFGodbjg3yn3hQG333SXmwh3HFMioeJeeIdQwhtLj7rrq8ZccUrKhD21mi5 JdTHmImYiYmJjghmJ/sUcxPHE8TPEx435DH1cpVZTuLlqGSJSMEQSJrKDWwSGY/J ZwJjzyPYY7CUfbyWT0qNs2AG4XLTJMuQ5UzAl7XgIcyTzkCMvcK0NTJGQgox5OcM SthqVmeYsLsc8PmXj6rBLmRZL8NQREJNPL7UrkVLAVyau1ZiJ6VwT9Lg5KwRYMxJ YBGQYbmPjCzGjTMCBuNllfHYd9gZxD7vg0rC807GX3xnMOjvOsOpxnCXWXFtOYwr HZWMLRlKsYzjOcZxjP3xntn7dfjzzxDiniHXX3V9vN15xTrivFOEp8lrypSvFKUp x3znsnGMY+2MY67b+Cf1mn8H/G9fRavxtS2O4nYLuXPM2thLHLbVvsrE6qVFWEts +qBSJQi2V41riVGdVoo9LeRvmb9I1D5i+QH7td3I8MpuGqY0carXl5Bq7NJbgTYi 63LVw+nNjYc6rFMTOYYI2AJ3tXcKhkwu0r/UKDGe1fznJYOXstSrc6AqZjagUxKw yL1JKYlAyoKEp86+DYw7Bh8YpuwwMcHV3nbm7AjON69b+y7PE41anodwuWx71Uo/ a0emts2afSZXqmbH06xMskyOWDYybuN2Pi0kR0HaL6NfpQGE/HWcz8PK2Yt+woR6 SXqC8LOFel79D7Qjr0Jt68WxySsM9H1JE+FKVyNBbFqcJDGgSCHRwohS5c0hiTEE eVLzpzmCjAcBoAjz9QnnrZeceyo+WbgfwVq+lZlBdf1B1wYqV7SRCMn2azSDDfZ2 fmRRI1l2MEfehoMYFkOPWWSuTmZf5XfqI+XPm39XP68qXyZe+Mbnxh8WfF2q4rTa t21lMjYp7ZWxL9iy6r+PJpU037V3N7HaqweLpVao4Wkk8x7GtGg/sH4N+L9Q/T78 CXNEpbX/AKtzmzZ27sVg/oKlNlCzdr4mgVc66pslXRXpYlLRi1ZsP+sc2KpiAixU z3o5chN9lcS3tQ0q822n1OibQs40egGG1nKRMiRYR46zyTYRdhp85YgixCJlK5Jh TrY6UlxpMZIurfOBio//AFNhNwap15U9OW0yQiazYdy7T2BisHyMeUgqHDsc+Hqm ZhCmyn5KYALqUxJF2v5ZMieBbnmjLUiMlZeIcl2ccJ+cuwuFlzPmK9BxN2pdjWIu 20aYeXHfPeAw5gGThZ8YcoqDmBkOujZdcDlIswIh5o6JfKajTo18fql+o3x15zad 0jE6/wBc3GvbSpdkKmZWVs4UYMxWYGRgzI2yVME+MmjW51FhmxqvMMH/AARsIBrg q3m4040yMapqNU+VtS/VAjLJ05GxfFe7X7Nm1sNE6zbGsXBxdu0p+RQ6yq0j1Zci j3vXYQSHqjFOU8Zxc3JGdwGQ+OmUDv8A0+fxtMayqlmDgXhN2r2KiQgSu7KqRUUL 6MkZcNgZgotwtPAJOzdzcQ5DTUTLRDNKk4y61d2jlmCxwlnZWoh+RjLDb2GrBYq7 V7HIm+6WLGRAdpijH5uTjZIytyFdr0Y+7+D9c1+E3p3aW5KU3lRu+P1BvWyciDIe Wq03WLsf7tK15Tq6BXJUdcDRTyWFP2uwbDDdHlZHD2GwBXWYeMy6QRKVKddbX2Rq SZzYNa3Ww0yVU06O+RCSDozRjDzeW1sSAWcrBkWcd8ONtHDENskNsFMpQSOw63o7 hcLLfrJKW+4S5M9ZZp1l+VlzEspJNdYGYDacdwO0yz5IGGYa7oaT3S3jKu6sqVnp irpzEXthgrCF4zPW1ZEvo1/T3V3VuM5h0GtyHwwDj22jL6hhqX2HrxARHI7BjLeJ wSq2PdXy2KW6tZayVNqXUNUofdDBldhTAYr+lVgJrKBzZA+5FLPpUQfrCcVtqE7W jWfUj4JF0J6Dn1RVR2Lx/wBrUA4StyMojGI2fntj8iIWF3KexSkzENI1mm0usH2y dKBPFjoOOWqvG/Oh5H0vUGvN1XqnaG26je2qoQ4Fir7UZpc7r4a0e9Dx5UzkGqWY 2RnAI6In35SDjipA0h2XBjR5lK/aPQnCIdHUjxeGDFMcSrdhwOABlTQrCMSH8HJJ QsiOPyiPvA8GXYTLqQxmzbmzAQSwCQkpghJkz+XHMRBmURE8RM/zPMRxIxzEnR0d HT14k8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Oj o6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8Oj o6Ojw8Ojo6Ojw8Ojo6Ojw8Ojo6Ojw8//2Q== ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=yarns.gif Content-Type: image/gif; name=yarns.gif Content-Location: http://zippy-egoboo.sourceforge.net/images/yarns.gif Content-Transfer-Encoding: Base64 R0lGODlhfQAoAPcAACTU/wBJdgAitgA5YgIRRRyK/wBShVRwkXvk/7jx/wCCowBk xIPm/0PZ/wBYe63v/3qux2vh/4nC3wB6rQBEWQAAIyMwWABqlwDK/AAZh0JshgAm xAC14gAzQQB0owAKSJzQ5AEclozo/6Hs/wDG+bXw/wBn4Urb/7Pw/xrR/wB/ngAm jgC/74ixxACKrgAw8gAnVbTw/zFAVAAcLXPj/wBjjIO+1gChyQAgpkZtfwCTugAq 1V3f/wBScwAkOgBpilXd/xBjfgCx3Znr/wDC8pHp/wCNsBcgTGXg/6nu/wA1SzFA ZQA7TAAAMKTt/wBcggBKbYSwwpfc8QAMUwCq1AB6mQAALQBG6AAz2gA4XDJwkg0N OgAYQx4eSwB0kgAVfABZdQBKYjPW/wASa4WwyQBGq1VwfwAt4wAyUjzY/6ng8QgI IwCfxwAAKABG0LDv/wCRtpHO4gAoQgAAHQC76QBifwBUagA0WIexv5bq/0RfhAAh Mz5QaACawG2svjlPdQA5UQDF9hXQ/wAJOwAvSpHA1G2RrQAAGAClzgApYAAAFQwN NABxnQAAEWCAoACGqAAVIWOOqQrO/22euwA05hEsXACm0AoKKwBohCVBbwBAZQA5 +khgbm6syXuhspzr/wANYwCt2ABAaQC45gQEEIzN5AAVLQAgPnyvwAArPQAEPgB2 qGDf/4m+0QYGGQAeTAAPWgAADiQwPQAdpQAJJABrrQsQJAAINAsRLAAfKwUFFQcH HQALGgAJF7rx/znX/wB5l4ixyQAFKwB8mwBwkAAynwC864nn/wB6nABa+azh8ACc wwAQH57s/xDP/wBdkBpyn6fg8QA4wQAuuT7A76Hf8X7H/1p/lHaguwCiy4fZ8QAI Li15/wCXvV2Nni7L/4W+zy2eyRyNtQBPiE1vjwAYKXe70nuhrgAzcDWF/xguPwo/ /xIfNQBmsi9beQs99AAGLQpUhWvN/0akyQBXe1Kz/13D3xg7UA45U2mPqw8PPwB4 lgAADQDM/wAz/wAAMyH5BAAAAAAALAAAAAB9ACgAAAj/ALvoG0iwoEGCW7boS7gw 4SKEDxfu0ndJl641A125GrhFl741pD6SGkkK5JY1u9ZcWhRR38hLJ1OydEWS5khX ukKSBEnqUkgCBEIIHQM0pEqKHxWSmuiqy5Z/UKNKnQq1iVQrUNtIrQB1TtU2jWL9 m6OoEb9/Fc7+U/SvEVe0Wq2I/dcG66FD/Ni2idWGX4VDbP/l5ZoWL1S1/6ycnfNF gL/HkCML+CJM0dlDjdpg5hcrJNXPUpuItooVa2KoWOd4Tdwks9q7rdfS3bo68Nm+ gg8rSltBL9p/ePvy43dIseVDWgfhiMy8uT8Bwg6jLX1JH1QYBrJr385dewADAb5n /x9gQNR2H+PBZyfkw8d3SAbQGMgy3wAkH5DyEzIgh7//+/zBB8kAkNwhR36QyEHI gZCUA0kAWWRhygrOPYbFBi8498IKiQyHVwVNDATVM/2UaOKJJWJAQiBEYGCiECxY YiILj3AghIleUMAEE/3Y0Y8X/XTAQR8ohoEJHR0E2Q8THbBAgQv9UNCBJUx2YGWS VtphJQVG9NGBjnS4UIcOHYyDBXNYFIMOCVJ2EMgNExRzZmTTzKHWHI149s8AE/Tp 559+rrKKB316cIGfNUywSp+LegCFEj1MoMQEkTJKwQRQ7DFBLk9MQIEDjEzaZ6cT pJILBTUAkksuF6yaiweAqP+aCxQThJHLphMAEsamuSSSIWRXJFKDq4DUYGouPtxa ixuR7TAHXsSJCNq0/1iFGl1aRdVGBXM00Ru2ia22WFRvocWPV1xp1YQVfWVmZ15k neuXV8OJFpZgcwzyqz9nfDAccMOdK1jA/4JyBmQ7NNFXBQpR+9lo61phmsLlrrZW XX9Z1ohg3irSBGCFjQXcwN1axY9b7J5lRW9+qWXZcN32Bc++G6hSl53vQpWWWf+e JcwOkIWgVRvSOhzaVOxite1vI5dlxW7FHVLBX121ZrHLZxEX1ceWbctPE5xpdq4i dUGrFT9AP4ZDYucqFrBl5iLn4WJp+zMFP1ZUZzS1WCn/rFW5VtwVGFZ8VZu0Wo1Y C9VuBPsVy1kVmOX2u2c1sjHbj6cVAmQbHKbYb2+jtlojUkM1BednFb030lVp25XO Ot81smz8aOUVWdVGpVYFXtN1iO6NzMG7cIeAbQUvSlRSjq+PXYFLyx4q1gYsGYTw hSJjVJ9B9WOYVcHmj4EyR0g/wAEjCywEckIRB/zDBTLLkHACA9iIdto/mjwyCgsk RBBJ62x5Xx/OhwEkdEIJj0AEBsKhBXYIz1zMAAYbhGAM9PUDATJQyw9uwIEU0KAV aOEWFzCBgWNowA5U+EYBkgEAM+CNOI2wTAb25Y8PHCwyGdjZIX6FA36EZABVeAQb /zjgjAgkAQQW+McgoFCFFIygFH+oFmn+4YAq6IADDXBCIbZWrV6EoQoKuEEgkJCE KFSCGCqAQwqQIAI96GwOtwjDMFzQDSqwoAGf2OJwAOGFZTDACWZgSyM6MAxBDAEc 6jjFAthgDCHkwYXECc5yIvOCDzQHFh8rjmP88YJDiAgK+xiGEU6QhAQ4QiqiEEQr rIMa02hiH1W4gQhikAB9WGUOmtGKA0KZglK2QDC71EEERvCGJVilDXbKAiwVQAUE PAAFnIjZK1RQhCXUjh/l2AccmgECXPxjDP64ggdukIRAZq0Cm4TMC0ABTubYyTKx aKc/BiGiV+xjH8A4AS1BIP+VAUTAmFaJGFZgcE8VjCABCeADcAJTl13u4xcJ8EUL uDKAe57gASXwxO8E04Y2OFQFCEABCtRgHbHUIQ57sZwd9kEHFOBhNxt4jBuq0Awz sIwfX2BOJf8xC+acYTiB+4cwIDMGadXhnoh4QwlKEEWoECMOUlScFQYwiHvuowgI PcBqLAaGe/7CF74IhmAAcU860NIXcxmYPe9JhGeiwAx0UQQYUEGXs9xTEktlRwUg gwMw0ACSjRAGDf0RAsvUTW0E80rQ9HSHe1ahCEsV6z9gAAA3BvRaLPjHD+4JBIS2 wCuKwErkHPpVX+ABKhXdBwdKENGb8oMZtAAlLBkgUhT/HAFsT0CFwvixh7K+4Q2l yARkYIGGXxygCY+bZGTuxo/mfIFgwIFMBjYSFWLcsx8oYO0RqCiF1hnOClw4QSZk SwfWJmA2mIFKVx8KVrHOIbUpUGohYoPMPQSBC9bdBxuSIFJsDGeuX7NCb/fxiCGM oAgMqAc3atgLccgiLaoY7BksY0nmDOJjdRFM0IqWWhU4gbX5eAUi2te6df0jCwg4 gjIJ/ACEykA2XVlvaYNxlopWAQlOeAMnwpWXU5yAHWTFJw/eIFJr5vZ3TWDGPYGR gmMcAwE0oIE83EGchckTMgI4F/giYwU7pYUfqiCqnv5BAKsCYakknQcrAxqxJ9ig /w1cWPIQshqVy8m4vWnRBDAEIYI8RAKZcGnDHhogAytslsAjECkI2lAHCOANL5i4 pwJ+EQEk0AABDCiCH2zxtX+kU7rE+bQ/NjCcjppFnoPwiFR6cE8dYLQEethuiVGT jVP+I78RQKhGp0JasOKBHRQABh3yYA499GVyitjDL5ZwiFRYFQBERgE5BtCJs/Gj A451AQYaAAQaHGMITmjFIvwyWLudZbAhCNhmJvmCRqhurcBgAGv5ycXcwaABS9Dl dVmrjJV1NBaN6LVp8QHLBsSBHBYwWQj/cYpfyMBODh1GEUQaDX3kQHp5AWUVhqGA ZbBgfiN4wBsOUIEwN4dsJv+PDCwOEQuF85UfqtPsPVOAUF9MxX740wa72pBaOLwB oUmUisDJQACyUoEVSEDANbhCL4YvWzDZvCcH3HoNfCFTMRSoggpUoAAF6MCQ2VVG BUDRnM4d4sqPsVPgkLnlDzQBI1NJbShKANajReUHkzDNWj2MUDdaTOBibUQY9mEE IAzhAQc4GVkOoewlREUUjg0pCmJwBLz1RQ5nKUcPtq6CYagA2kA/HXMyMJwtP+YM 6+pLG3L6GFIfomH9vGc2YlB3uxOACHqIhwt08IQliyCihkCNVQD/uyCn4ee/hIpY XuFw5dMiv8vAaALO8S9ANMCWxDGFHKuwDxUMAawyqDD/DnsT08icQRWKgceWKzmc MaNW9rS3ud3REIEjMGIUAICDVRuAUBBwBTn/cGdh5RWpRQIRFQyXMxwN53gVYAWN EGTx5lmCcQhZ8AucYDLnMg21cE+sgFCywA83hDDC0FzN8VOm5w+g4IAV4H57An+1 FxpN0AM2oDRt0ASvtA+WcFaylhiAVy0rZoCmBRWH4BXKVmj/8Dj8cGj9QHctkDUD EAogQDYw8wWbwAj7cAIloAyJ0VPNMQWH9RgJY34rtxpwF3v7kA1v8IJScQtw4Aim kRgrZgSllFAiMwekdYBYsWKr5QtRsAVa8GVyIAYK1TX/MGBG8AASdRf8AAgK8Alm /yAuc/AC7QAMCDByMPOF/jAGrCcZ4hcCwvAsoMWCNiYEQ8BaN3diRJAPE9MG9gQM feBMpvQbFbBLw9BLJUAGH0MI97QMToACUmAPTmABZ+EAAEAGHGUn/8BqCoBVCJiH VRABTqAHWfMPK8AIoTAEEsBpePIB5fcYWTYH3fgYX/ABkzGCucE7K8hKShQAXqAC 3SAEaZAHD2ADTeU+T6ACYpAEkWABHbUNdSBKoVBETlAN7bNEYCRGQPAJDzAJlTAI 1mUEPOAETpAHEEBmYDAMv5AEECCMWVNmCkBKpzVWj9AANDAE3sAOtAAIQsQD1vAO 5hgwU/AB4hMwTaAKMvkBU/9gPEDFFi1TAaoGFQQQRohQQSyQAkDAALY2WS5gCRjA CkXgRnCmAtmwPyxABA2AAHGgCFxQBQOEPkXJA0XwBxVwCl5gBMYgBjTgB/qgCHLw CDeAAWDJCVpxHIBgBCSABBDwMgNgCdBADJJgQoTQDSlADemwDv7gLMIhLsSxc13h F2gRWmYBcNDzk6sjRdeiLX8DIlmRGhsVLhZDNoMgCmAQBOpQLf+CjLHwF3yhMItT O8WjFXIgGIMwAPdQDsnDD924A6pwG9DyLmAzHC+TF3kxMNMIc+pYmbmDGh11P9xS G7djFWXRBHOQmrlRLekCHGKhMLFAOG/IGjx5G/NSal//0zKRiDCD4CFl8Th1BTZQ YRaSEzD3gicxZzRsVhpZwTRw8RZswVBtATP9qTPBYyea8S68c4RckRqhhTfpcjKN kBp+wTP6EhkhsJtANYHnEkMvFDh4sxaKEAuWYQUPERXY0R0kOg7ioR4nGgB3IB/Z cQcGcAc+sAf94R0G4AMHUqPwwaIKUg7kYQAzwKLzIQcDgAYzAB8zkAWQQAj3IQea cAd7YB/wgaSvQAmUJA1lYB8EMh/w4aMBwAUrIA1nUAyQwAuPU4M+pI4kgiIn4iIl QgQsUCI2QgIyAqd0YCJQ4gKY0A8KoCRVWSId8Aj9AAcmkiRBQqg34KdBIgRh0AFC /6AlHRAG/QAG/YABWmclxsAjmOAFHTAKVqIEyeAcyXAFxTCqZWACococm9ABM+AX HXUIIYpagBKrgjIoHsAIE2AofZIoE3ABvMoIq5Aok/IEubAKtLIqE6CrlIIrfUIB tyKsw3IrfeIAfXIrt3IBk0IITyCsT5AoruIDpuIBPeABDrAAVFoh5voYC3AHLWMW eoOc1hJQSjMbU0E1xQE2hKEz6lIxgrEbaaEapxGcDfg4XiFVGVYvUoEzgQMKOFBu FfICAjAGTRBaHmoWpPAU7goacQE7Y3FM91KdadEWe7E4ACMb0ymddMGaA8MzabEy jokzHGWaAYMWwfEBXxACG3BwszgrACGQAaDwAZaBXE9TOI2wCwJxEEZrEAzBEAOx CNVxCdWxBlC7EB+xCyGBFCGxES6hD4sQEifBE64wESOhD66wBrqgFBXrEjZBEiJB ESDhEWuwBaRQtjwREinxER+BERqBEXRLCq7wEHHbBQEBADs= ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=egoboopolskabutton.jpg Content-Type: image/jpeg; name=egoboopolskabutton.jpg Content-Location: http://zippy-egoboo.sourceforge.net/images/egoboopolskabutton.jpg Content-Transfer-Encoding: Base64 /9j/4AAQSkZJRgABAQAAAQABAAD/2wBDAAEBAQEBAQEBAQEBAQEBAQEBAQEBAQEB AQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQH/2wBDAQEB AQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEB AQEBAQEBAQEBAQEBAQH/wAARCAAoAGQDASIAAhEBAxEB/8QAHwAAAQUBAQEBAQEA AAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQAAAF9AQIDAAQRBRIh MUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3ODk6 Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZ mqKjpKWmp6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx 8vP09fb3+Pn6/8QAHwEAAwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREA AgECBAQDBAcFBAQAAQJ3AAECAxEEBSExBhJBUQdhcRMiMoEIFEKRobHBCSMzUvAV YnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElKU1RVVldYWVpjZGVmZ2hp anN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPE xcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwD5 x/Yz/aS+Efh34Z6X4cvykc1tZzXuo3khh8nzrkKgIibDW6yKdg2hdkaqQuSRX54f tu6Q/wC0F8R7rxb4G+HXinxJ4W8Mm/lubvwv4O8Ra7pWlSxQW0sl3dvoml3lvYCO yiW9a6unh8u3uRPuWKdZJPMf2XvBOjeKPFPiW41We9XwtYpbtJo0GoX1j5OpXE0s sdvHNYS2rCBIfMZIX+a3BTaC0aSD9utN+IX7MHwx8B6ba2L/ABO8FeKL280u7urP 4KTzL/b0ljdQ3GoReItG1aHVdAvbbVkhFtrmp6hFb6tfwO0dtqFvO6Tp/G7nh6tf BQ9pSyfK8lv9UxTi6MnVlh62F9nSrSm3TpU8PiFSnOpS5q9eVTltyQcv9n8dhK+Y 8IYjGZnh62YU88q1MJjcHgsUsV7SWEzKhXo4qdGdFUo06mKwcJUISrKp7NKn7OFW bhH+XHU7S30OO5F9o76W1sFLwXulz2moRBmURBra+iiuEeXcgjeWKMMrrMGVCJK5 j49WPwa8WfBL4T+M/BsOl+FPiv4Ks5Ph/wDFPw7ZWen6bbeONL0/VJ/+EN+I1nba fHbxL4kOl3NtofjLz4ri91q5isfEF1qFzff2nPffp3/wUN8T6P8AtPeJLNfhB8F9 dHxUsNMtdM8LXvh65B1/4p6DolhdalrNp4y8FQ2Mv2i98N2NjqEnh7WtO1gzmeCb S7q3vhcpcWX4UaHDbeMNRmaQxfaobYNbu6rNiKZvKuo44vOUyrNug/eLE6qm6NpU E4SX934ByTE4eNHE4mvGWCz/AC6njMHVlXhXjGFZKphcVH2VSbXtJ0alOM+aKr0r rkckor+EfF3iThqllWZYLIadSrnHC/EU8PicPDC1sBRrxw3Ng8dlznjKOHjOpSp4 1Vasowm6NaOHqwTpyhUn+kP7OWm6SfCVpcy20csq6VA5LEn5lUELtXGcgBiOvPJx ivvD9m74J6n+0tqHx80Dwbr0Hh7xP8CP2c/iJ+03L4S0z4da/wDEHxb8R/A/wqfT YfGOgeAtL0bUdMs5vHK3PiLwvZ+GtH1vU9KtPEd9rYtl1PTxZTyP8Hfs63enW+nf 2RNdxwyR2kluYoAty0WFRURZpfkQhACJHLvgoxicE7f08/Ya+Mfgf9mDx3+0D4yk 034zXvir4yfsm/Fv9l7QPGXwn8a6F4O8U/DV/i3qvgvWL/4saNrOrwuuneMvAN98 P9BvvAkml/ZFS9u9Rn1S4kay0j7P8Fkng1m+ecY5pmvEWWOtkMMbio+zxeLcFioq FenCWFpYXEfWZ06daVGt7WrHD0HThJRnW+F/oWe/SC4T4b8JstyzgzO40uOsTRw9 SlHLspoVpZdCWNoVq39oYvGYWeCpVZ4SOIoyw8HicZTqzhzUaCvWj4zon7PPxC8Z 6Z8YviNpnxQ0nw3+z5+z/c+APD/xe+LPj74XfGHwFrHhf4mePNXn8MN8CbT4Uaj4 SuvE3iD43eEvFdhq2neM/Del6jN4L8LaRpZ8R+I/iJotnquiQal3XwU/YK8Q/HLx z8QWs/2ivhF45+Afwh+Dln8f/ip8avBeteOrnw14L8AeIb/xNpXhTwX4w8KQeCH+ LWj/AB71uXw9ext8E9L8KXms21/9mGm+Kdc0250/UdW6DXP21fhJdWX7VP7LOq+D fi/4p/Zh/ad8efDL4v8Ai3xDB8S/COk/tBfD742+AtC8N3vjP4pW3jnWvBHinwN4 51r42fE7TfF+tfEjQZfDfhPTbHwl43h0nwPqXhm68KwjW/ffBf8AwUv/AGXPg6Pi o/g34F6L8Kvh18Yfgv8AC74DfEv4N/CTWfAtnrfje4+F3i/xV4j0n9qIeMtM+Avh /wAF6P8AHV7rxR/bj/D8fDDU/g6502bwRqdxfaNqel674T/V8u8KuCspmsRDh/C1 q9GrKrCpW9pUoRbl7sPq8604VI0HJ04qt7ZTcVKpzO7f87Zv9IfxWzVTorivH4PD VKEKDhRjhI4nljBRlWeKpYSjKGIqyUqkq2Hhh+RyXsY01FM+2fgB+yr8I/hCPhT4 n0Zvg3pPgz4x/G7wF+zl4X8T6foXivTvEWlftGeNdW0XT/B/wf8AjN4W8Q6WfiH4 W8W6ja+OfDnjXRBaT+I9HvPhR4huPihoV23g+1M998of8FJv2O/25P8AgoF+1J+z T8IdI8dfDzTfgl4h8JftF3fg5NTs/Gvw68J/A/wx+yv8Qbf4dftD/FT4q+H/ABVo Fv4gvbb+1b/w5D4H8SaOPENl4y0bVdGXw0NK0+/1PUrn5z+KX/BZTwHrHxN/ZT0L R/hZ8WNG+CP7P37avgb9vf4parceJfAEPxz+PPxy+HXhbSvCPgiyvpvDHhXwn4C8 IeAdG8BaDo3wtvdATTtZ1XX/AAXI93qOtW2r6VbQ3uR8QP8Aguquj/HH4PfE/wCG Hwg8deM/DHgnwd+2j8OPivB8dviZpt38SfjR8Jv20PibY/E7WPg9D440Pwprk3w4 8J/BTUdJsbb4O6nYp4putMS4vorvR00hn0W79LFZlk1aDwft6cKVKvTpezw6cIS5 KkKjjThQjy/V+aU+flioOUJST0hJzlPCHifhcbHil5XjcbmOPyfFYuGYZvKGMrwp YrB4ynTqVa+YVXOnmLp08PPDRnU9vyYilSqQcJ1qK+HPhB/wTyiufDQ/aU/ZD/aG 8Aftm/Dvwr8ZvB3wF+LeheEvB/jf4WfFD4a+Lvi9rtv4a+BWtaj8O/ila6Jq194F +NPiyaLwl4G8WW08aTeKzJ4cv9Ps9T03xGnh/wCmvij/AMEltc1r49fEz9lzwT+0 78FvGf7b3w68A3HjXUv2V9K0j4haTc+MNa0Xwwnj7xl8Kvhb8XfEPh/Sfh/8R/iz 4Q8DSza5eeGdMltra+ttG8QQWWsMfCvis6D4P8Mv+CiXwB/Zp+FGvfsvfsA/DP4x eCU+Nf7QfwH+N3xf+OP7S/in4aeOfiN9q/Zg8caf8S/gB4D8G6J8OvAfhHwtDofh X4maZY+NtS1jxH/a7ale3GtaQmh2ekazMbT7i1f/AIKV/Bv4c/tYfEr/AIKJeAf2 ffiD/wAN5+K/DnjiDw/b+Jvih4Q8S/sx/DH4j+OfB978Pdf+MHgfw/B8KtG+LOp6 lfeE7vVLyx+H2veL/sGkaj4y8UeHG8Z63oFtpF23x+cUOFKHEscXjasaeZYnK8LC ftquKhh1l9KeOVSrl8qS5K2OVeeFjUp4jmSpckqUHeofovBWbeKFPhCthclpYn+y cHnmYwwjoYPKamJxWe4meVPC4XieGLdsLkssOsx5sTgPYVIVNK1Wm4YeT/Am38J2 s8EM9tqiz288STQTRQB45oZVEkUsbrckMkiMrqwJDKQQTmpv+EOT/n/P/gN/90V5 zDixhhs4AUgtYoreBNzfJDDGscaZyc7UUDNSfapPU/8AfTV8lLA5g5ScMxfI2+Xm wlDm5b+7zWlbmta9tL7H9HUquJVKmq+Np06yhFVoU8HRlThVSSqRpylyylTjO6hK UVJxs2k9D9T/AIR6nYeCNO1RbEMn9o6s+pajPIPmNw8cVtFEZCAzskEKIN/myKFJ YlSEH0HF46u/EcMei2Gprpc2p/6JJqZO5rGBhvmkjVSHknMYKIhaKNWfezKEyfzq tNYmuLFHtLxpbK+EF9HIjlo5lkXzoplIIDJKsm/HKsSHxuANZ2ofFm/8Kahb2d1H qDfaI82V5AWMUspwi2YFqXnjnYglI3tSkqK+yRiCo0xuR4arGcJ8scO6cIQikpTq KMJOcLcr09lBxtBczjzSjKMmuTfKfEfMMuy54CnKWHi6VSjRqUG+Wk60Wo1IKLi+ f21SU1yuLvy2ld3P6Yvgh/wgfhXxd+y34U8O+CvDPim6tvA3xM1O38bavJZWuuaR qWl3/hc7bW4uI2+2waxdeILy3msnZszzJPDFIhuhX8oP7afwqtP2eP2zPi34M8Nv YnwrqXi7WNd8LWmnp5MWkeG/Fus6k0Ph14xa28NtdeEtUhvtDaCwVrWMaNFBHPgz RR/qj8AfiPqHiK00Kbxfq10kOjWszaWuj3UsN9p0d7cWtxJHLfRsJ0ZmsrSWSJJI ljkiQMrshLeL/tg/D34T+NfiBqnxR8QJqfinxfrz6elxr2reKfEEWo3EenW8VjCP sWnaraWCNZxiN1aK1gaWZZbq4d7qaWSScBxBU4XxdDGV8tzL+wa9GjgaU8LLD4mV PFRquVCpPCzxMHhcPeUqEJUqlVOdSUqtCi5OpW+K4u4DwPiBwy8ry3OMmw/FOBx9 bNqrzXD18uoVMnr5RhcHVw0MbhcNi8RicavqmExEoYnDwVqMaccZCFCnCP5s/ATx vM3xG1fR7mR1VLlfssEaFmlWzu5LW9lefACbkaD5GZUAkZtrujzH9Jb7xxcnQ9Vs /A7W0VmkX2XXPF1/KE0XS9w2y2VjOcvrGrjLqLey3RROMTSqVZK/KzxFPZfDC81+ 6v8Awq2r+Kb220ax07UTrF3p9ppOjSXc891qlzbaTPbvqN3r9nHbadp66nEbC0+y zSSQXQhhtLj0Dw18cJ/FtvY2F5PbWWn2MDR2vh63dbW10hYzGD5Fqo/exEuub8g+ duVWEdzvgH9D4DNZYmnKVG8cJX9hUw+LhKg6GYUKmHo1FiMN7CrOap88pUJSxMKF V16NedOi6MqGJxH+fuZZTUymrHCYidNY6kq9PHZdyYynjMpxVDFYjDzwWYxxeGoQ WLlGlHGR+qVcZRlhcVhnPErEOvhqH64/8Ezv2b/gv8fvjX8f9K/aA0LVPid4O+HX 7Ev7Ufx18P6TDf8AxX082XxA+GGieGda8LeLG0X4JeK/B/jzxm2mS3F/bHwJaape WXimPU207+yLzV30aax9x8UfAv8AY88VfAT9oX49/sLfsffEn9prxJ4f/bn+E/wY 8A/AnWtf/aQ1nxj8Lv2ZdR/Zu0zxRrXxjvvBXwJ+Md98QZ/D/wAdv2gvD3xN8AfD bxZ8VvFXim88L6BYaLpIXTfiZb6lEv5C6L8Qda8GR3GteGfEeu6DLeWU2kz3PhzW 9S0G9vrC9kimn0ee6065tJptPu57S2uLzT7ky20v2JLiS1lktUA8wsvGXjLwV4q1 DXvB3i3xL4Q18x3mlPrfhLXtY8NaodMmuLd59MGoaRfW1+umyyWFi72DXT27Gysz IrtbQsvgcRZ9hMqqQwcXUqYnFU5TcKU482GoRi4SnPnTi6lSpOPs4SjrFVJNpJQl +peGfhZmvGuHxWee1oYLLsvxFGlhHjKdd0c1xlOrSqYjDp4epSr0sPh6DtWxNNt+ 2q0aNJSlHESof02/tSf8Ej/2etP+EX/BS0/sm/CXxZ8Z/jF8Hv2hP2OPAnwU0jwv rfxr8ZeNPgnqPxh0XwN4k+OXwVuktvGN14H+LUHg9tfTTX8Y+LvCuteIfBFhqWsW XibxWfFGg3V9pvlHiv8A4Jvfs86F+yH8EviIv7Ps2l/FHTrr9gTwb+0r4e+Mlx+1 L8OfifH4z/aB+J/hEa947+DviHTvifqf7O/xx+FXxe8Mazd+BrTwT4D8JeCfiH8K bK21TxZd+M7Txn4W8QeHj/PB4Y+Jvxc8A2D6R8M/iP8AELwNpUt2NQuNM8G+MvEf hfRpL4wQ2wvL2x0XULOwlne1soLYzT28kstvbQWoEiRRRVyHivx148vdJ02NNZ14 J4S1PU9a8MsNZ1Iv4W1LW9ctNf8AEGs+Ggsh/sbUtZ1yxsta1u+042NxqOpWsWr3 9xcXlpDIPncLj8lrNyeHo4WtKnGjTw/sqLguapOcZRapWhJuok3LlTUfdirJn1nF uF4t4Xr4HIcVxZjs0VbMIY76zTr5q8XO2EwGDVPG2xfs4YaEcNz4eDm6ic6rnWne UKn9FP8AwWT/AOCZXwc/Y08R2M/7Fv7IcPjn4beLf2jG8E618ePDfxI/aE+JPjX9 n74jQXXh3RPDH7I1r8Ir/wAca1HpV34p0220bxtpHxB+K1r8TfFPxf1r4q6ja/De Xwd4Ytfh9psnzz+3T+yp8MvgX8GPgZ8UPhj4m1HxfrHhvxp8QP2S/wBuG+N7ql1o Pw9/bo8DWenfFHV/AeixazpOi3Fzp6eDfGWufD3RdS8GafceBb6w/Z8udX1G8PxH 1zxnfa1+Ey/HD4zzajdyXXxe+KN0de8Q6D4m143HxA8WTNrfiPw7Jpn/AAj+v6s0 2rsdR1vQv7F0b+xtVvDNf6WdJ0w2E8BsLTyvqjxp8Ste8deGbSy1nxprt5aanq0H izU9O1fxBruq2l74pGlPpVz4k1G1mlu47rxI9jJ/Z39vXdt/aVxpw+yi7e2Hlnx+ Mp5fKdGNfLqteeYYZ4Sliqfsr5f7Cp9YjOC9lKfNWqOHtOX4qcJwuk2pfTeD+T8Q 4hPDUs+dHL8qzqGY5pg19bqPNvreF+qtV7zlB/VsP9ZeGlOPJTxDp4icJSireJT3 dv5r402xPPXzNS/DpqAHTHQdPeoftdv/ANAyx/7+al/8sKg1CMWN3Nayk+ZC5Vjh sNgnDrvAYo64dGIG5GVu9UvPj/vV5FJt0qfKuaPJHlk4qTlGys7yTbutbttvdn77 W+ryq1JOvbmnKVvrVV7u+j9ptrp5Fj4cfF0+E9Li0HWNPk1DTEmMtrewTEX2mwyC WWa2S1cCG9gkuGSSINNbyWwacBrhXhih9b1TWW8WW9lfaGmmSrFcW9zFdTh7jyVi xIAzqjG2n3yIjK8dvPEspQmOUxsPjhPur/uj+VfTfws/5FWf/rvL/wCjtMr1OI8O o0qdWnOdNzxCp1ILldKopqbvUjKLk2nHRKcYO75oyai1+KcK5ni6ntMLUnGpRwuG jXpc8eaaVOrQpqlz3/h2ldNpzT+04vlPorwh8X9T8D2M0UlrCtp5rI1zMvlWxWBR dXAS5wI2ZID5kkkcjouH8woUkA8a8X/G2y8Xaut7BcWVmktwyxfbrpLS2+yQS+e7 wLPKBLdTrj7IL2Swsi7q9xdDAgmPGP8AyJn/AG08Rf8Apinr41v/APj30/8A64/+ 0revKyfK45pDGYPFV6kqGCxlTCYel7OiqcPqksRShUUVBSTfJGTipq/vRk5Rkz0e Kc9xOQU8NiKEI1quPyrC4+rUnKVOtzV61Gm6UqlOynCMZTV+SM3zaSi4xa+kfFNt 4Y+LepSaZpcostb0nS7mwXxTEsE9rr8sk2Z7bVQEK3um2dy8RsdQhj88XQuNQsSl sLCEfMWs+DvF/gnW0tpbO4+1wTstlqGlpLe2V26LNvFrcJFtmJjguBPaTRpOsUcy XVsqB1r2/wCCn/IWb/r2m/8ASm2rrviX/wAhHw5/2H9X/wDSXxRX1HD+YYnAZy+G IyVbL8NhHWozrc0sTGrOopVW6ikouFSU5SVPktT92FJwpQjTX5nxxwrleb8GYrxE kquEzyeNy+hiaWGklgMTSrYedODlh5qUqdajDD0oKtTqxde0qmJjWrzlWfF+F9b1 S/0bTbXWInttRW4lijW4VIXkEkkEC3TW6g3ECPsjVllRFLo72sSwPGldnrjDzZ76 GWNVkaeaVLl9jGVjJN5dsdh3s43LHE+HyvLvuOzioP8AkOWH1tv/AEtjrpfEf/Hk n/X5H/6KuK8ziLDKnxBKKnOXtnGpKVR88v39OE5QTldqEHpTimlCKjFLlikfVcCc XZxPhfgzC4eeGwVGNLH4CVPDYanThVhgswxOEhWqQSUZYitHDRrYitbnrYmpVrzb nUk3j3PjB4bOCyQQQGCZ5pJNil7hWIZY5s8ZBypkVlkMYijQx+WTJzer+L11GCS1 G9IHjAeOQozeYsiyKiyZY+TGUUxFRAxJfemCoXB1X/Wyf8B/9lrmZf8AWN+H8hXo 4TK8HJwrun+8jyyUtFaUVFJ7atWjZvVWune5ycS5pUnmk8ROhQlXpVa0HVlBylV9 pzJyq87kpSha9J6eybvDlsiq7BLiNxwEZGBHUBXJHX2HevZrnxLZR6dYqtwu9Igr qDhhjtx19f5V4rP98f7o/ma27z/UwfT+hr0MdgqWLlhXVcl7NzatbW8Nnpf7mefw nxPmHD8eIlgY0f8AbaeGjN1FN8nJVnJOCjOKv01vodXdeKoLid5ri4kmmYjfJK7S O20BV3OwZjhQFGW4AC8AAVX/AOEksv7/APP/AOIrz1/vt/vN/M02q/srCf8ATz/w P/gHLPxAz3mkl9WSUmkvZPRJ6L4+iP/Z ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=sflogo.png Content-Type: image/png; name=sflogo.png Content-Location: http://sourceforge.net/sflogo.php?group_id=46278&type=3 Content-Transfer-Encoding: Base64 iVBORw0KGgoAAAANSUhEUgAAAH0AAAAlCAIAAADgP3HoAAAAGXRFWHRTb2Z0d2Fy ZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAvxJREFUaN7tl72NmkEQhq8EJBdgSrjM KYlzSqAC6yLHdODABVACJVACJVCAA0o4P+KRXo12P7gTiR3MK+u03zA7O/POz65f XhqNRqPRaDQajUaj0Wg0Go1G4x/g9fX1eDy+33A6nbbbLcLVarXf78/ns3IUNpuN +r9uqBbYtdvtsHMqeHt7iwK/xpRHDMpAy4MQNbezdvvlcjkcDuv1Ws+rMk6qD1BA DeUcqj+D/SGQGOTEeO6ni4pZEjnsYXl/w13ece56varENtxlmzTxqdwA9CY0BfyE DolhwXbWJtJTkVRTRluV41/IDVBze0h3gcMwq5EK5Nghr+8T2KurFUMgMah9JDhm IC4qZknk5BgGJDOlMALVIe1arAWbTODNY97TFkZFqpKAOcIop28GZZw2GE7HBwuw tqDrShkLWHNL7LPLdXQWqaiJxP4i7w92VQKhlEzD4b2zXiS0NikSq6PCIsLQZ3h3 fbzhga+6BSwueU9nIE+0ki7SAZVr4nSNTRfanIus9tmgMzQQIc+8u84gWuQdJiGQ 2FMuC+CHROKQmRsw1h0UD3ivLe+4nFM4R7g4ZxLtYCFjZJ4zWJhZgNyMsnmOLXpl FgnBxTxnKgPzibJ6t9IrcM7ahPrFerfBP6x3FRKSNufSezBncCBNkGirhbnebVmH e4Q+EAZe0hMeMRRjNJHnLhl4d2Od2ou8f4waPIfZ5sZfs+f163xnHY/TB6ESHTTh ItlyVj4x3zEVZqU+Y8T0DAmw/aUMH/yceR/O/f39y58fX/m7eGE8Md8/9YjMSLWO DNsK4q9XhDeVYeiBPwF/yuvCkGSnvmfgQn0+veWG94wZnS/hXKQVzs0asKfgDHKC 0qsB85xRCOn+GxjMnXHvPfM8777TLWHZrwFHPryH8h4nvFzITvOo+ZDKRPaTXSwW 3+9IfL/XKyuBeUdxnE7abTFiZ7h2vPCpNZOU0ObnNsKf31aQzt9qsEZx7/0+vPr7 /4KNRqPRaDQajUaj0Wg0Go1G47/BXwLmDwsKnGx0AAAAAElFTkSuQmCC ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=tutori7.gif Content-Type: image/gif; name=tutori7.gif Content-Location: http://zippy-egoboo.sourceforge.net/images/tutori7.gif Content-Transfer-Encoding: Base64 R0lGODdhUwBTAHcAACH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACwAAAAA UwBTAIYAAAAREREAAJkAAMwAAP8AM5kAM8wzAAAzADMzAGYzAJkzAP8zMwAzMzMz M2YzM8wzM/8zZmYzZv9ERERVVVVmAABmADNmMwBmMzNmM2ZmZgBmZjNmZmZmZplm Zv9mmWZmmZmZMwCZMzOZZgCZZjOZZmaZZpmZmQCZmWaZmZmIiIiZmcyZmf+ZzJmZ zMyqqqq7u7vMMwDMZgDMmQDMmTPMmWbMmZnMmczMmf/MzJnMzMzd3d3MzP/M/8zM ////ZgD/mQD/mTP/mWb/zAD/zDP/zJn/zMz/zP///wD//zP//2b//5n//8zu7u7/ //8BAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMB AgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMB AgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMBAgMB AgMBAgMH/4AMF4OEhIKFhQcMB4wXh4UYGogMFY6DgpSCB5aGBxWLiJefkBcYhJuP mheolqaOFYqbm5cXGyMYIhuGlqOVmaOur4uZiKPEGiKSoIOmqaGWsayipiS1ibuy q5iGn42KpY7Nu6UawaGqxsyrq4yU6hflyLrB37OY2emZ2ZO9ghjV2sC5SkdKVKNH zJCp2zZKmC9Og0YpArZw3SFdujgFE/SJoKhhs8AlxJDxVb11jn4JGzRxW6GHjf4R qhSp1CGXIoV5OmQOwy1Jp4hBy1eIWEhTGxIUUJDApSsGj1yh6mip3IVuoDYSqtlM ltF1+LahysYAQwMHBNIOcIAAATwST//BabiJ8p2mjjy31gqxcSdLS5gaXmUpDYOC tAvSKlZQKuMhSaYEOwMcUCuhkl79ghVFWRMxASx4+ODhQXFaBdWk5rz5cFe3ulv9 7VpEVlrhqZkw5AjtpDcPFqXTGoA3jl5XWuAC08WA0Go2b9wCc8K9wUbv69g9QCAw IAMGc+Mgyn5lMWcrfu1osZLG6xUK7PB7b0/7dLy4qwgthyQfVRhtUBy5k9tsFbwX X3aKNTCTXkWZJx1PYr3jiCyNGIKQeoWkYMR1NnDwQQc6XEfaAzXMYOIM4QDlEiuq IMdReYNY1Q0jLUVEC0IAwnCdDhxM0EADJYTY2wolDGEkEkMUBCP/RZw0BBVVZV2y CFYN+iOZLxUI6QQFP/rYQAq9MaHEEEgaOQRUcUkzHkohBQgROK9VeEibMGKSw3Uc /NiAjyD0loSZRyY5yV8NcvbLMuF0os8mpjCH3CyvDaJlnl5+yQQRRJAZ6JmFNNAa ciutuJKENA7DT2dFWddbnl02YAITZQJqpIQcKRglJ+6g1GKUjsXCTkVw5qrSpHsW mwITm5aJRKFvPsKiQS3yM0xDptAJDWCqOtGjng28Z2ass97K31+uPIUXKPsl2g4s F0r3ja6DgKltq5bKqmx0Nxbq5ov2NIpNS/42NIs9IRmogws3tKDDCjrAuqmZq5HH zCHp1MZZ/1GweFWJLspcO6ogJdiQw4bY8bCCvZpWVMmbtGA5p66R+PsfK42+KJRQ 0OTQBHY4SJCppoBGLJs4rAEYEHsfaQxPZFB91OS+2WL357dGqnjAQP3h2o1EU4l0 z7o44tVQBUHqYLbZOdzgw4FiAj3rfTga6jExN0dEm0Xf/aUJCimkwLeWBx5ohBJF KLGEEkoQB+V5GG42oT2D0oiSVYdwQALggWceuIUSjnPoOsb4Ui1YOKkmr+aoZ24T bK7V9eTXoHZSY1wa9mYCB7jjTgEHu2+g+++7B8/78LvPZF9y06m0KzBzHqQXBigc cZ0LfafA7fXYZ89tXMA2TpbdsSeNH/9xF+x8YAomfJB+BnpW6uP7xcKvYHjMGmWz O6Or4utRpfSQuhMqiAAGKOCADRSLW5VqFTj4Rw+LbK1p40OaJpwXDAvcCXVNYMIR fMAE68XPS/DzEmWQMpsbUWtuHfHUzSTDABGUwED/M9sNXKADG+gABqwC4fxWRsJG DWwVEnEWZSCnD42ArzopEFnU/ueEF6ggBU+MImUipp4JkuKHFMMZo5SxHk7kQAdG 0MEOzGaEHTDxOheinN4kAg1M0M0TLHrgO6zlNNlsAHOoWwl4lMPGWVTrUELcxppG IANCFvKQhEzkIWVAgyDQoJGPFEIja+BISQahBp+K2UuKBiNdaYb/LoIxhQxkMANS mrKUqBwlKlNpIlKu0pWkfBn5LmAruhyKJqw4Ieha5ChDjvKXwFRlMIdJzFEWx0Er w4+T6rhMm0FEBico5AiiOYJpSvOa1SwkNRN5gkRmcwRT0WTL1KWcS1QIOsKS2CWq 6U1FftOb2IQnO6U5AhhVw0222Qy/ipgvwDxiBCFgZ0DZSdCCGvSg7HSK58alikwg ij0r24crAkpRgFL0ogDNaAg2atGOVjSgldgi3Fb2sn3gx19+HMT8PEMIDYTApTB1 KTxeeoF61nQQI5BEPWF6gZeG4KYKtRGo7mGqXQkyFPwLxU8l8dObOtWmS22qTYES ArxUyVHp/5KF2LKYzAilq6XPCKtYz0EKoUAOAxRqmhY9lhwmjfVC5hnrgtSkz2JM SUDjg8h9JoQra0zHG037B+W8ApKGbsNc+UnOf9gYpWeBT03JxFCFyCECjAXISaGz S5USITmc2O0hziIpOZrRR1NtgCRttCpu+kmMvU7oPw5Z3VHV8a5gaCUWuSrFLU6h DatK1nitEZ3d1jXF8XX1L2elXETBVguAtPEbOGuQrUQbts6O7z6z8BS+xAGQe8Rp JLzdhFUd1bhOlgs/0zJpCbW2DP4NjJ/USFp6dsVbvq4JeTSCbqKIIRmbSOOdCP0m PedpUHraI6InpRVWtuqi+irTEsKcwf8PSgmEX1Z4laicsCp/QEoOU1gGoZrsOxRE oRq9ZBqX6MojTvlLVgqzxRE2pYxLCWKPvUsuificHyFUXCDOwpcvhjGLZQxMGhu5 xl0Ul0DucpDIttVpzLmxKgk5A0NWuZhCNqQvDbkS34LHnNMSxPzEA1eKKHKRWkak mr955TWD+DVOmYtfF+WrY/rxXYiq6ZrdWcgrE5KabgY0IRvqZau0VXIBySuoDvyu dyJSnpDe85qvtQyEOGZG00KeTfCSS+kQlJ6gLmg8CWzQLiNKk0Qr1SdSYZlFiIMV IZDBQGddTVrHQKMZvXVFbz2CWyuzoSKphnPyKzFVkJYS+8ENQWn/ndFmB9igAx3B PXosTsJ0NkoXek5ZyolrZtMaoxwN90cBuhm/mMLQ5sxvtL7xx95ewxE/7bZHKepS jdab3gGtab5X+IhqnHa4zGWrQ3hsiXj3lKk4nSlTZbrwpR7c4Nxw963SdIAA4BmX 2F61Lssz1agi/OEJp+lNaUpyZYTO0n59HAC+Fy0HZm0/Ui0ETxNOvqZ+vKmIOI46 KguNUl2LKo5iSE1SInOljtXmiAAKUI7TWvBahNhEeRTjgAhXuVpdrJflhKEnmJ72 YEIr/Wn51cee82IzSi6qoQ06YcMvgWAIJ3QRT74m84xyKmmCAGgw6yColwPLJi+0 SNOvCpOTYVcnul3sIC5eo4Q1cGAmWnGPO5vKszKM2PXwwMqvftWp6UngNVFGzJWt UgsYf5XC8He9blFK9UNOlOQT/mJa1wi1Wc50/SIxQs/f0VNx8dpSJEFP+ZNofxPT I/45EjJFIAAAOw== ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=tutori8.jpg Content-Type: image/jpeg; name=tutori8.jpg Content-Location: http://zippy-egoboo.sourceforge.net/images/tutori8.jpg Content-Transfer-Encoding: Base64 /9j/4AAQSkZJRgABAQEAYABgAAD//gAcU29mdHdhcmU6IE1pY3Jvc29mdCBPZmZp Y2X/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0aHBwgJC4nICIs IxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIy MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAAR CAGwAkADASIAAhEBAxEB/8QAHAABAAIDAQEBAAAAAAAAAAAAAAUGAwQHAgEI/8QA WBAAAQIEAgQGDAcNCAEEAwEBAQIDAAQFERIhBhMxQRQiUVRhkwcVFhcycYGRkrHR 0yM0QlJTc6EzNTZVVmJydZSis8HSJEN0grLh4vDCJUVjhCaD8aNE/8QAGQEBAQEB AQEAAAAAAAAAAAAAAAECAwQF/8QAMhEBAAIBAgUCBAUDBQEAAAAAAAERAgMhBBIx QVEVoRMiMmEFcZGx8EJSgRQjwdHh8f/dAAQAKP/aAAwDAQACEQMRAD8Ain332pm2 rKsK9gWoJUFX6eTCMthMWGWZlVSg1roCxYKUTxvCAvYZbLmLFMS0o2oq4FLkISDf VJOZuPJGVmWkXklSZNkAG2bQgK21LSQPwsyLYc7Z54P5KjGlqVS7LYncQKwHRfIC +eYixKbk0JcUZSXNlFIAbT07fNGZiVk3mQ5wNgXv/dp5YCtuMSCsOrmCEhGZUMye Nu8iRYct49FiQBSdbsFim9wem/s5InCiSQUhckyMRw5NDaNvk3RmZl5F4Epk2ha3 hNAf9/3gKsG5dTTHGSlRSorN88V1WG3K+W6M7svT1OENvhKcaswdibi23oKj5OmJ 5bUk26tKpSXwp3BtN93L4/sjykSCjbgLdyrCBqkwFVdS2lxQQsqAtY22xuamRWQN aEAqOYN8jgA9aj5IsjUtIvAlMoyLW2tp5Lx4cl5Npa8cowUgAizQvnf2QEAGqfhN 3NoNszlxVZ+fDlGJxmUQ08UO41gWQCdhunk25FXmixobkVu4BJs7QB8Gnbn7I9zE tKMthSZJhRzy1aeQn+UBTIRblCnpdwcCa8IpPwadoja4BJ80Y6sQFHhF44BJ80Y6 sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44B J80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFH hF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y 6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4 BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80 Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF4 4BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQ FHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ8 0Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFHhF44BJ80Y6s Q4BJ80Y6sQFHhF44BJ80Y6sQ4BJ80Y6sQFXojkqzVW3J1TCWEocKi/hwA4FWviy2 28sbB0mo02JV9hFPbKHXrsutsoK7S7pTcD5OLDt3gRYOASfNGOrEOASfNGOrEBTK XUkuzcgmfqVMmUKqTd8DTLfwYQsrukISQjZ4V/B27I91KsJdTONB2lBgutplTLhg Oqu6gEKwm+y+G3yb4rGLhwCT5ox1YhwCT5ox1YgNt9UnJthc1NaoWBJKQEi4uMyo csZtXLpaDl3XAVYbZIt64x1KnpmXWxwsNOMlNlIOaVBGE7QRvIj04EolkoDiVKxk 8W+ywgNSSqlKqKcUoXHQEIWbOWsFC6dqeTdGKSqMg/ISD0xNBh6cZQ4lohOZIBIT dQJsVAeUR8kqbJ04KEowGsQAVYk3sSRe/jP/AERqSujjb9Poypx1CH5JhsYOKbKG AkE4TsKBsI3wEol+V10ylx1aEMBKisoFrEE3PGytYx4nJqUlmCtLjjig82yUhAFi tSUi/Gy8IGPSJAGYmy46wpp5KE2JJBACrgi3TGs/RwmmsysvMNqwPtOFTiySqzqV qJNtpsTAV2p6QVOXq85KsCT1LK0pTrGVKVmhKsyFjeeSNbunrPLIfs6/eRpVJ5t+ v1VTSsSUzGrJtvShKT9oMYIzbNv/0NnunrPLIfs6/eQ7p6zyyH7Ov3kRcIzbNpTu nrPLIfs6/eQ7p6zyyH7Ov3kRcIWWlDpNWDa5kMtn9nX7yHdPWeWQ/Z1+8iLhCy0p 3T1nlkP2dfvId09Z5ZD9nX7yIuELLSndPWeWQ/Z1+8h3T1nlkP2dfvIi4QstKd09 Z5ZD9nX7yHdPWeWQ/Z1+8iLhCy0p3T1nlkP2dfvId09Z5ZD9nX7yIuELLSndPWeW Q/Z1+8h3T1nlkP2dfvIi4QstKd09Z5ZD9nX7yHdPWeWQ/Z1+8iLhCy0p3T1nlkP2 dfvId09Z5ZD9nX7yIuELLSndPWeWQ/Z1+8h3T1nlkP2dfvIi4QstKd09Z5ZD9nX7 yHdPWeWQ/Z1+8iLhCy0p3T1nlkP2dfvId09Z5ZD9nX7yIuELLSndPWeWQ/Z1+8h3 T1nlkP2dfvIi4QstKd09Z5ZD9nX7yHdPWeWQ/Z1+8iLhCy0p3T1nlkP2dfvIoUx2 ZtI2Zl1oSdKIQspvqnM7H6yLTHEZ34/M/Wq9ZiwsOg9+vSTmVK6pz3kO/XpJzKld U57yObwiq6R369JOZUrqnPeQ79eknMqV1TnvI5vCA6R369JOZUrqnPeQ79eknMqV 1TnvI5vCA6R369JOZUrqnPeQ79eknMqV1TnvI5vCA6R369JOZUrqnPeQ79eknMqV 1TnvI5vCA6R369JOZUrqnPeQ79eknMqV1TnvI5vCA6R369JOZUrqnPeQ79eknMqV 1TnvI5vCA6R369JOZUrqnPeQ79eknMqV1TnvI5vCA6R369JOZUrqnPeQ79eknMqV 1TnvI5vCA6R369JOZUrqnPeQ79eknMqV1TnvI5vCA6R369JOZUrqnPeQ79eknMqV 1TnvI5vCA6R369JOZUrqnPeQ79eknMqV1TnvI5vCA6R369JOZUrqnPeQ79eknMqV 1TnvI5vCA6R369JOZUrqnPeQ79eknMqV1TnvI5vCA6R369JOZUrqnPeQ79eknMqV 1TnvI5vCA6R369JOZUrqnPeQ79eknMqV1TnvI5vCA/YFWVMrqElKsTr8qmYn3UOL Zw4iA0tVuMCNqRujP2kmvyhqv/8Ah7qPcywHJ1L4Skrlpl1xGJVgCRg5eRZjLwyY 5GPTHtgKy7OrlsQmKvXAvAtxKW0tKshNs1HUi1yQLi6STkogG3tqc4QhlTNX0gIc W0njtsIwhxVkkhTYNiLqyvkOXKJwBIJIlZK5UpZNk5qULE7dpGRMAEgpIlZIFOyw TlxsXL84A+POA+dpJr8oar//AIe6jA+05LvMMrmXpgpbXdx4jErjb7ADoyG6N/hk xyMemPbEY7Npmp8gFJU0FNrw7AeKr/yEBzMffSr/AKwe9cZYxD76Vf8AWD3rjLGZ ZkhCERCEIQCEIQCEIQH/0dSEIRhghCEAhCEAhCEAhCEAhCEAhCEAhCEAhCEAhCEA hCEAjiM78fmfrVesx26OIzvx+Z+tV6zGoahghCEVSEIQCEIQCEIQCEIQCEIQCEIQ CEIQCEIQCEIQCEIQCEIQCEIQCEIQCEIQCEIQH7HqU03KImFuh0hTy0gNNKcN7pOx IJ3RD9uZX6Ke/YH/AOiJ95SkKmSlRSdYvMG3ykxqa976Vz0jAUyz6JxTzc7UcBcd KUGSmLIC1FQ+RnYm9jkQAnIRuSs04zPoeem6k60lvCUGReso3NjbV7bYc77QfnGM jFT0lQww2+letU43jXYrASbFezDs2WtfjZXwkn1K1nSNydSh6UwNFTYJJWLAk4rH PO1tthxfzhAbvbmV+inv2B/+iMVKUXJmad1bqEOPLUjWtqQSMLYvZQB3GJnXvfSu ekYiJBSl1GfUpRUeELzJv8huAoY++lX/AFg964yxiH30q/6we9cZYzLMkIQiIQhC AQhCAQhCAQhCAQhCAQhCAQhCA//S1IQhGGCEIQCEIQCEIQCEIQCEIQCEIQCOIzvx +Z+tV6zHbo4jO/H5n61XrMahqGCEIRVIQhAIQhAIQhAIQhAIQhAIQhAIQhAIQhAI QhAIQhAIQhAIQhAIQhAIQhAIQhAfsioSkrNpmETcqzMtpeWoIeTiTe6Re3lMRXaa i/iOm/s4jZrzk3jalpJS0vzU442ChSU7ElZuVJUPkckRyKNpIVpC5l5KScyJhk2H UQGpfR9Ew809o/T29WSb6gZIBwlZvbK9tl9vQbY5CZ0aqM1wdrR6WC9Yps4pKwQo C5Cvmm4UP8p6I9S9Jqk4p16TccWhL6hrFrYSorSSnFbUHPbnePT1IqVNlOEPuuM4 FJbZDSmDmshNr6kYRs80BJ9pqL+I6b+ziNemJabm5tphhlhpt5aUNsoCUgYWzu6S Y89p9Jvp3f2hn3EbMnILkHAl11xx50F10rKSQohGXFSBYW5IDno++lX/AFg964yx iH30q/6we9cZYzLMkIQiIQhCAQhCAQhCAQhCAQhHhx1tlBW64ltA2qUbCA9wiKFX XN2FMlVzCT/fufBtDpuc1eQR6TTZia41Smy4kj7gzxGx5fCPlO6KrO5VZBqYQwua bDi72zy8+wRuRGPykoZtmS1KUocZdXZKQLEKbz8eYjUblZyQc1MrM4VbUtP3W24P zTe6TnynPzkJ6ERzFXbLuonGVyb9r4XPBPiVsMSMRCEIQCEIQCEIQH//09SEIRhg hCEAhCEAjiM78fmfrVesx26OIzvx+Z+tV6zGoahghCEVSEIQCEIQCEIQCEIQCEIQ CEIQCEIQCEIQCEIQCEIQCEIQCEIQCEIQCEIQCEIQH7DnkKVXaWUpJCag8VEDYNS4 LnykeePlDoDtKn5mYW424HwcKEg/AcdSsDd9iMwbfOvuwhOzMsrdeewuJSA84c0A 7xvKh0Rr8GVzhv0E/wBcBoS9IXU9HX2EqVLzKZ511h4FSVNnGRiSRYi6SpNxuUeW N6vSiJegS8rKMBDLL0uhtttOSUpWmwA5AB9kfeDK5w36Cf64cGVzhv0E/wBcB67T rc0o7aPy8otDYswsHCtslFlKIw8ZRzTfFknYMzfHOZVFIP0f8kx64MrnDfoJ/rjU C0KnFIQ+HFNYkLARax4p23N8iIDm4++lX/WD3rjLGIffSr/rB71xljMsyQhCIhCE IBCEIBCEIBCEYpl8S0q6+oXDaCqw32GyAiH6lUJmdelZCWSG2wRr1KF1EGxwg5ZE EEm/ijy3SplbuufQiYf3rmk5DoSApQHm88bjjIlKMkuOKQ6yjGXE5kr2nx3JOXTG 3T5Kq1aTbmVtGVl1jw1AjF0ptdSvJYXyxb4znqYacXlNNREz0abipttWBT2JZF9W l0FRHiDd/LGEMzcy0taOI2DY/CKdA5QpSlhF+g327IszFCZYRx2n3t6sbZShRO8J 2qvvxBezyx9OJxYWinLcDZs2p5tRGVxknZbk3dGyPPPFRltg1yV1VJyiPU0oq60M v7ZdaZZKkkYiCCDtvluA2kC98tlE23ONhOLWclxZxPkGSsszbzXiZqLqnWHkVH4J GJsoK/gxmFghIyFrAZCK66E6wtlCpoADCsIV8IOUm1iQdpGWzI7u2llOUTzSzk32 XWppsy8ylLgBtxhfPde+w/8AdoMY3JdymNqdl5kiXSM2nONboTy9A2knM7ojiXpg OKlG3Xltix1mFLqc9hub2Nt43ZCNqlTDlTKHJkhTSFEsADw8JsVKFzmDa3kMdUSN Pnm6jKJmGxa5KSm97EHZG1EDJuGQqymcKUy7ysNwLYVYilIPjCfGb9ET0EIQiV0c YZma4y0+2lxsocJQrYbNqI+0CIIqEYJHS+YqEm3Mt0KgIS5sS466DtI3Ajcd+4x9 ldKavO0fttL6G01clq3XC4FryDakpUNu2602G+8evHg9TKZiK2+5bNCNZnSuuPNz ShoFLo4MhKlpW08lRJWhASAdqruINttjePbWlVUcnJWVXojS2XpiXXMpQ6pwKShC 1oVdPhXxNqysTvjfp+v9v1hLhmhGv3V1k6nVaESb5fYD7Il0PO6xJUlORTcXupPR mN5AOhNdkOekW0uTmhMrLoWpSUqeQ6gEpNiATvB2xY/DdeekR+sHNCXhFd76w/Je mekv2w76w/Jemekv2xr0vifHvBzQsUcRnfj8z9ar1mOmd9YfkvTPSX7Yi16ZUVa1 LVoPRipRuTdzM+eLH4XxPj3hYyh//9T8/wAIvvdfQ/yGovnc9sO6+h/kNRfO57Y+ h6ZxPj3hjnhQoRfe6+h/kNRfO57Yd19D/Iai+dz2w9M4nx7wc8KFCL73X0P8hqL5 3PbDuvof5DUXzue2HpnE+PeDnhQoRfe6+h/kNRfO57Yd19D/ACGovnc9sPTOJ8e8 HPChQi+919D/ACGovnc9sO6+h/kNRfO57YemcT494OeFChF97r6H+Q1F87nth3X0 P8hqL53PbD0zifHvBzwoUIvvdfQ/yGovnc9sO6+h/kNRfO57YemcT494OeFChF97 r6H+Q1F87ntjKnTajpl1sDQah6tago3Som42Z3uNsPTOJ8e8Lzw57CL73X0P8hqL 53PbDuvof5DUXzue2HpnE+PeE54UKEX3uvof5DUXzue2HdfQ/wAhqL53PbD0zifH vBzwoUIvvdfQ/wAhqL53PbDuvof5DUXzue2HpnE+PeDnhQoRfe6+h/kNRfO57Yd1 9D/Iai+dz2w9M4nx7wc8KFCL73X0P8hqL53PbDuvof5DUXzue2HpnE+PeDnhQoRf e6+h/kNRfO57Yd19D/Iai+dz2w9M4nx7wc8KFCP0YjQqmqlEPqoGjwxNhwpDTptc Xt4URvaSjh0Nr0XpA+5hTiZV4tpUtKVAYsf5wHjjxzp13hq3BYR3iQo9Cm6XTZx+ g0CXVUGwtloy76yST4IIOZ325ATsBI59p+1IBiQckqVKSCkzE3LuCWBAc1a0pBzJ PL54Zac439i36Rn30y6ZhSm3l3dWLMsrdPhJ3JBNumKTNSkwlTbsmKglzhLjro7X PoK0LWDhxBu4sm4vmRfKLfXJluVp9QUuZallqLqGluuBAxki2ZinLq7rqXMNbkWk rU8UDhTWJAKTq95zubHaMh445q2H2ptaw4h2pqVrErWk0+ZQFgICTYhHEvxr2G8c keS1Us1cNqqnNUUhRp0wBjKycWEIt4Bw23WvtzhN1lT8geD1unNzCXl4bzCEhSAl SRfM7TZWWy45I8GtzCw7atUxGXE+HaOeFV7Z7MVrXzsc84DYpnDJSbLkyupvtkHI yEwdwAy1eZy27cukxvUpesnJ1eBxF5hZwuNqQocVvalQBEQgrc6X1rXWKWEBpOFK Jhvw7i+07LDacxdVgbC81SHmpianXWHUOtqmF4VoUFA8VvYRAUcffSr/AKwe9cZY xD76Vf8AWD3rjLGZZkhCERCEIQCEIQCEIQCNKfIcclZW+broWr9FHGP2hI/zRuxE PvqXVHQ3m4hIl2gDmCQFrN93FweXlijLM3qE6zJIVhSp0JKtwte5PRkU+UncIlqU tbdKmVqU4hCnDwYH5AUcQy/NTxP8u4gW0JWVGJ5tJGTYl8VrAldseXQ2Ljxb4k3C lMwyAMWtbxNtDbxThzHlB6bx5Nas8oxn+d/+HTHaLYpiUedwGZWEsOJxKWbnWDYU jf4ybfbl9xtpFkIufnL8W4f/AN3R6VM6xxSsWsaUAPCyIGwjk5cuU7c7+HG8FiDi QrwVf92GOmETMRzsz9nyYYanZBaZhOIIdQUEHCUGyhxSM05ZZWiLeYnmEWbXwtCT dOKyXUHoOQVyWOHK9yYmPBkh+e5n0YR/yjTcUpxeqbNreGofJHJ4/wCXkvvCIi68 kotZ7dt6xtnAGVFK7my1qB4zd9wysSfNlGKWwy8w4lgAIW4HWgBYYiDZI3AFFh0E jojbdYEnUGnGjq0OgN3AuAR4II3joHKTeNWw4c/LPANFbpCVpJtdSUm4J+UFhJ8u zK8dEZZphM464lCrF8YmlbLXQClXKPuahy5xu0ycM7IocWMLySUOp+asZEf95Yjm nla1a1JCFJBW4kbUqbXdYT4wpRF9oVyRnV/6dXQrZLz4w9CXR/UPUYCWiZ0W/CFj 6t7+EqIaJnRb8IWPq3v4SoCtM6BT9Lk1SDldpiVkYmy5dKkDjXNr5jM/btGUbkno JpbT6X2slNJ2WpK5OpS1lckm+zbmc4vtRoPDy/jfU0p1tLRwugWCVE5i9jttnGWn Uk05lxtLocxuFwqW7ckkAZ3Uc8rm1hck2EeyOM1ImZit952g5YUJuhaXBT5b0wp4 LRJcwyzfwWaFHYnigllBIyvhz3xqr0B0km56VqK6/T3npZBQwtUmhSUArUs2Thw+ EtRvbK+WwRfH9HVvsPMKmm9W48p0AnFbFiuM1W+VcWAsQDnG7TaX2tkG5VDiVhBU cSlpuSVFRJz5TGo4/WjpX6QcsOfM6LaWkpS3pZJLUZbVpPB0KVqVLC7A2vhKkg+O /Kb6lT7G2kVYZZanq7JuoZUpSLSwSQVWBJKQCfBG3kEX17RdDhZwzKkJbdLmFL1g bgADJQ8EJFukA5xuU6jmnIUkTCnbgC7joNgOTPlJPl6IscfrRNxX6QcsOQJ7EE0q YVLprkiXki6mwDiA5SNu8eePaew3PLvhrEoqxsbIUbHkjo1ZlZdkuzMxOsNIccSA HkY0Xu2VA2OYIZ2eOIhC9HpZSQqv4kF4ukLNyc7kX/OvxuU25M9T+K8RG05R7Hw4 8Kj3mKj+NpXq1Q7zFR/G0r1ao6BT63QpBKm+3LbpVhzUTfJIFzynLzWG6LLLJVNy jc1LjWMOC6Fp2KEI/FeInpl7QfDjw413mKj+NpXq1Q7zFR/G0r1ao6inSGkrnESi Z9ozC3A0lu+ZVe1vPHqoV6l0qaMtPzrTDwAUULOdjsh6rxH90fpB8OPDlneYqP42 lerVDvMVH8bSvVqjqtPrdMqr5ZkJxp9wJxlKDmE3Av8AaI+vViny7qGnZttC3PBS Ttix+KcTP9XtB8OHKe8xUfxtK9WqHeYqP42lerVHYWHm5kgMrCydlojpjSSjSj7j D9QZbdbUULSSbhQNiIk/inER1y9oPhw5f3mKj+NpXq1Q7zFR/G0r1ao6YvSmhtoK l1NgJSLkknIR4Tpfo+qX16arLlq9sVza8I/FeInplH6QfDjw/9Wtd5io/jaV6tUO 8xUfxtK9WqOkJ0y0dVsq0ufKY3Gq3THpd2YbnGlMteGsHJMe/wBV4j+6P0hn4ceH K+8xUfxtK9WqHeYqP42lerVHYpNaahKompQh5hd8K07DY2P2gxilpyXnJt+VlnUu PsEh1CdqCDY38sPVOI/u9oPhx4ci7zFR/G0r1aod5io/jaV6tUdlUlSHUtKFlq2J 5YLBQopULEbovqfE+faDkhxrvMVH8bSvVqh3mKj+NpXq1R0peltAbcUhdUlwpJII JORiRkahKVKTcm5J9D0u2ooU4jYCADb7R54nqvET/V7QfDjw5J3mKj+NpXq1Q7zF R/G0r1ao69wpgJCtYmx3xgnqvT6bquGzbbOtvgxnwrWv6xF9U4mP6vaD4cOUd5io /jaV6tUO8xUfxtK9WqOlq0soKPCqjA8pjYla/Sp5eCWnmnVYcVkndE9V4j+6PY+H HhyzvMVH8bSvVqh3mKj+NpXq1R16ZmmJR6WamHEtuTSsLKVfLOWQ8488adT0gpNG fUzUZ5qWcSAopWcwDsh6pxH93tB8OHLe8xUfxtK9WqHeYqP42lerVHTqfpPRarMi XkKixMPEFQQgm9htiWi+qcT/AHe0HJDjfeYqP42lerVDvMVH8bSvVqjskIep8T59 oTkhxvvMVH8bSvVqh3mKj+NpXq1R2SEPU+J8+0HJCmiiaXCZD4qdNxBoNBNpjV4Q LeBrMN+m148nR/Sokkz9JzKCRq38JKQkJOHWW2JTu3RdIR451L7Q1SjS2jGkstIy MpwqiOokm0tsLdlnCpIBBuDiyNwDcW2COd9kykTNGlaSxNvNPPuvTcwtTSSlN1qQ SADHfY432cvjFE/Qe9aIZak5X9yncn8OOYUpAVZ1wgG/zk8kagcCnAgMNZi+alX2 gcvKoRmqDC5hMwhE29K2eWStlKFKIunLjAj/APkQj0umXWhDukFSSXAQPgGDlle/ EyFyNuWyOapRDyXEpUmWThUAQbnYQSPlfmnzR8L4SlJLDRunFxSrLz2ziLWGm0ul ek88kM5OXRL8Xo8D877Y+LbZbZ1itJZ9DYRjuWmAAAcvkcp88BLpdChcywSL5YsQ v4s4jZSYXMT82F2CW3VIQANgwtn1kx6TJF0KwaQVBQCiDhal7BW8ZIyMYKYhDU3N tpdedKXlhTj2HEs4W87JAA5PJAUQffSr/rB71xljEPvpV/1g964yxmWZIQhEQhCE AhCEAhCEAiuUaZS0h2cmJea1j7i1KXqrpbSVHi5cm/xdEWONCW/s1SmJXY26OEND xmywPKQf88VUtR0tTVEl5ttbKuFOLexrNgAOKm/L8pOXJ0mMlRk5k1Eugt4mFWvr kghNsKd/KUHyRWpNBZa1beFDsknim2S2cRSu/IEmxFuQxannA6y846mylMoaeGdl lQCsj0jGP8sfOyxzwzne7vt5mK7+HWJiYavBXPnNdcj2x7bYmE3Bl3Ftq2gJJB6Q fUf5RrYSnik3I38vTGVLYSkLduEnwUjIq8XR0x65mZx69ft/65vlTVwCUlkOKS2X nHNWXeKLAJuSDyZZdI3G8aLc1JtICRNMnlJcFyeUxvzQMxJsG+AocXgw/JyTl4vX 441W3cStWsYXAL23Eco5f5RdG+T5uu/7mVXs15p6TmZZbRmmOMMjrBt88RBnpacp sxjmmEzQWHGgp0JKlJQk3H+17X5RE1OvqbQllr7s6cKegbz5L/ztkY0Jd1plngyB jDDqi4EAC6sZwg8m48pyAvnHVEZPTcqmeYeTNtKaWqziVnCsHAoJKhvB8AnxckS6 SzWKOltDyFvYAoG+aVjYfOPNGmqWFQni9MMtKS06NW2E2CnLfKO022nxbDu+TvB5 eWblafKMLedVgQvViylG5JFtg2qJ2ADKAmKdN8MkkOnJY4qxyKG0RY9FvwhY+re/ hKiuyEk1T5NEu1sTmpW9SjmSfGYsWi34QsfVvfwlQF2qs2/JSCVyqJcvuzwZCnmg sDEttOe/LETH3g2kHOaR+w/7x9qUuJmVZSVlARP664TfwFtrta424beWPcxXEsPN MolpiYddCilDSE3sLXOahyiNNItdTnm0vKcqdGbSyooUpdPKQVC4IST4RFtib/bH 12pTbNsda0eF3A2BwZJOIkAC2LlIjHMysnOPLemdHKm64s3KlkE78h8LkMzkMo8S Rp65dExJUCpBl0pdBbISFEG6SRrdx2A7ICW4NpBzmkfsP+8YJtybb4EzMrly4pw4 ywyGwcl26dw37Y3mao44FF2RmpYC1i8hIv4rLMaFRdS9Nyak3sHCM/0Fn+cBSuyE 4ZTRxl9wktqncICdt7L9hjmVQdAMurOyrn1R0jsnu20RlkYb2qHL+a5HLZaYDM3L vLSHA2tK8CjtsQbR5dbGOe3o05+VctCZWTqmlkixMy4dZXrApCxkbNqI+2O2JZDE o3IyIDLbOSUjIAcg88QuiNfp+klPcqZpktSy08pnwknYkG+LCm18VomXZ9KHFatA cRfJxKslR20cIxjZjKZlyHSmo0hyoyrtGk3JSblXVqddKQMSwU2IsTsIJ3bYqtaq TlQmVPTzi35kpA1itthHQ6823pXJzzzkumjqprbikBSbmaJBOXg2tg6fC8/Jplkt zVi5iyjy5RPN12dY6OoaBaOT1KS3X3HmDKTcsUNoQolYJUDmCLfJO+I6rVSVmKrI tJbc1y1BLaiBYEqAG/lix6CUN6j0qUrjk65NMzUvq0yikEJbuQbg3N/BtsG2IiuN tJrdNS0lC7qTxkgcXjCPZpxWLjl1XzROnPplWnHVtqWFqzueTxRxfSNWHS2tJd4w E8+AOT4RUW/SXStyQoMzQmmVBxeBYmUvYSnjA7LdFtu+OaYlzDq1qUpSiSoqJuST HHWzjLaOzeMTG659l2nytGqtORIMol5ZbClPNt/LGL2RSJZ5DUrw1YJpl8OoHhYu W2z7Yyvl+bnZdyYmHHQhQuXCVWF+mNGsKSuoFhsgM4QeKeLfxR0xmJi2Ju2/LLlV uLcS0Q2vjJBGYB2R1TseycvOSc2xMNJcaW6ApKthFopvY5rYos1NKNGFTCmUpCT8 mx2+CqOjyFJGiCuDCaE0Jg4y5h1eC2XKY5aeF526ZTtSKqLlWl9Lpmg0Kd4FKspS pprFZCboSo7icySfLF6pFERS5ITi0NcNfZSZh5F7uLtdRN+U3Me5ByXdZQ+GGluq vdwWKjnbbaJBLxUhV0WCRexMd8dPlmZlicrV9yeBWHl4ytAyO8Rq1Gm1qsSRfpk6 2wpxQKS4oggDI7AeSJVS2p19OFKEJPFNrERr1Wqu6PyRdYk1zgQoJCEEpvffkDGs qqbSOrktf0QmtH6tSxUFyz3DXzfVKUb2Um97gfOjr70lTqJSZiSkJVMu24C4UtjI qNhf7BG3VpiTmKNrppphtzg6lth0i4JTfK+/ZFR7Hjjs/onOPvqWtSZpSeOSo2wI O0+OOeGMYZVHdZm43f/W3mph1VXeYLhLSUXCdwOXtMV/TYuuJktcvHhDmDo8GL67 LJlpxc4EBesARgCbW2Z38kYdKK6iSpyG00RM0X2nElY/ushn4J5ejZGdXfCbdcOr iCkOqZU6tYISbdMda0EdoNSpsrIylOU3VWpfG/MLSAlYBAIBBJ2lO4bI46pJQwpv GSCb3jr3Y7rzU9Jy9HMiiUMtLFRnSsfC2UBa1htxX2nZHn0o+ZvKdkvp4UoreiYb GEomDn/maih9kaXM/XnkKwqcU02Lq6I6zUEMqbQ4C3MFoFQIscOzx22fZFN00qMt L6Iz04WGlTCNWAgqAWbuJG2198dstO5u+8MRkpvY5VJt6WNSbbBTNMtLxrAyItuz 6Rujsccb7HFT7YaYIPA9Tdlasd73y2bBHZI3H2c5IQhFQhCEAhCEAjjfZy+MUT9B 71ojskcb7OXxiifoPetEB22oGaCZjgjLLrheXcPPatIF053wnoytFfnqbU6ilCZi Sp5SkniiokXvuvqrjyW+2J+pTTcoiYW6HSFPLSA00pw3uk7EgndFdqVQYnJBxhtu dClFJ40g9Y2UCQfgzttbYduwwGorRibWHccpKKU7jxqNTNzjyX/dWzFx0XytlHp3 RqZdRhNPkR8EWripm+ApCSPue8X9InbnGAOL17K9dPtttoSgNok3wEpxIKgLNgG4 SRsFsWVrCNd8z7+EmfnxhKLYJKYSck2VnqzYq5bG14CckafU6cytqWp9NShS8RHD 7Z2A3NZ5AC5zyzJj1TEOom5vX6kOl5ZWllwrSk4W8sRAvlbdvj03V5dDSErTPrUE gFZp7wxHlyRHilKLkzNO6t1CHHlqRrW1IJGFsXsoA7jAUUffSr/rB71xljEPvpV/ 1g964yxmWZIQhEQhCEAhCEAhCEAjRqgLbCJxI40qvWm29FrLHTxSTblAjegQCCCL g7oCMadDFVbNkrZu624k246XMBt5128RMT7Uul2nGUeGtWMKA4fCJGMoVfcSnAb7 gd1oqkggIqUxTnbhDLChcnagkBJv+iAPGkxMSmkhfp/A2m06xlfwrwB44KR4ORFs hZRIyJzEebicMpqcf593TCY7t2XYU224XLqdbNkodyNvnEHbbZuytkcycayorJXf FvvHpqruOOBt5h5a0puhTmG5SfGq+E7js8Y2ZV8KKby8ujVlRvLTDllIO4CwN7jY QQTGcM8sJ+bv/Nv5/kmL6PCviTX1i/UmI2fm5ZhBDilFxPGSloXWLbwPFfyXj1UX ZpcohDWCWSh9xDyS4Sq+FBAScO+53XBA2xEBa8YYYZZbAOJ1QWVuL5BYJuM89mVr EC8ejSm8b/P92Z6vqX5jXLVN3anFpAZZBAKwTYZ36c943Wvn7ATIpdaSU68uWSdo bBQnErpOe3aSdm6MU7MKdSZJqml55RCgUvkKSdmJRUMQtynyboxyTT79Scamy2Zp QBW8CCAkAAoSN5vmTbfYi1r9Eb0uyXEZfBsIRZIX8lG0lXSrbh5LX5D7pjPCHVVJ xJAUCiXSo5hu+aj0qIB8QSI9zCBMvJp7QswnjTB23G0JvtudpPJfOJIAAAAWA3QC JnRb8IWPq3v4SohomdFvwhY+re/hKgL7NfF0/wCId9SIjWPwnp/1D/8A4RKvJSpo BV7B945HkSkxqILCH0vpaVrUApSrECQDa+7oEaaeaI1WUVCaNS1vBin+yhTqVFKc asnLbV2tYjLDYHMEq0paXqL2htJNLeW3MANIUARbVrUEuKz3pSVLHSkbb2Oz3USA fLKpwJWkrBC1BNsBAVclNtqh475RklqrJtJalZZ5tICbNtIdRstfIW5CD4oCQn04 JNtGJSsKgMSjmcjtiFmPu8p9af8AQqJFyaDyMLgWRe/hD+mIbhXCZ0JCMKWZsti5 uT8ETf7YCpdlJpadEJZ0p4hqFgb/AJrkcplEMzdSkmiSUl5CVWyyJEdX7J2sGiku XFYmOH8VHIcLn+8cxpstjnWQ0EpcU4nAo7jfIxw1J+Z2x+l32b0b0eo+jc0xNKea pylpW6rEpRBJSBsBO0JjzTapR52SZpFAmS+qXTiCFIUkhAyvdQA2qEQmkaKtS9AK kzWpwTUwpxC0rbUVAIxoAGYG8Hzxu6IU5mV0ekaqw0ht6YZwqcHhEE3z8wjcTPNE RFbE9N5c+0p0mqlfmEMTCm1CTU4hASgJtcgZ8vgiKm5KvuP6xSONblEdLrFOptfl 52coMoiUNMQ47PF4YS7kSMNr3PEXtttEc9cqDKV4CleLlsPbHky5ruN3TGuku6aO KWNAKO2r5LY/nFflaClqcYS62oLLicIxjPOLXoW0ic0NpV0gjUBQCvGY0Shb0/LT DagG2lpKwdpsb5R78fphxnq5V2QmOC6XrliLfAoNr33RH0Kg1SsPvN0mW17jaQpY K0psL/nEROdkmblHNNVqU0oq1CM7DkPTHl6j6QaJ0uSrMpUWmGam2lSAwtWPCUhQ CgU22HcTHlzrmm42dIuopU58qZYcaZ2LQoG/iiuoQ4pWoI6bRetJKK7QXWmJ0tOL eQSgtEkDdncCKwlDaJvEU7ozhM43ErljE7w6to8JWm0SQc0OUXqu5KtioodvZBwi 9sdh4V9hMTmkE1LompeUeXYvJNhY558sSdDo0jIaL0idlpZtp6Zk2VOLTtVdAOfl is6WOtqqMmsJOsSg4VcmcerTxmIuXLKY7Lxo2intUuXaZWrXgK4pvsxHoiQqDikM hKbWXdJ8UQeiklMTFFlZhtxAWoL4xJv4RHJGWlVqXqdWqNOWh1TkipSVlYGEkKKT bPo6I3MxGyUyMsU+mUKamnVKQlolRUbmwsNwj3R6mmoSzTkm4HGFA4VYSL2JB29N 43wzKT8k6wpgKYXxVoUMjFbqdIn2McpQH2pFKSNWMRASNp3HaSYkzMb9likTMoVO z2q08HBkFwppupzxgmy74MX/AMe223xxLuUiq0CbbpujcuFUZ4ayYU6tJUHDkbXI OxKN0UiiaSNCpOy+lYfqb4eSiSUAFBlVyFHMi1zg5dkdaS3NXDRdGsVsN8o5YRGX zf8A1qZrZWZdypJrL8tNoSllDd02te/F5D0mI7TWt1GgMSrEuUIE8lxCgpIVisEj Lk8KLKtrgNYfdnbOgpCeLmb2HLbkinaY1WQrzkmlphwGUKx8KkDbh2WJ+bG9Waxa 0tPLPKoUeS0dlzLKTUG1odKsgF/Jy5Om8T8o2zLy6JdgnA2LAHkjCpRUbk3glRSb g2jhjqcs7Rs9c8JE49d03IVWZpzb6JcpCXwAvEm+y/tMR+kzVCmtFZufqLy01EFC QEhWHDjSNwtsJjE08b2USb7I163IOVOkPybRQFuYbFZIGSgd3ijvExnFvHqaeWnN Sh+xnNlzTnUNKBlUMOFs2z3R2yOM9jGS7W6dzUvMBK3BKrQgozAViQb523Ajyx2a LjNuMv/Xv8IQgEIQgEIQgEcb7OXxiifoPetEdkjjfZy+MUT9B71ogO4zDTS3X1OB XFdWclK5QNgUOWNbVynI551/1xlqBmAmY4M2ytZdXcPOlAAuneEqPJuiKxVXm9N/ bHPcwGVuo0V1YQ3NJUooDlg4rwSSAfD5UqHkPJGdLtNW5gS7iX80OKJ2X+fyZxWk 6MFDmNMlIA4Ci3DnbWKcJP3Hb/ONxilzkvOmbblafrMJSkGccsgE4jb4HlJPlI2Z QE7q5Tkc86/640GZhp+eeS00UBlam7lajiyQb2JNtv2R8xVXm9N/bHPcxrUsOCbn NbqtYX1lQaUpSQcLeVylJPmgKKPvpV/1g964yxiH30q/6we9cZYzLMkIQiIQhCAQ hCAQhCAQhCA0JynB+bTNthBcDZaW25fC6i9wD4jfcdpyMeXSxNPIQ+hUtNp+5lRt flwqB4wyzF725IkY8uNoebLbiErQralQuD5Io0EPPSuJp9OuYTxigAhSdgKk23W2 4bEbLZxKSc02tuwc17JysSAtHl2HbexAI6bm8YuSea+4uF1sG4aeVmk8qV7R4jfy RqNTTaZjVupcYd2AqThWn+RF+S6b9OUc89OMo8NRNJuvOU6SkZXtgGlupW4plTiQ VLQoICQm+ZN0qFt2cQDMyt1CW1KUwleZbl0lbizyBSeKgDIctrZiNt1uemJ9KEzD WrabCkrIJtcq2J2Z2zz3A2yjyS0hxbDZdnZm/wAIhKsKUn88jdsyNzbYLRNHCcMO WZvr+5lNyxpc1Lamky2obTxlMhYvy3WU4jycg6TGDhFRqqAzJsMMS2wTCgSEZWu2 QRiPIRl0xIt0wOAGcKXEjwZdAwso/wAvyj0nyARIR1Rgk5USkuG8anFk4luKAutR 2k2jPCERCJnRb8IWPq3v4SohomdFvwhY+re/hKiqvs1rhKng6W1O656wcUUp8FN7 kAnZ0RD2qvJTeuc93ExNOhiVLhQ4uzzwwtoK1G6UjIDMxD9sD+L6l+xueyNNI5yg LdeW6qVpusWFBSkzDyScRJOxG+58mWzKMiKQ+3OJm0S1LTMJUpWMPO3JVe9+JntO 2IlVEUmSXLSwqrCXGylZTJPcZRSkXyIyyOX5x6LekUyeTNOvmcrRLjqFfEXskJxc TbsuomAsNqryU3rnPdxpyaVJmV6xbanDPKK9XcpB1OwEgE7t0bnbA/i+pfsbnsjT kwszK1racb1k8pQS4gpVbU7wcxsgKz2TJ9p7RhiQaU05MNT+NTaVArAwuZkbQMx5 xHLkuKxJUjJSDfi7o6f2QaM3J0pNbShQdmJzVFZVcEWXu/yRzeTlV64odTZTygGx faT/AP0R5dWZ5t3ow6RS40mnivaKzc2qpPPVRD+rZpqV41vJGAlQRfEbXUch8mJ/ QKn1mm1x5U3JTyGODKSlD7S0oBxJOVxa+R+2GhdEaoFal25xCma2VLXLtFWIKbKC Cbi6dy9p3RbdNK5UKJQmJyWLaZhcwlteJOIWKVH+Qi4YxEc89jKb2ciNPqUzO1Nq QanHUuuKS6lhClWuVWBA8u2PlA0OVNaVytMnzMyynAokON2UAEKIyPiiw1LSaUoC 5R3RiZC35wlU8HW1EBQta2IDepeyIuWrWktX0zl56SbadqOEpbFkpBshV9pA2Xjn FRMRbXa3SqJUXqFNKo08xwSlyjZQxPzF20vKuLAE2SSQVGwPyYnJyp09ukT09T5i UmxLMrcOqcSoXSkmxI2bIrGlshpDWtBqbLqlUrqaX0uPtpWhITZKwc723jYYn6Vo tTKfSJ+npS6lqcSpDgK7kgpKTY7sjHqx5omuzlNdXISBp7p9LcISJVt9BQpTIxBO FCjv8UWxegDZAYNUm3W2uKhKhcADLIbosDGhlE0eUKjKJeS6z4JW4VDjcU5eIxNN Sz7raXZdGLGkKJuBkc98Zx0rj591nPwqGnlbUyz2tl6WxNvTsuttBCMTgUrigJAF 73OXTHGZlmbknuBT8k7KvgYih5soXbdkRe0dh0+pVXl56TrNIlwtqnNGYccUtNkF BxXsSCdm6OVV2tv6RTpq9QWlU4UhslCcIsNmUc9TrN/4ax6bO0t1ISOhWj5xIN5N kWUq392mKdpk+ibnZVbK0qQlshSm1XAz32iQn3CvQ2gA7BLNW6sRhrVGblac8EoU Hii6AVXvHqjo5SsuhqpOn6NSc/NVNtlHHSdc6EpBxqG0mIWZr0lpBW35UzUrIplp hRafZdSDNcawzvxr7cuWI2rIQz2IpUOXEyHuMn/9ivJsjSplFo1bZpZ0bU5NVSWD TtQQpRQGzYXtjAB419hMcdSZmahrHys+kOmE9ovUG2xIJWdUHcLpUm9yRs8kYJTT jSKopTUmNGXHUO3ALTTikm2WRA6I0uydTa5PVRE8mWSqWalEpWsLQLWWo7L33iLX oEXmex7TbABwF24//auJ885zjdLtEXTn1SpVKplXp0xK1Zqbem38b7WsSSwrEk4T Y3GaiM+SL1ppRZmoqVUJGZmy4ywEJalrkKIUTu35xVpvRik1ertP6MB2aXLvldRx LKdWSoEWx2vsXsvs8UdSVNyVPp700t0olmuMtZBNtm614mGETzWs5dKVWRqE5QNB Kc9NyqlzRdU2tE0CFC6lkE3z2AeSKU85rHXHSAnEoqI3C8XvS+dl6nolKT0m5rJZ 2aGBeEi9gsHI57QY5879xX+iYxqdoe/hYjknLu0JuqBl0JaCHElN7hV84SlUDzpS 6ENpCb3KrZxCwjjbj/qM7tbEqsQoZ742DMANFXFxfNvGm2bMo/RHqj4Tc3MbjUnD o7cRGOVX1SGiUigaXGdxnEtC7ptlmI6RFC0T+/ifq1RfY76E3jcvna0VkQhCOzkQ hCAQhCARxvs5fGKJ+g960R2SON9nL4xRP0HvWiA//9Do1SmkSiH1rQ6vE8tIDTZW b3SdgHRFHlpEy/BEpfqCWmFIUpluQcS2spw/JvlfDffnnF1qGvXUZaVlUNF+bnHW gp1RCQAhS87An5BHljFVZCoyVOebxsieU0vVFrjJSq3F8IC+fLlAVifQZt9b7Kp2 VdWhKS43IOY8iDkSchkRYW253yjCzLvMuuK4bVVtrdLmrMo8kAG9xxVA7TfxxItj SJopWVsvpxEFDiEoVY4M+Koi4+E37/EIzoTWnpJ5LrrUvMF1vAtpAISi6cYzJubY vOICElpN1hDCFztUdbaUyQ2qTdw8Qg5C++1s77c7nOJ2l4lTMy6ptxtLry1oDiCk kYWxexz2gxrF3SYuugMyAQltBQopVx1G2JPh5AZ59HTEhJrm1qBnW223RjADZuCm 4sf++aA56PvpV/1g964yxiH30q/6we9cZYzLMkIQiIQhCAQhCAQhCAQhCAQhCARh mZRicZLMw0lxBzsrceUchjNCAimaMWVqQJ+ZMsUhOquL2F8se22fj6YkWWGpdoNs tpbQNiUiwjJCAQhCAQhCARM6LfhCx9W9/CVENEzot+ELH1b38JUVXQHSEs3JAAdf zP6KYjNez9K36QjfnJdE1Lal5Da21PukpcTcZBJz80RnaWl81keo/wCMaaRq5uoN zy9WQ4wXBYrLdkpsb2AUCc7Zk79mWetKVGvLn2hNS0oiWULOEOpOHM5jjXzv07Im +0tL5rI9R/xh2lpfNZHqP+MBk17P0rfpCIqTIVOvEEEGoKzH1MSPaWl81keo/wCM YBwVD7TEohtKGZkoUG0YU4tWTkLDlEBQuyTpDw+mjRtlDjT0pOB9TxIwqBSvID/O PNEXojoy/pNr5tqZQymlat1xKwSXAbmwts8A+eN3shaTKmi5o6420hqVmQ8HcXGU SkmxH+c+aLzoFozSZCl1ASVYRNqnWGw8ErQotHCrkP5x28kcJx5893bGaxe2tIaT NUd/SztWrXSKwwm6hjsbDI7LfCH7YqmmSarUaGxWlVBXa+bmEqZlFbWrpVbPyHzx a9H6dM6JVVigysu9NU+ZKph2dU2QG1YSMNxl8hO350RmkOiejk/V5qYnNJWJV5xz EtpTrYKTbZmbwyjKYpYmIUOmztMlZCoIqFP4XMONWlnb/cVWVn5yk+SOl9jKlU97 R9msLlGzNoecSHD4QGz1GKXN1SY0zm5SnrltVT6cvUvTjN1JQ0ohJcWdiQEoJuct sSM/2NKYxQnqpRKu5VXGyA23LhLgWSoA+DfYCT5I54ROM3EXTWU39rXnSusGgyaZ 1YW4048G0tpNiLgn+UKdSa5L0ycYm6xr5l1JDLtj8GcNgfPnEZoNooKQ21VHHH0z L8uUOMOIw4LqB8fyYmapU31srmmpfG8w2pSG03ONQzA8pyj0Y3l82TnNRtDWQJqn URcpVJgzz+LEXdlxcWEScrPGXlWVAKwlCbAbhaKyt+f0gozip+QdkishJBQoWAII 2xZqWuQokhLmbn2GEqZQhKn3EoBsBsuY3jMcqT1c77LlVqck/LSspOuMy0xKuB9p OxwE2IPkyjlFPbDroQvjN2PFMdD7MNma5SVpOIJZUo+RUV8aTuTeifaJxhpEtrtb wjEb3vs5I82rO8w6YRs6BpLIlvQfRtUuoNky7d7cmrEaU8xPLYW5MTmsCU7DG7XG 0S+g+jiisBKpZrComwPwaY8U51dRu6pGFLZsSMxHqx6Q5T1aGk0qo9ipl4LABfGX +dUVrsbSFSqNTqDVJn+AOttAuLtfGMXti4adJLWg+MAlGuTZW7ad8clo1VLNabJS jCHk3JOwYo4an1N49F900mK7RZsUyfqy5vXS4cJGQsVKFv3Yv+hIX3tqa9izKnP4 q4lzXCuiTVRpqG551m4Q2yrHiULZcW+ecR0tUJ2pyiJybkVy005fHLlKgU2Nhkc9 gB8sawxiMtpSZmYUTRzSFmgTtYZLC1uTzgQhaCBgIKxc+lFxkg9TtEKg7WXe2DSF qUtGzEmyeL543KppQ/LiXl6PLN1MO3RNFglwy+wDFhva91bfmmMqplVC0ZnpxpId UzdwJVkDkBEwxqJ3uv5/lZm62QFXnJWd7H1NekZbgsoqaOBm/g21gP23Plimu/cV /omLVIVRXZJdNHnUJkm2U8KDjRxEkHDbPdxz5orwkHX1zTEo25MIlyULU0kqwjMA m2zYfNHHL5qmHv4bKsZxlTYRM9pW/pleaHaVv6ZXmjlTl/p9Tw3R9xb/AERCPakF tCEkHIWF48RMurep9Sc0T+/ifq1RfYoWif38T9WqL7Hr0PoeHW+ohCEdnIhCEAhC EAjjfZy+MUT9B71ojskcb7OXxiifoPetEB3CYWWpvXICQ43MOFCikEpJFri+w2JH iJjDMTT80oKfcxkbDYRknfujn17n8orixpAyHS0uWfu6ooDqbYUFSrC4I2JCNuZu c8oDZrLMnM0/g086G2XXEb7ElJC7D0YgXJICVmkM6SPB11YLZK1hLSdmEAHZs2W2 brmJqXTVHKpSUPavXiorw8HugrZDDtwLk4VFOIA3FiRmNsdMkEPt06WRNKxTCWkB 1V73XYXPngOdUZAcbcYZm1zq0qU4VKzISTkD/wB8kbTySzOMtucVa21qSk7SAU3P 2jzxb6+l9dNcEu820ux47jRcAG/ihSfXHPQ1MN6QSeumW3gZR/CEypZtx2szdar/ AGQFGH30q/6we9cZYxD76Vf9YPeuMsZlmX//0dSEIRhghCEAhCEAhCEAhCEAhCEA hCEAhCEAhCEAhCEAiZ0W/CFj6t7+EqIaJnRb8IWPq3v4Soqr5OPplpQurStSQ88L NoKlG6UjIDPfEJ23a5rPfsq/ZFgc+5jIGzz5zF/kpiAqNdcp7xSZMupS2HVKQ2m+ C5CiMrHDxbi/yr7o00r3AECoJmkv1RATMLd1aZRwDCpeMpBGeZKr8t9kbUsFsTLD i5mrONtYboVLvcchGHMkm+fG8ZzvlbZZ0yaeeS0JWyy400cSUAYlLwnaBe178pzy Fo25jSQSjuB+VUAHgySltJAUblOdrZpGI55YkjO+Qeu27XNZ79lX7I15LEp8uqbc bS7PKWgOIKSRqbXsc9oMZJDSduemkS/BVNLcPEC0tE21aV3IBNsljLODT7j885rF XwTxQkAAADU7MvGYDjenqW1aaVIKvfGn/QmLzozJaRaPMCYlRLplnktrexEKOBIJ y6bExS9OZZTmmdSUFAXWn/QmO0U6YYlaEhb7AeSmWSSkgG4CcxnHGMIyymb6O3NU Q0JTTlus6d06l0pZMi+youBxuysYStWR5MkxzjT1p9WlVSQ1hxCYzv4otMh2RdGZ WpNPS2izbL6QcLrbbaVJyINiBfZfzxStLKn21q01UGUrZS+9iCScwLbMo5amW0Rd zbeMfbZ80Sq81TFTslMFIkJ4oamwlN1FrjBWHkNlGLlS61MS1QaoWhyk8EXdbYmk 8bFYqVcnxRSaE+yqv0ttxgLQuaaStJAIWMQuCN8dcbq9DkdKmabL0JhqaKSpMw20 hOHiknYL7AR5YYc096SapPLeqLFClVPavtiSA9bwdh2fZEI1MzL0u6lgp4UQQzcZ Y7ZX8to2OCTtNqj9am55c1ITN0NSZUohomxBsctiSMuWPoaSJN+TbARMzCShp9Is WlEWCgduRN8o9cXTn3azr1dZ0fdZntRw3EDxAMNsQjYnKRL6SUeQYmgpTjLaVKwq wjFhAMaE1Q6nIaNPibqi5l9KgdapaibFQyuTeNqcoVSqNDpqafVFyTqWklxxClJK +KNpBzjP9G8Wd1D7LimHqnT0oxZsKGfjiqaP6PTVcdTTZZKSSFLspdtnTF17K0qG 6lIOWTZLCiRbbYxA02QnJfR0aQyc4qWGtLOFpRSvk2iPNqT88umMbLtpTLpkdFaH I1XJEs2hpAbN80oA2+SNDRmdDlEqCEH4cqGruMtkblbbd0h0YozetIdbaQpbjhKi slAufHeGgMkioszDyEoQhp0BSCnwso9kdHKWppi5MOdjlDExhuHkk4f0jFJ7GWi9 O0irVWaqCXFCXbxt4F4c8W+OidlSnra0LdUysNjXt2CBa2fRHItEZqcpVZKmZt5s vLSheqcKcQxb7bY5ZzEZXLUW7jISz1CpL8jSAkPuLLjYdOIYiANvkiSknJrtc2up YO2Wet1fg7Ta3+W0bGvZkqU/POsJcLNzsF7ZbDFOrGlKZ9paZVt6XWSCFBdrW8Ua mccG9PSz1OjLXSdC5uTNH4vbRZ4TrePfCU2tyeGqNvSGry4oU5TLq1z7d0jDln0+ SKdMzUxOlszT7r5b+5l1ZVg8V9mweaPLjrjysTri1qAtdSiTaPP8TrEdHrx4TeOa W3TJpqgUhiZpZIraipuY1gxN6sknLpyR9sWGiVPR6kszhQZgPTqQX7pJBVY3tyZq MVCEZxynHo6zw2E+W3UeBcITwDHqsOePbiuf9o1IQjMzbvEVFPrii4ADu2RhIsbG MsfLA7omUXu5ZaMTHy7JfRP7+J+rVF9ii6LACtJy/u1Reo9OhFYvm8Tjy50QhCOz zkIQgEIQgEcb7OXxiifoPetEdkjjfZy+MUT9B71ogO3Tv3Rz69z+UaMw+3Ky7kw8 SG20lSiElRAG3IZmN6d+6OfXufyjTcbQ60ttxIUhaSlQO8HbAaaqjeapwk5hCFvT RYx6oLUhRbWQkJJGFRICcyLYje0WeWpVWm5VmZa0gBbeQlxN5IA2IuPlRX5enyia jKPLQlDLUyuYdAuCpRbWi4IzCrqBvutlnFuZrcgwy2y0kobbSEpSAbAAWAgImq08 yVNecrlaDspbZ8WGK4tdQV9kVKUepC6/LppjrTqjKvFzDNl4p47VtpNtv2ReKtX0 GRWZVl1161kpQQk577m0VFL89OVmWdmWH222pd1N3nUruVKbOVj+aYChD76Vf9YP euMsYh99Kv8ArB71xljMsyQhCIhCEIBCEIBCEID/0tSEIRhghCEAhCEAhCEAhCEA hCEAiZ0W/CFj6t7+EqIaJnRb8IWPq3v4Soqr7NNF6VLYdcau89x27YhxU7Lgjo2R DKp6UpKjUakABc/CN+7iZmtcJU8HS2p3XPWDiilPgpvcgE7OiIZSKopJSRTSCLH4 Z3+iNNPipFCVFKqlUQoG1i63e/Vw4E0CB20qGez4Zv3ce1CpqKiW6bxhY/2h7MXv nxM8+WPgRU0owJRTQmyhbXvfKuD8jpgHa4fjGpda37uNOTShEytCC4rDPKBW4oKU o6nabAD7N0bqjVlrKiKbcm5+Fc93GlJpUmZXrFtqcM8or1dykHU7ASATu3QHKNNS DppUkkgWUn/QmOn112fptBp6ZCQdnEPypDykoUrVAJTYmwy2nbyRCaSaPUzSOael aNK//kqHdbNOuOKSlTIBFhc4b5t7Bu8cWufrTWjVB4NW1q1j0qW2NWnELpTY3t40 xxiK5punbw4LNAszSUJGIFN7+ePK+OgcvJGk/VWluApUrFawOGLVoQ9o8upLXpGw 4/KGXOEIKgdZiTY8Ug7MUceWYjdq4mdli7HdIaqs0/PzbypZNLWy8CQAlQuom5Ow cT7Y6ZUqsmXp7tXpJbqL7dg2yyrGF3ISfBucgSfJH2T0XpknKKbpsoGpSoNhL6S4 o40EZDMkjJR2W2xty1Gp1DltVLS+qaScVgtSsz4zHo09OcYpjLK5akppA+/IMzM7 LplXXBdbayU4TyZxFVCUQzo5VPhMzLOnP9AxtVySfqkuGqaEh0OBZxm3FsRv6SI0 qjXKNS2HJWuBxSX21CyEk3Rax2ER0y2x3lI3nZStGqiqaYb0eUlKWXlKUXgeMLDF s2fJif7I7bctozRGS4MLdkBSja9kARAU56kv6eyjlEbW3TMChhXe+LVqvtJO22+L zpA7ow7ISiNJJdx9hJ+BSgrFlW/NI3csefGJnSmJluZ+e4a+m9aq7FJmpOXo7r0v MSjqHXktrIaBSQTcC2w3zjnNO0blZnQsTTM4pyqa8p4CixXhv4WEca3kjsOkzrrl PmKewqzs1LuNIBAsVKBAud22KrolSafTHk02bY//ACQBS9YlaijVndtw7OiNamEz lv0TGYpl0nlNXoRo40sqS4hhtKkkWKSGxcEbo2dCaazI6xMu8XwpwEkWNsuiJDS2 mTM9TpJpgJKm1ca6rbox6IyT9Np04tzClwLCkkG9so7xtDCn9lWh0t0zk521R2wU 40FSYWnEkYQL4b32AHyxT+x7PTdEqVQMjKKnCtsIWAknAAdptHQOyVR5A6OvV8sf +puvNpW/jVmBxfBvh2ADZFJ0Ekqo/PziqSpCPgwqZxEcZF87XB6dkefKZxyqO7eM XvKen55U++l1SAghOGwPSfbEfMy4mWS2pRSL3uIsFSpGGnv1SUbSmSl0/C3Ub3G2 wPQRECw+iYZS63fCq9rjyRyziYnd9TTy088eXH9EeqjICCQ6skDIWiM4LMfQO+gY s8IxSZcPjPTZVlsuti62lpGy6kkR4i0PMNzCAh1OJIN7XIzjB2sk/of3j7YlOOXD Te0q9CJWbpSi6ODISEYc7q3+WMHama5E+lCnKdHOJqmjCNxdMmW21LUE2SCTnGnE YyxnHrC0aAfhQj6pfqjq8co0A/ChH1S/VHV49eh9Lz6nUhCEdmCEIQCEIQCON9nL 4xRP0HvWiOyRxvs5fGKJ+g960QHaJ1tC518rQlXwitovvjX1DP0TfoiNqb+Ov/WK 9cYYDHqGfom/RENQz9E36IjJCAx6hn6Jv0RH1LTaFYktpSbWuBaPcIDkz1RlJas1 dt53Cvh7xthJ39Ah25p/OP3FeyNoffSr/rB71xljMsy0O3NP5x+4r2Q7c0/nH7iv ZG/CCNDtzT+cfuK9kO3NP5x+4r2RvwgNDtzT+cfuK9kO3NP5x+4r2RvwgNDtzT+c fuK9kO3NP5x+4r2RvwgNDtzT+cfuK9kO3NP5x+4r2RvwgNDtzT+cfuK9kO3NP5x+ 4r2RvwgNDtzT+cfuK9kO3NP5x+4r2RvwgNDtzT+cfuK9kO3NP5x+4r2RITSTIhgz XwWvvq8eV7AHPkuDcX2jZHyM45RlFwsxT//The3NP5x+4r2Q7c0/nH7ivZG/CMsN DtzT+cfuK9kO3NP5x+4r2RvwgNDtzT+cfuK9kTmiFTk5jSaXaaexLU29YYSP7pfR GlEzot+ELH1b38JUFXqenGZOVLjyjYPPcVKSpRuEgWAzinVB+XnZhx5tyaYWpkNp cRJrLjZBUQUq3XxZi2YFouEz8r61f8o1400o6pfE4pRq1TsS2op4K5bEgp423MnD vvu5I23FtOSsm2uZm1vy5UeEOSS1rNzfK5sDkM8zkLWi2wgK3Sp5qnMOIdfnZpS3 CtTi5VeI5ADl5I2ZBwOzCnAFJDs6paQsYVYdVa9jntBibjG54bP6f/iYChaXUipU txzSGTqS5fhT+owsrUhYFjtI3XR6osenGkNMpej9MRUaWmeempVYbcWlKihWBNzd Q3kjzRg7IKFdxMmq2XDzn5HYgOyIszVKoessNWw5bD+ij2RwynlnKvs7xFxDkMtL B2ZQqycOYsR0R0F3RRdN0TkKzrWSiZIQEJRZQuFHM/5YoySC+lasrC0TLDxDCMdg 3bJXLHLUm+rWEVLrleq82iY0UalpqYYQpaUuJQ6UhYu3kQDnv88WSY4RMSi/7Qu5 ttUeWNCZrkg7o0H6bNNTDsnJlbidoSQi4B2ch80Y9DdJ5WsSjKZiYYTUFrWEsN3F wBfYb7r749OMxE9ernMDapguqZbmHELQM1hRF4+aQUuXl9HKoZ1hiamOCOlp1bYU pviHYTmM88ol6rNzGbbbaVYV8h5PHHtQTM0WfbqB1EutlaXFpyKUFJxHO+wXjplF wzDiehDyZLSaSmHU61pBcu3y3Qofzjo+kOjb+l8rLpk5lEoEK1tlA7CMhlFJl6ZS 2+yVKStLmnJiSLajrSoE31aiRew9UXLSDSaY0Vk5YySWHCs6s69JOQHQRHnwiI05 5nSfqiktNVlmUqMoxMMKfW6sBCzY4c7b4+jRqYmtK+6NmaQ0zqdTqQDiva17jKPD +j9NVWJCYRMPlbLiVJGIWJCgc8oqGmOkE9QOyOuakmWXFiWSkB1JIzHQRHXUmIiJ liIt0WaZdaSkuOlYJyuTEG/LzXbuRfZm1tyjZ+Gl0qIS74wMj5Yw1JiiVuhUybrk +qUcebS8Q0oJGNSQVAXByzi5zTSG069ail1AuhO4xfq2Oihdll4d7tbjacAMw3YD K2Zir9hp4NzdWU4CsLlE2B3ZxL9kWoVuo0x+nTEi2ijhxtSJlCSFFVr2uSRtuNm6 IPsVy4kZjSNxvESmSJGLoJjE5ROdd2qmItYq9pJLSdGm6LwRRXNN4gtNgkXyzH+W JjQWjST2jEjMPSks5iDl8bQJ8NQ3iOK92tW5tKegr+qHdrVubSnoK/qjH+5z80wc +MRUSk23X11ubZ17mHhJSkYjZIxEbIvSdGXlKCeEN59BjmXdrVubSnoK/qh3a1bm 0p6Cv6oxjp5Rdx7ukcTOPSXUBoq+XCjhLdwL3wmKFN6Tsyk8JVUu4pRcLeIEWyNr xGd2tW5tKegr+qHdrVubSnoK/qizhPbH3aji8vPsuEIp/drVubSnoK/qh3a1bm0p 6Cv6ox8PPw7f67Hwt5AUCCAQciDvjFwWX+ga9ARVe7Wrc2lPQV/VDu1q3NpT0Ff1 Q+Hn4SeNwnrDo2ibDLdcSpDSEnVqzCQIvscl7H+kk/VNKUS0wywhstLVdCSDkOkm OtR6NLGYxqXk19SNTK4ghCEdHEhCEAhCEAjj3ZvacdmKLq21Lsh4nCL2zRHYYo+n nxhn/BP+tMBfpv46/wDWK9cYYzTfx1/6xXrjDAIQhAIQhAcwH30q/wCsHvXGWMQ+ +lX/AFg964yxmWZIQhEQhCEAhCEAhCEAhCEAhCNiVYQ4l110kNNJBOHaSTYD+fkj OWUYxcrEWxNtLdJwiwG1R2CN4hmnJOQcmyMsQybPLbl6PPa1jsuNtSkqlzWrDxSF JTqh8Ek7wMW05ZnPyi8RhTLE3LzxJ/8AiH9UeXHU+Pvvy/lO/wD5+/77rl/MmGzN U0Leu4C8oKKjmSQk/wAtsRaEvSyw0khST4KVGwI5Adx6NnJbMCYniZajtBoY8cxn rOJhOHIG19v/AHdEWvhLiClUuwQf/mV/THbQyjLGa6XLOUUytvJduBcKT4SFZFP/ AHzRkiJYmJibUptbLQdbJLbgeIKk7lDi7Dl0H7I25SYdW46w+EhxsixSbhQsDyDM Xzy3jljuy24QhECJnRb8IWPq3v4SohomdFvwhY+re/hKiqvMz8r61f8AKNeNiZ+V 9av+Ua8aaf/Uv8IQgEY3PDZ/T/8AExkjG54bP6f/AImAPSErVKWiXqrWukkvKW2g KKbLuoXukg7CrzxznsqLMsxS0S5wthLwA25AItti7VmuuUujt6mRVNr4QUlCF2IB KjfIH/pildlp/hElRF8G1JU28SPGG+iOepXLPnZ1wvZzXRelzmkVal5FgIWXSsAK VhBsgq2+SO+U7sd6OtUCTaqdMC5xKQHSmYcsVZ8irRybsRpLemdPxJtx3uMRa3wK o6lXqu5odPv1tc4qrNTDmoTTVPYUsXGLEPC2YLeCPC28ufl+qYWLqoSU1ozSKbRK hK06U1Tk5LLbF3FqBOEhO0m3hRzvRinTlD7IMiw/hSEpWohJxbW1RbGa1OaVJNUQ w/TkUgCYMqFlQnQeNgvZNvAtsV4Wzlq07pdbTlmsOUbUJbbwmWU5a/EKb3w9N9kY znG4mFiJ3t1AIXNPrwWJOeeUas2p+Y0fqcpiBmH5dxtrYBiKCBfymPclNcNpEtVW xqBMgHVpV4O3K+V9nJFemqs4pSZBsKS5NDVpeSvNsqyBA32vfaI9XWHPuaL6HNU6 jpqE9LI7cNrVheS6ogJOWy+HYTujSnVUvhTw0qbU/KhxXB0tkgpN/wA0g7OWJaQ0 ZqclhnJjSSbfZQTil3AoJVfLO6yNpvs3RXOyZhFLp+qshetOJaMiri745b46fSmt rWF2cmZerSLDjnHdcSE2A+cBGHSR7RCXqyl6RSrrtQwJutBXbDu8FQH2RJ07RhVA mmk1CqGqOrcStt2YRZTdjsF1K35xR+yJLOTWmaw0FO/AI4iU4t0NXKsbmDGLl0nu dodZotPWqTLkmWUOS6S4tJCSkWvY32W2xE6E1yer9OnX6vMcILLgSk4EpsLfmgRS NFperVSYfk3dK52ntSyAENqeXhSAbYQMYtaM/Y8rzzAep3a9xbc06Ap/GbN5bxb+ YjnGpE5RPRqcaiYWzT9+XVoitloEAPIIB8cc90Kr0jSn623NKWC/LqaRhTfjXMdF q9NarYXS3ZxEm3cL4QsAjLO1rjl5Y4vMSyZKv1OWadDqZV9xAcSLB0JURfy26Yat 458xjUxTR7VufNT6UO1bnzU+lG13RD8Vj0v+MO6Ifisel/xj082HlyqfDV7VufNT 6UO1bnzU+lG13RD8Vj0v+MO6Ifisel/xhzYeSp8NXtW581PpQ7VufNT6UbXdEPxW PS/4w7oh+Kx6X/GHNh5Knw1e1bnzU+lDtW581PpRtd0Q/FY9L/jDuiH4rHpf8Yc2 HkqfDV7VufNT6UO1bnzU+lG13RD8Vj0v+MO6Ifisel/xhzYeSp8LF2OZFbGlra1J AGpWMj0R2GOS9j+sCd0pQzwHU3aWcWK+7xCOtRLieiSQhCCEIQgEIQgEUfTz4wz/ AIJ/1pi8RR9PPjDP+Cf9aYSkr9N/HX/rFeuMMZpv46/9Yr1xhgpCEIBCEIDmA++l X/WD3rjLGIffSr/rB71xljMsyQhCIhCEIBCEIBCEIBCEIBEpKN2ZUggWwp8LYXFq BSD0WF/IY0JdvWvpSQSnaoDaQNw6YlJdQWiYWqykNLBVbYtRC8VvJe3iEeTis6io 7f8AbphDUnJn+3k2KkIAQUqOZG8E+fOMK2hKkKVZZUMTYIyIOxR9nn6fOwa93jKU SUg7zynoj7iMw0oKN3EXUk8o3jybfPG8ceWIiOkbT/P3SZtkdSHqIoOXVimONc5n i8sRK3HPipUdavILGXE3q8YGXjI5Yl//AGX/AOx/4xEJb4SpUxexB+BVa9gN/lz2 bRaN6P8AV+cpl2fHWQJlsIsjEjCg2ySpN8Nh4iryCMKHDeYmSnAtp74QcicCcXk3 9NhGd1zGwl0jCtlwFYvfDuV+6SY8JSW5mafQCSHAFJA8JOBP2jO3lG/Lsy3oRrya gGtUCDq8kkb0fJI5csr8oMbEQImdFvwhY+re/hKiGiZ0W/CFj6t7+EqKq6zS161a EISbOKNyq23ydEa93vo2/TPsjYf+MO/pn1xjjTTHd76Nv0z7IXe+jb9M+yMkIDHd 76Nv0z7I+EOqW2VJQAlVzZRO4jk6YywgNinSTbTXDmlLU+4paVJJGEDEfYIr/ZEp lCnJSUXXJ9yTebbeMqlCwnWKsm4N0m+YTybYtNN+Ip/TX/qMcw7LjFQmpugsuPtq 1jjyG8rWuWxnYeKJqfS6Y9XjsaUCWfpDtbcW8JqXmltIQCMBBQnaLXvxzv5Ik6/o xRW1LqlUnJiWRMOWxY0hJUQTYcU7gYldEaS9ojRXqZVVNvuuvl8GXJKcJSkAXISb 3SY57pzpHNVKozNJU8oyMvMY2mlISMNgRtGZ8I7THHKMccIiYaubt//Vv6p2j0KU lVTU+lltxsFpTh8IJAzyHSPPHIeyFWpKp6TOOSUy0+wppAxovtEbSWa1phSH3n5x lbFIYKsLgCDhKSSE4U5mze+IKk6OitVZmQlw2mYdxYVOLUEiySrO19wO6PLnq81R W3Z6Yw+7q9KmWZfsd0Zx1wIQUpAJ5bKiv6NuJqdQl5l5QSWJhFsGQ2g53ibqNLdl tDqfRsTevlVpC1AnAbBWw2vv5Ip+gyZ3hjaFPILaplsLFtouL7o9WPSHGerqVSql NfKqWZxHCnACGgeMQM/UDFF7JkjLytGpi9YsY3D4RHzfFFznaPSUVMT4lFdsEJsl 3GqwFrbL22E7oqPZbYcfoNIDakghw3v+jGNS+Sbaxq4bdMr83pfIzU+82zw2TBEs 0wkhK1WuAQSSc7DIiIqj1N+T09E3pAhuQWJcpIIIAyy3mMchWabL6Q0yW0ZYfkpR +ZbTMtvAKKyVgZElRGXIRHQalohS6vPmfnpVLpKQg/CrSctmQIEc4vOI5Z6NfT17 udJoEpNaQVSf0hcekaZNPrdkZhKgkPhSyQRcHLCQd0Y9GprSLR2fao0/TES7NQcB UXUHHYC10kKt5xGhpRWJyYnXqQ69ikafMLZlWsCRq0JJSkXtc5ADMmJuqaWyukmn 2j/BkTCUJJQoOoSL3N9xMc8Zjm26/wAtrK63Wmb0ekq+0afNOvoQSFktKAVceMGO Ry+j7x0uqNNkGXn2WJtbKlZFQQHCm53Xt0R26QUEaSLbUDqwjYPEI5/WtJaFIaST Y0ek5uTqCJxYqLrgCkvWWcWEFSrZ3OxMdtaIq5c8L6Qren9FlNFK2zJSTjriFyyX iXyCblShuAy4ojc0L0Qc0hDEzPtTLVPdQsh9ogAkEiwuDvBiG7JulElXdJJealWp hCESaWyHUpBuFrO4nli26F1Wq0nQqQqUxNJVRPhEol20JLgUXFC+YG+58KMcuN32 buendF0nRmTqD9TbU7Mf2VWFvAoZ5q25dAjapOiNOmLNVB6ZZmFLsltKki6bbc0n feLTR6ho0+1PvUynzTCwkLfLir4jxiLcc9PJtiJlKxIzk03MNsvB5BwpUoDL7emO mnhjOPlnLKbYa12OuD09t6ktzsy6pwJKVKSRhsbnIDeBHOJV4uuzbb1krYVhsOXP b5o/SNDcffkGnlrBbUFWFs74jH5efRNmtVUyzqEDhC8eIbeMro8cJ08Ym055patD aYjSPSWTp0xrEyzxWFrZIChhQpQsTcbQN0dBR2NaGKi9Luzc+lCAbHWIvfL8yKd2 JcfdfIJBGLWO2P8A+pUdK0gmZmlz78y64C2tzAAgAm9r7x0RnSwiYm2s8phC97ah 6p9XC5/GlJLY1iOMc/zPFGCQ7HdHmH0MvzM8hxV+KFovsv8ANi1sTbc2ltTKVJCQ C5i335PtiPn55VHrAqzpJp7KQFtIAKySMOV+kjfHScMIi5hnmyfKdoJJaPVHh0uu cVYFCS6pJBv4kiJyI2n6d07SaaXTpNmbQ4ygvEvISE2BCcrKJvxhElDHlr5WMrvc hCEaZIQhAIQhAIo+nnxhn/BP+tMXiKPp58YZ/wAE/wCtMJSV+m/jr/1ivXGGM038 df8ArFeuMMFIQhAIQhAcwH30q/6we9cZYxD76Vf9YPeuMsZlmSEIREIQhAIQhAIQ hAIQhAbjREtIrd/vXiUIHIkbT57W8R5I2GkIl6Gp1xBJeXZFt9uU+Q7OXdGIvPGm MqbecQWipBSlRAw3vfzqt5RG07MuPUiWKphxLyVWCsRAINwAd3ydvn23j5+rOU19 8t/8dO32h2ivZELWpaipRuTBC1NrCkmxBuIyqmZtCilT7wI3YzH1ExNuLCUzDt/0 zlHsua6RX5/+Ob1Pj/0VCGbpExMcWxzQnDxs+jYDykcsaiUhKQlIASBYAbBG3U0i co7alJ1+omFBAdzKwU57dl7DzDpiMRKSTiAtEswUkXHwY9kc+Gvlm/Mrn1fZlnEl SwnFdOFaB8tOeXjzy/3vGGkPcIp6XlKxLWteNXKQop/lbyR6dlZa+qalWNaRt1Ys kcp9m/zkatMkpVKHUGXaUFKLqLoBOBRJH2gx6WWw4DJzjbgHwLqg2r80nZ5L5DpU Y3oi5uWl1vMsNS7STrUlSwgZW42G+42B+zlvEpBCJnRb8IWPq3v4SohomdFvwhY+ re/hKgq6v/GHf0z64xxkf+MO/pn1xjjTRCEIBCEICAmUzek0y7o61rpBMqszAnk3 UHM7YLZW+6cp8HZyQundPm3naJKoQ+6UqW2XUoJw+AMX89sWaZ0lnJNoyNCbYnKm 24ouyy0lRQ2STisCN5T54+O6TaTY2EyFMl3sRtM/BqOr2fnfpcuyOUxExNusTO1P lFoTtCdTS359c6p5Re4Q4kgpFrYbEn5vLvilTs8NE9NqpUZimCeYdJZSlwYE3JSb gkEHwT546DNTkwa2wFNpA1e2x/O6Y5j2QNKp2pvvUN5qXTLSsyFoUhKgskJIzJNv lHdF1flxijHeUvO1CW0OpU2yy41P90bC0HAsI4JxSNgxYvuv5vg9OVK0fpxqulkp TRUjJB0K/tXzLIUrlG21tu+IBRbUCVKspPgjliSokg7UplpqVbW7NLKsDaN9gSfs BjzzPTbbw6Q7TNNJpFClZIzQm9SoI4STbWZHPafWYoVEdVT61Ipbu8FTLZOE2+UP HFslaZMOUCUp9QZWxqQCQMlBWeR28sQWjEguXfS+8haHm3kLbSdiiDcfbHtx6Q4z 1XeYpbr9bRpCZtaEtpwcCKTZWRTe9+m+zdHPeyRX5msMsSRpzsqiVfWEulRIctlk MIty7THWpdPDZbhM58Gu9iE5C3lvHPuylX6U5T5GUkJ5p+YYeUl5u9yiwtn5Y5as VjNN4zvu2O1i+x1NMtol1VovKDwcDWr1eE7PlfyjNpHpDM1zRxUw2w7JTBdSODpc JWAN+wH7I3mtMqlTqPPuaSMStOqKWlLkmFIUA9ZJtliN+NYbRGro/O0+sMJ0trM0 mVmiVS5S2cLVhkMjc38sZmO0TsRL/9bN2LZFuardV4XgdXqwSHUhRBxZ7d8V3RmU W1prSDMIU0rXcVLibE7dl4sfY9cWvTnSZ1gBbC3FqbX85JdNj5o2tNnWJbsm6KzM 04GmGgorWdiRePPGHyxN9HeZ3mKT5ni/pxMUxLWDCgK1wVt4iTst08sVzROgEaX6 VGaRdD63QhbrOQu4rMX2xLt1KlO6aPzshOofWtAAzuCMAB3dEYJDS+rVOcr8ouWl tTJId1SkIVcgEgXurkHRHbKpmGI2cu0z0b7ndJpUNPdsUCXS4ShqwviUMO08l/LH VdCKnLOaEyDb8o0j7pdpwjL4RW4iOLd3VV5vJ+gr+qHd1VebyfoK/qjnjz47RCzl jO9uuymlrNVVPNJozckJc4bhYOtvcfNHJ07YjJJhuYdTNXSyEKtq7ben7Y5r3dVX m8n6Cv6od3VV5vJ+gr+qLGWpEdEmcPLqWmynUaFyS5SaWlwzYBQyoggWc5Ds2Ryy iyjyVTynGnCVEG6kHPwo+93VV5vJ+gr+qHd1VebyfoK/qiROpzXRM4eXQexpQEia b0hdnQwqVeca4IpFisFu2LFfLw+Q7IsNarCZ6oPyhZAS2vEHMdwrK3J0xx3u6qvN 5P0Ff1Q7uqrzeT9BX9UMOfGKr3WZxnu7tQplltLzS1NjWBKQoqHF25/bEqsya0mS W4wtKsy4ogjl2eSPzp3dVXm8n6Cv6od3VV5vJ+gr+qNc+p490vHy6Fo+yZPss1nA nEy62ttKkiyRmhVxu+THRY5F2PdKJ6q6VNysw1LpbLK1XQlQOQ6SY67Fwut2cpiZ 2IQhG2SEIQCEIQCKPp58YZ/wT/rTF4ij6efGGf8ABP8ArTCUlfpv46/9Yr1xhjNN /HX/AKxXrjDBSEIQCEIQHMB99Kv+sHvXGWMQ++lX/WD3rjLGZZkhCERCEIQCEIQC EIQCEIQG1KuBLTwIukWUocovhI/e+yNuYbKKeqXJxahIUTuOIgpI8hPnjQlc5hKP pAUecWH2mJJADrc23YXYasu3ysIsD5yf3Y8Ov8ucT+U/8f8Af6uuO8I1B12FpXhb EK/lB34FJZHhfLPL0eIfb5ofcEf/ACqHoD2n/u3L4laVpCHMrZJXyePlH/eiPT3u OjDOri0Vu/y5hVv8qU3/ANQiIdcMq7ZABDxyTfwVXAv4jfz9JiWnFGXo0qlSbrMy 8EpG84Gz6s7xHIYGBYdstTgss8o5PF/3fDQ3xmfMz+5l1fF/2WVedHGWElaiflED /aNdYMmuWbbIKlt6lN95AuCegAKMJh3VyjjTyvBKUqUflNlQBPmuD/LKPTyVahU0 4LLQQ4BvQgEEgdJAN/Ha9o7MvbbYTNIbBJDTeI4t6lHb48lelG1GCV4yXHfpHCoc lhxQR4wAfLGeIETOi34QsfVvfwlRDRM6LfhCx9W9/CVFVdX/AIw7+mfXGOMj/wAY d/TPrjHGmiEIQCEIQFPoTyZPsoViYcBKFSxSAnbe7fsixTOllHpD7bfBJkLmlYbo QnaDvur86NWVrzEzWZmhintoelwXVTQUCpYJGRFvzxv3RJ0qUZKZxbrSHSkApxIB tt2RnG6mpdPzFy65uqNONlIARh43ljh+nSTIaU1Jx04kmYw2Ty2/2jrc5pIaPLLn TJl0tW4hcw3ubbbHljnmmlKYmpBGlHDmyuoTAvI2BLN0qPhXz8H5o2xjWm9msI7q kW2GpcrW2CVoukjdlG/ofJVWZ0mk1UqbRLLOMIUpRFjgVfYDuvEATcKuvZsBO2Jj Q+UeqeksnJtvrl1OY7LSCSLIUdlxyRxxiW5p22el6hJUGVXOTCXZkqCXHEknEbHl AilaM1Q8LaM2px2z6OQ5XEWWryK6Fo9KqenVTJ1gbIXxc7KN8yeSKPofMh2pS6y3 kmabuCb3zEeyOjjPV0LSiqPI0fmpmnuuMITgAGwg4wDHF59xExMOOugrdWtSlqO8 k5mO31me4EtdQRIcJQ2AOCjYu+XIdl77N0VTsbKYqumOkLr8k2kKUpwMrSFau7hy zG7ZHDUx5s43bxmsUXpdKVWnV6lv6TTaKhLtkOLQ2oqJaCgVJzCcyLxfaDL0LSXR pK6XTgxT1OkBl5OE4htNgT64pHZefL1XpilAthLKuKTt40WvsX8XQ9uYCuLrnBg3 bYuERGc4kzcW0NAVsyumekUqhBSlla2wAMgA4Rl5o0eyG801pvo/MzyS9JNoUXmh mVi+wDL1xPSWj7NEr1TqrdTbmV1B1a1MJSElq6iqxOI3222CImpTrL+nNBEy22G7 kKLigRa++8KnHCiZvK29QJCQna2KtT5VLEg6ghtpQstNhhNwLjaCdsUCrVyYplfr jUm+6zrJh5peC1lJxKFo68uVZFUXNSryNQQAlDQGHYAbEG228Qsnoq3Tn69UXlIm eGNurShbAGrJJVkSTfb0Rc8JyiISMqt+f9UOQQ1Q5BG/wc8v2Q4OeX7I6W5NDVDk ENUOQRv8HPL9kODnl+yFj//X41qhyCGqHII3+Dnl+yHBzy/ZCxoaocghqhyCN/g5 5fshwc8v2QsaGqHIIaocgjf4OeX7IcHPL9kLFl7FzYTpo2cvuDnqjuEcY7GzODS9 s3/uV7uiOzwCEIQCEIQCEIQCKPp58YZ/wT/rTF4ij6efGGf8E/60wlJX6b+Ov/WK 9cYYzTfx1/6xXrjDBSEIQCEIQHMB99Kv+sHvXGWMQ++lX/WD3rjLGZZkhCERCEIQ CEIQCEIQCEIQAEg3BsRG0iozLbxdSWwsm5OpRnv5I1Y05ucLTiGmygHMuLUCQgAc gtcm4FukcovnLTxz+qLWJmOiTM26pRUoNEk3JLSc/sj5wpz5rXUo9kQkvNzzyC+o solieIstG9uVQxZD/pjZcXMtkJ1zSlnYhLJJP72zpMPh4eILlvTS1TjbKHlHCzi1 YbOC2K1/BttwjzRrcDa+c/16/bGg3MVRU0+0pUqdVhOFLarkEbiVZ28nk37JdmNV jS8yok2SnUqBJ5LFWUXHGMYrGKJm3p2mSrym1OB1RbVjQS+vI8u2PapJlSSlReKS LEF5dj9saqX55t1aJhcukCxC0NKItynjZDb5s7ZX2JWZW4mz2HEVKCFIFkrsSPIc tnl5baRsIQlttLaBZKQAByAR6hCIETOi34QsfVvfwlRDRM6LfhCx9W9/CVFVdX/j Dv6Z9cY4YZh95RC27qJV4NunlhweY+lY84/qjTRCHB5j6Vjzj+qHB5j6Vjzj+qAQ hweY+lY84/qjAha3FuoQ80pTS8C7IJsbA2vfkIgIeXZoqdIJt6UdWqtqBEw2cWEN 3FiLi25Gw74+OTdfbfSKS02toq/tJVh4ovla5H52yIiRZec7JVVZZcAcEuFFRyFi G/HyxaalR6lP8HVQ5lqUDNzN41FOt2WtYG+xXJtjFzOM/n2ddrhEaXobc0bm3hcq SEAemn2xx+YKXHlImDZoG6bcv/bx3NmjvVCsMMvqacpykkOsKJ4xAJBtblw790co 01paJfSSoS0ohtpDb9kpF7AW2Ry18fmjJvTnsoSzrZpGDMIXl546FoRo1pS5Ny2k FGkEupaUtCXFOtgXwlJ4qlA7454SFP2aGFSVcY8ucdw7EcrXhJSk72wR2nS66HJb EcSjhIva1tpB27osRcwzE9Ufpg7W105CK20hsh8YgnD4eFXzSd14rGhDrwrck0uw S5ONA+IqAi09lRufBde4QNQqcGBF8xxVdEaXYsk5epqXNlpJVLzTZBXtG/KPRGzn 3ddQ0lmpoQi9rb/EY51oc4qW7IWla29qph29/rVR1B7VNXfUi6k7xt5I5XondWnm ky9yn3COtVGMvqhqOkovstAztVpqnc8LKhllliiyaATMvK6AoZQuy+ELNiCd8U3s iOPu1CSJcJAaN7+OLl2PZMOaFoeWEqTr1jp2xmJ/3JhZj5W2qhtsvLnZFtSnplRW 7iXlnnlfpMU/sholG6hJcYj4I8vLHRpp0S7aMNwNgtHP+zIGJOp07A3hBYUTh/Sh q4/JUGM77rnoHLJ7jKfMLBEsdYAq+/WK3bYsNQTOilzGBA1BZUEG4zThNvsjjegu nCqdweVnXZt2mIQu0ugJIBJJvYkbyd8demq2xNaNuvMpdShyUK2woC6QUXG+Lp5R MV3gyiptwfgI+afPDgI+afPFZ7Z1DnS/PDtnUOdL88avEpZuAj5p88OAj5p88Vnt nUOdL88O2dQ50vzwvEpZuAj5p88OAj5p88VntnUOdL88O2dQ50vzwvEpZuAj5p88 OAj5p88VntnUOdL88O2dQ50vzwvEpZuAj5p88OAj5p88VntnUOdL88O2dQ50vzwv Ep0vQSW1WkyFWI+CXv6I6lHE+xlOzb+mLaHn1LRqHDY+KO2RduzGXV//0L/CEIBC EIBCEIBFH08+MM/4J/1pi8RR9PPjDP8Agn/WmEpK/Tfx1/6xXrjDGab+Ov8A1ivX GGCkIQgEIQgOYD76Vf8AWD3rjLGIffSr/rB71xljMsyQhCIhCEIBCEIBCEIBCEY3 3NTLuO2vgSVWvtsIDFMzOrUllvjPLzCRtA5f++2Ista+ZW0pYwoGFSgcm07VG/zi TYk8myxNsoVMylMXOhxlbriNYbtG6lEZC+LYPsEY6dJvtG7jzSitWJClNkhRBOfh bTbF/mJG+KqUSVupCWBqmgLBeHMj80bvGfNvjyhkSdy0glo2xAZqFt/KRbd5o94J v6djqT/VHxQmkpKlTDASBcktGw/egjVU6hNa1pUMHBL4hncYt3LGwJZS3DME6t4+ DbOw5Dy/9AO+InA/2+DuJsIDGL7mq3heFhxePz3iYCZogEPsEHfqT/VBXhxawpBU jC+jwc+K4N6QeU8h3jeBGFhoOCYMuQWi5cNqJCc0pVlvSbknLfuvGwtuYUhQcdly i2YUybf6ojZNM3Kzbo1zYl37OIK2yTc5fOvnl05i+3IJFiZs4GXSoL+TjFifHbLy jKNqNN+VemGy264wpO37koEHlBxZGFNdcclsLqsakGwXa2NNrpVbdcGCNyJnRb8I WPq3v4SohomdFvwhY+re/hKgq4l9EshbrgWUpSbhCFLOYtkEgk7YiZurMuybzbTE 0pxaClIckH8NyN/EOUTcuSl0kEghCsx+iY0ajOTbaZdLUxNIK3khSm0ldk775HI7 PGRuvGmlcS682EIYcnJdpASA2mUmFAAJsP7sbDdX517HIQaU8Jdhp2dqTikOpW4s yUwCrwwqxwZXSUjKwFri0SLlb0gDBLUkpbmFJAJUkG54x2/J2W+V4QsI2ZioVpKE lpLinRcJQDxXSFEG5PgjCMQz2m1zsIeZerMtyzSHUzzjiUALXwB/jG2Z8CPdIUXD PO6t1CHJkqRrW1IJGBIvZQB3GM1MqFRmTNLmda0gPEMJUFJJbsLE3O/M2yI3xjpy lLmakpSio8LOZN/kIgKxRp6Vk+zFW1Tkwyw1wJICnnAkE2Zyud+2LDXadKVWZknX 6yadqVlTSUOhAmLlJtmRfYNnzo5Ppa/g7JlWSs2SG27Zf/G3HSdIKTN1hrR56mM6 5EqnE+cYTgBwEeERfwTs5I5TMxcU7RU1ux6aPzoaXLybb3ClNpKG2gcZ4+dgM9gP mjkrzk41U3+Etu8IuQtDoOIHLaDnHe3nKXOaWSa9apU2GiEABQFrL6LcsUOlUCUr vZcr8pU0L4KhtbiMC7HEFNgbOgmGtp828GGVOOOJWJxONst4nMri1847d2MqJqqK xWxOv/BOuJ4NfiG4w5+e/kjl9akm2qthUCGmX1gG/wAkK9gjp/Y3NcdZlmJdlCtH FOOax26QoKsTvOLwsO6M45RllGxUxEsPZTaDtGbe1hClziSUg7OIuIrscVKZkabP ql5PWuB0KSgJN1KAyFhyxbOyRK05VFabxK1gm04hn8xUUnsfzU2iSm1SoSZgOpLQ IFiu2W3ptHolz7uvUyoTtVoRenZJcpMlZGoUkg2BGdjnFad0irslPTDUvoitaUOK QHkyy7uAHJVwM77YsFMqcxKaPqqekZTLuNrIWpKcQAJATkm/LFgllCclWZpg42Xk JcbVsuki4NjnsMc6nKIiJqW+nZwrskU5yRn5LJ1QLSiSpNrZxLdjPSVqWQ3Tppcu zK/CL1zrgSL8meUZeyoXjMS3CAB/Z17OS8QGj1LptY0XTJ0krf0mLqlCXJKU6oHM 3VZOzpvHHKZ+JPK3ty7u2vvshhp5pDTzbgulQsQQRcEHfHBOyBVanU6tT1VOluSW FsgaxCk3F9vGEdokJWfl6HT5WbaCHGJdttSQoGygkAi4PRHC9LdJJvSSYYdnFtqD SCm6EYbAm8ddTLpbOMdUv2P5ySlK+0qZ4LqA0sYniAm/jOUdSbnDMydSCZdAlywv VKSOKpJBth3WtyRwOmFJWlCTxLG0d10WcbmKQxLTKrNmUbQLDPwQIxozvOMGUbXL hXa7oV6MO13Qr0Y7PUdCKFTplL76X0U9CAp5zWElOZ3DPk2CKxSaNS612SH6dIlx 6h6rEyrEUqJCEk7bHwsW6Oc4ZxNTTcTjPZz/ALXdCvRh2u6FejHR65o3IzgV3Joc mTKY+G414dX83w7X2L2X2eKKM0qZJBcAw3z2RzynKFiIlo9ruhXow7XdCvRjpUto W5VtCpCfpMst+ouuq1oLqUpwBSxfjEDcmITQ1ikvzlRltKHFsuIcQ3Lpbubm6goH CDyJ2xqIzT5VQ7XdCvRh2u6FejHYZvRnRJqotU9Dj/C3UY0NlSsxnvtb5JiMltFp BVamWHkOCWQk4CF53uP943GnqT4S8XMe13Qr0YdruhXox2ZzRPRSnKaaqan2nps4 ZVIWpWNWXIDbNSdttsc808blqBUnpankgJbQpIXdWZ2xmcM4WJxlsdjqT1Olja7H 7isZjojsEcX7GVRmJvS1tDpSRqFnIW5I7RHo0omI3cc6vYhCEdGCEIQCEIQCKPp5 8YZ/wT/rTF4ij6efGGf8E/60wlJf/9Hos38df+sV64wxmm/jr/1ivXGGAQhCAQhC A5gPvpV/1g964yxiH30q/wCsHvXGWMyzJCEIiEIQgEIQgEIQgEYJnjqZa+c4FHlA Txr+cAeWM8abzijNHB4YTqmzuxKzN/EEgwGk4v8AsriykltpxTaEfOAWcVugIBA5 OMIk25cCTbl1m+FATccoG0RGutpS+ZUeBrQbb1DC2g+cKV5olXHUtgXBKjklKRck xRjD+rxJfNlJzBt4Y5QOW5tbl8Yj6lCnVBboKUg3S3lkeU8p+yPCpYu2ceI1qTiQ Uj7mej1E7xeMrThXiQoWcR4Q/mOj/fkgNT/3/wD+r/5RsEGXJUkXaO0D5PSOiNf/ AN//APq/+UbLq1Ehpo2cUMz8wcvs/wBjAeSRMrKAbsp8M7ln5vi2X83LB9I4SwVA KSsKaKTszF//ABt5Y+JbEmkBtPwA2p24enxR9myODa0HJtSXLjkBubeS/ngMbzi2 GVsFRxqGFlZN73sBc8oJHkzzzj3hSxNNBIwoWjV+VOaR5sUfJhBemGmgopKAXMSd qTsHrPjt44+PuEyy1KGF1ghxQHIDfLoIBHlI5YDbiZ0W/CFj6t7+EqIaJnRb8IWP q3v4SoKuM4zJcFWmdUlTGALcDraSgC187m1hEKZLR5YkFy1MknmpzNC+DIAw4CoH Znew88Y9OKQ5X6I5Iy0+Jd4BCwkqAS4QkcVe+387HO0YqW0uVp2i8o9hEwwylt1A UFYVJYIIuMtojtOOHw4yid7nb7ef8/8AC90kqiUVCCpVLkEpSLkmXQAB5oJolFWg KTS5BSVC4Il0EEeaM1TlFT1OelkqCVLAsTsuCD/KFMlFSNOZllKClIBuRsuST/OO Xduo5bvd8Ro9RC2pa6ZJCxAylUHbf2R6p6qR2sTMUtTfBFpLiTLtJCVdOR25W8kb hWhEssrUlPHTtNtxii6CaPzOjmj76Z+dBemE4jKhwKQzlbaNqjvIyyG2147Y44Tp 5ZTNTFVHnrf6Md0srRag1p5NZmqaFTc20hS1a5fzRYZEDIADZuixsEyzIaZslASE 2tuGUaVJ+80j/h2/9IjcjkttdMjLJnm51LdphsFKVhRyGe7ZvMepeTlpSovVBhht E48Clx4JGJQJBz8w80ZoQLQk7ohQag5jmaa2pVybpUpFydt8JF43qdSpSkSglael 2XYBKghD67XO3fG7CJyxHZeaWlPUiSqbQanGVPJCsfGcVe9iL3BvvMadN0VotIVe RkyzxgvJ5ZFxs2qMTMIqPMyhE3JrlJhCHJddsTakixsb+sCNhibelpdthleBppAQ hIAslIFgIwwh91uWhWKNT68pKqmxryhJQnjqTYHb4JEalL0TotFmxNU6VXLvgFIW iYcvY7dqomoROWOpcsvCHikJKyoD52Z88VVXY/0YULGmXH17v9UWWEJiJ6lyr8to Ro5JuBbNMQFAW4zi1DzEkRMysnLyXxdsIFgALkgAbLA7IzwhERHQuXmdQmoy7kvN DWNOJwqTe1x5IjJDRulUuc4XJMOMPgFOND7mw/5olYQmImbkuWm1S5NgPhhota/7 rq1qTj27bHPafPEc3obQGlhSZC5BvZTq1DzFVonYROXHwc0+SR/9Nl0S8mAyyi+F CRkLm5+2IhrRiiszDkwiQb1ri8alKKlca97i5y27ol4RaiS5a6pGVXNom1MIMwhO FLhHGAzyv5T54cCl9ap3V8dW04jnGxCKXLWekJaYdZdfb1y2FYmi6oqwHLZc5bB5 ojqronQ63MKmKjIB51SQkq1i05DZ4JETUIlQXKDpWh1Bok4JunSGofCSkK1q1ZHb kVEROQhFQhCEAhCEAhCEAij6efGGf8E/60xeIo+nnxhn/BP+tMJSV+m/jr/1ivXG GM038df+sV64wwUhCEAhCEBzAffSr/rB71xljEPvpV/1g964yxmWZf/S1IQhGGCE IQCEIQCEIQCNGQBeU7NqGS1qDfSm4F/KEp83TG9EVSZSWNNZQuWZK20JQTqxnkCD 47ERR4W4VaRrS2jEtLSNptfDj8w+EGcSjbWAlalYnDtV/IDcP+5xCMSTKqzMutMs KQVKTqyjI4Q2D4je45MolG5aSdBtKshQyUktpuk9MFbcY3WyuykHC4nwVesHoP8A 3ZHjgMpzVjqxGJyWlEEITKMqcOxOrHnJtkP+5xEa3CR26KsJx8Gw6veVYtn8/Fns iRZbKEkqN3FZrPT0dEQ/auX7d5ttFzg+IK1YsDi5OTM9PTfOJFuWlF3SqUYS4nwk 4Bl0jLMdP+8VW3Gs62ENrSQSwsEKSPk32kdEeuAynNWOrEYVSsu4ottSzAtkperH F8WWZ9X2QQpzpmWjNKIJWEpBGzIZ/vFUbDzajZxv7onYNyhyH/uUR1PkpVlJaMu0 W1LWWipAPyjlc9GY8u4RuOysm02VqlWTbcGxcncBAJBxK5UIT/dKLdjtGE2F+m1o sei34QsfVvfwlRWacwGDNJskEvYiEiwBwJyHRFm0W/CFj6t7+EqCrY9SKUXnC5Ks qXiOJRlkkk3zN7x9Zp1Nl3NYxLttLtbEhhKT5wYjqq5W2qpNqkWNe2VcRLpQlCdl 7Z4idu0gbcjlGkH9JzKuNmVZS4GgEODColdtpGMDb/8AwxppZrM/SOegPbCzP0jn oD2xX5lekCZ8Kl0NqlcYJBCb21diLXHyjcZ7U2uAbx4RM6S8JSVyTGqUGwscXi5q xEce5yw7bdF9sBK1FdDbLQqb8skm+rEylAvsvbEfFfyRo67Q/nNK8zPtiUk/wqlP 8FMf62YmJ5U4lxgSqUlKyULJ+Rexx+QBWW8kQFeFboCUhKaxKAAWADreX70fe3lB /HMp1qP6oymqaSKbac7XMN5jEkJWq90uXvkCAgpTewOLdtF5mnTM5MJUJyWDKkpQ bpvhUSONa+dgbjMC9r7CICLk5un1DFwKcTM4LYtThXhve17K6D5o2uDfmv8AVf7x vTew+I/6VREwGxwb81/qv94cG/Nf6r/eKwhzSOWZlWy23NqLSS+8pKElKycwEhQB sPOd8SVOdqDhmOHsNtBLhDOA+EjcTmc9kBJrZQ2nEsvJTcC6m7DPLljzZn6Rz0B7 Yi6v9wlv8Wz/AKxEhAZLM/SOegPbCzP0jnoD2xjhAZLM/SOegPbCzP0jnoD2xjhA ZLM/SOegPbCzP0jnoD2xDMCrGjPh1RTPYfgyoIJvhGWXF8LFboteJWAyWZ+kc9Ae 2FmfpHPQHtjHCAyWZ+kc9Ae2FmfpHPQHtjHCAyWZ+kc9Ae2FmfpHPQHtjHCAyWZ+ kc9Ae2FmfpHPQHtjHCAyWZ+kc9Ae2FmfpHPQHtjHCAyWZ+kc9Ae2FmfpHPQHtjHC AyWZ+kc9Ae2FmfpHPQHtjHCAyWZ+kc9Ae2FmfpHPQHtiDenKoh5CWZbGEKdLoUg2 KQSWwk7LkC1xexOY3RhXVKwUrLdOCSEJIC0qyPFxHK9wLnIZm0BYrM/SOegPbCzP 0jnoD2xAGbqrjUwpxgy+ApCQhJUdqr2OFV/k54Tt2DaMPbeslOJulYwFuJINwclF IG0jkVfZmRtF4Cy2Z+kc9Ae2FmfpHPQHtiHlpuovTD6HGEIbSgapzAq6zhvcpNgA TfK9xax2iNEVSrpxtNSSnlJbSpK3UkXxKUCTknIWGWEE4rjJNyFmsz9I56A9sUPT tSTNoCbkJlHxci1/AP8AOJl2p1osBTdOCVFLhUlQVdBA4qRlZR33yB8HbEBpm4HZ hK0hQBlXyMSSk7G9xzEJSXRJv46/9Yr1xhjUMvVph1xxVSlk3JWr+ymwuf0+mPnA ql+N5T9kV/VBW5CNPgVS/G8p+yK/qhwKpfjeU/ZFf1QG5CNPgVS/G8p+yK/qjAhN QcdfbbqkuosrCFkShAvhCt6uRQgKGPvpV/1g964yx6mJRUlV6kyt3WrMzrFLCcNy tKVHLP50eYzLMkIQiIQhCAQhCAQhCA//09SIxpapeWlloFy6wlAB2YwOL6zc9AiT iLbSt+Ulw3mWGULAB2rsLC/iBv8ApCMsPUq2GaiptJJCQoXO08VrbG841jIWlWFw bFfyI3j/ALlGlLrS5UlOIN0qCiDygpajbU4pxRbaNiPCXbJPi5T6t/IQx8KUXOD4 QJg8vg2+d/tt8mcZ22g2DmVKO1StpjzqG9VqyCRe97535b8seQ4pkhL5unYHdg8R 5D07PFsgNf8A9/8A/q/+UbbjeOyknC4nwVW2dB5R0f7Rqf8Av/8A9X/yjYJVMEhC iloZFQ2q6B0dPmgPCH1TKlNI+DKDZw7c+RPL4/JtvbZSlKEhKRYDYIxrZBSnV2Qp AsggZDotydH+0fW3Md0qGFxPhJvs6Ryjp/3iDBLt62mS6QcKg2gpVbYQBaEs5wwp fIwpQSEpv8rYT4uQ7wb7xHiXJdkpaXSbXZSXDyJts8Z2eeMywJd4OAWbVZKwNgO4 /wAvNuEUfZf7tNfWj/QmJWkT7dMqSJt1txxCELGFu2I4kFI2kDaeWIqW4yn3BsW6 beQBJ+1JjPBVlXpihbilmSmhiJP3Nv3kfO69vmc31bfvIrcIWWsnde3zOb6tv3kO 69vmc31bfvIrcIWWsiNMG0Oh1MhMawJKQsstEgG1wCXMgbDzCM3dyrmkz1DXvIqs IWWtXdyrmkz1DXvId3KuaTPUNe8iqwhZayTOlzM4wpmZp77rSvCQthog+MazOItm sUCYaS61o+2pCth4EyP/ADiPjQo33pY/zf6jCy1j7Y0P8nW/2Nj+uHbGh/k63+xs f1xFwhZaWbq1HZdS61QQ24k3SpMoyCDyg6yN7uvb5nN9W37yK3CFlrJ3Xt8zm+rb 95Duvb5nN9W37yK3CFlrJ3Xt8zm+rb95Duvb5nN9W37yK3CFlrJ3Xt8zm+rb95Hl WmTKMOKUmxc2B1be3rIrsYJz7in61v8A1iFlrO7powygKclZpKSoJvq0bSbD+8j0 vTJltIKpSbAJA+5t7SbD+85TFUCUzTilLGJkAoSDsO5R/l5+WMbqlBrUrN1tutZ/ OSVix8eR80Wy1x7r2+ZzfVt+8jErTaXQ6G1Sk2FG390iwvsudZYXituOEK1bYBcI vnsSOU+zf5yPqWUJbUgjEFeGVZ4vHEstaO69vmc31bfvIxt6ay7qlJRKzZKdvwSO Uj6TlBisBZlyEuKu2ckrUdnQT6j589utJrSh+ZUtQSkXuSbAfCORbLXTuvb5nN9W 37yMSdNpdbhbTKzRUMvuaLX3i+s2xWePMfOba6LpUr+YH2+LfkUy2psNlNkjYE5W 8VtkSy1n7r2+ZzfVt+8jydMmQ4GzKTeIgkDVt7Ba/wDedIirpcU0oIeIsTZLnzug 8h9f2RiecCJrHa+qaOXziojCB5UnziFlrWNNZdT6mRKzesSkKI1SNhvb+86P+3Ee k6ZMqUsJlJslBsr4NvI2B+k5CIqSmiw0l7wnEErcI+UD4Q9Vv0QI9yxBdmiDcF0Z /wCRMWy1s7r2+ZzfVt+8h3Xt8zm+rb95FbhEstZO69vmc31bfvId17fM5vq2/eRW 4QstZO69vmc31bfvId17fM5vq2/eRW4QstZO69vmc31bfvId17fM5vq2/eRW4Qst ZO69vmc31bfvIrmkdQFUUp9DDzaUSzoUXAkZkJtYBR+aY+RgnviEz9Ur1GFluqIU lLTxUQAEDMn84Rg17P0rfpCMhl2JhpxMww2+gJvgcTcXuN3liGdmKCzOLll0iUxJ fbYJDKTx1gFIsDcCx2kWjTTGmTmm6kzMpqhLWvcW80p+6Sk3wJSCNgBzHLvgxL1B FVafeqbK5bG44tsOEWxCwRbYoJsLHLebR6fndG5XW8Ip0i1q1lACmhdRF9gBvu32 2jlF/Qm9GVAlqRkHrOho6qXK7KJAANuW+XKLkXtASuvZ+lb9IRpU1SVTlWKSCDNp zB/+FqMMvMaNTbjSJaSpzxdJCcDN9xOfomNinYEzFRZaZaZaamQlCGkBIALTavLm TAU+sfhFU/rUfwkRqRt1j8Iqn9aj+EiNSMyzJCEIiEIQgEIQgEIQgERdOVMNNKlg 00VtKKVFbpBVyHwdlreS0Skak03hdRMJOEpyUq17DOxPQLm/QSdwtREFyZlKmWVN ttoViUFh0kJScNh4PFAKbbNnJkYmG1TAbTq2ZfBbKzxsR6Mac6S5NMqsEOttrCgc 8N1Isq/ICAb8gN98bjbYcbDzB1K15qTa4vvxDlvt2HKCveOb+gY64/0x5W5MhCit mXCQMyXja3owVOJYAEynVqJsmxulR5AeXoNo9pbU6oLeyAN0t8nj5T9g+2CIO8ya x9wSWOD+CXSbpxfo3w9H8somUOTJQkoZlykjIh42t6MYf/f/AP6v/lGdw8FxOj7l tWm9rdI/mPLt2lf/1I3HN/QMdcf6Y052ZmW0KUhhpT7aSpIS6cug8XYeTfuzEbaV rmRdsltk/K+Urxcnlz25DbHlbaAtmXQmySrWK6cJG/luU/bGWGvTUzTUg0nVMqXh AWS6RxgLHLDutbyRmmHnm2Fa5ljAQQRrjnl+jyXgh0tTD0u2nGu4cAvYJCuU7uMF Hy5dAs6x/Ao41AXdWRu3IHIDbPoGd7wH2mJeTIN69JS4oqUQdoBUSAemxF+mNuEI gQhCAQhCAQhCAQhCARoUb70sf5v9RjfjQo33pY/zf6jFG/CEIgQhCAQhCAQhCARq VMOmnuFkXWkpXYGxICgTbpsDbpjbhAabDzy2UhpljCkYbB48Xo8GNWqmcEqHW2WN c2pJQNYTisQSLYei/kvujaS1q3y2hWBVsTR2jDvSRvAJy5L5b4+h3XTqGlpwLaSX CknaTxQQd48L7Ioxyzz5SUpZaDnhKC3jiPT4OfjGW4bI2Mc39Ax1x/pjGy0hbRZU M2FYEqGRAsCLHxEA+WPq5hUon+0cZGxK0jPyj+Yy27IA47MoQSthgg5W1pN+jwYi ZLhbUy6t1lpSBew1pAa+Ec25Z+Pd54m20FRDrliojigG4SP+741ZH4zMeX+I5BWc OTRAIZYIO/XH+mPuOb+gY64/0x8WngwU42UhsZqQSAPGOQ/Z4tsfEvqmR/ZxZGwu LBFvEnf5beWCPLzzyGzrWZfCri2LpOLothz8UR8sqdXVV42UBCEDVpcdN7i98wnc Fjb87eQbShQ3LIW+rEtaUm6ibqPQNw8QtGvnKvS5WCta0uAhGd1khVh0ZHbuAgMy 3pltBUplgAf/ACq/pjFSUuCULjicGtWVpRe+FOQSPMBH1bRfeCHcKiBddtiAfkjp O88l9lxG7AIQhECEIQCEIQCEIQCME98QmfqleoxnjBPfEJn6pXqMB1N1M03Lr4O2 w44pIsl18Ni1wdtifsiFeanXZgtOU+mqdQtEwQmfUSFbEqyb/NI8kaHZIfrUvo64 ujpywDhK0E6xDeEZpHrO0DzjcohKpoKUSSabKEk783Y9GWnWnjncb3t32rr+d7NX vT45ITbq1rcpUipS/CJn3Mxyfc9lze2y+e2HAJu4IpUiLEEWn3Ba2z+73buTdaJC pqmUSV5TEHNa1iKUhRCMacZAN7nDij1TVTKqXKKnRabLKC8Msl4Ri2Zbbxxvem+X 5eZoy9Pnm3EOtUqnJW0MKVKn15DOwuW+QkDkEbUnLzEkioTdQMqyHHtdZuYxhKQ2 hOZIGfFO6JIfF1/pp9Rjmuh0xXJjsfziqoCqV1P9kccJ1ik2zvyp2WJz8lo7Y6fN p5Z3G1bd5u+jF70z1j8Iqn9aj+EiNSNusfhFU/rUfwkRqRwlJIQhEQhCEAhCEAhC EAj4pIUkpUAUkWIOwx9hARSylM2tqYdSgtNgNLdOTiVE3Bvt8EA+feIxyVSaaS4y pxJWFcUqXkTv42z84npIGYiZhFGmiYlLlbs2wtZFvDFgOQdHr80eNfLs/F5xjD9G twYfIfk+rojfhAQnbJk1nGki/B8PGUAkHFfNWzzXjeS/KlQcenGFrGYGMYU+IX29 Pq2RuwgNJU1LtqLjUywb5qRrBxvFnkfX9sa7U+zMPOuImG2kqITjWoJUAOQHpJN+ QjptKwgI5cxLNOsql3EOq4yMCV4lHFnfl2pAueXON1hstN2UbrOa1cp/79kZIRAh CEAhCEB//9XUhCEYYIQhAIQhAI0KN96WP83+oxvxoUb70sf5v9RijfhCEQIQhAIQ hAIQhAIQhAYn2y4gYCA4k4kE8v8AvmPLGm1MSrwcceeS0tS8krWErbsLW6N58p5Y kYQEUqossTaSt1teNODE2oG9sxf5u07csx022W5qVCtY5NMFwi2Tgskcg9u/zAbk Io0TMSzRKpeblxytqcGE+LkP/bRpSdQbD72EpSo3zcWAkcdZ23zyI2X8kTcIDSS9 KYgt2cZcWNl3AEp8Qv8Abt6Y+uTEoVaxubYQ5vOMWUOQ/wDco3IQEU9UmXXGmQtv EFYl3WMAts42/Oxyzy2bY9Ovy6VsuodbmHw5mEKBUq4KQANwuR4syd5iThAY2Wy2 g4jdajiWeU+zd5IyQhECEIQCEIQCEIQCEIQCME98QmfqleoxnjBPfEJn6pXqMB0R 2ly7zqnFuzmJRucM68keQBVh5IxLlmKPKzs9LtvPPBgqIdmFrKwgKITdZNsyfPEp OPScnPmSW4nhGrW8lvWHEUJKQT4FvlJ88eW3WlyTcypISFtJdwa0kgFN7eB0xttB zOkrMgm05KPtuglJSgpUMQQlVgbj54G7O+7OMslpFLTs4mURLzKHlMh7CtKcgRcC 4JF7W88T8mwqbkmJlLQSHm0uBJe2XF7eDGbtev5ieu/4wEI2lNVpss69rmg4hLpQ zMLRYkbLpIJ2xjXQ5JxBQ4qcWg7UqnXiD4wV5xP9r1/MT13/ABh2vX8xPXf8YDmV Y/CKp/Wo/hIjUi9zug7M7PvzapmabW8oKUlt5GEEJCcrtE7EjfGHvfM8+neub9zE pKUqEXXvfM8+neub9zDvfM8+neub9zEpKUqEXXvfM8+neub9zDvfM8+neub9zCil KhF173zPPp3rm/cw73zPPp3rm/cwopSoRde98zz6d65v3MO98zz6d65v3MKKUqEX XvfM8+neub9zDvfM8+neub9zCilKhF173zPPp3rm/cw73zPPp3rm/cwopSoRde98 zz6d65v3MO98zz6d65v3MKKUqEXXvfM8+neub9zDvfM8+neub9zCilKhF173zPPp 3rm/cw73zPPp3rm/cwopSoRde98zz6d65v3MO98zz6d65v3MKKUqEXXvfM8+neub 9zDvfM8+neub9zCilKhF173zPPp3rm/cw73zPPp3rm/cwopSoRde98zz6d65v3MO 98zz6d65v3MKKUqEXXvfM8+neub9zDvfM8+neub9zCilKhF173zPPp3rm/cw73zP Pp3rm/cwopSo0KN96WP83+ox0TvfM8+neub9zGNjscSssylpqdnQhN7DXtnab/Qw op//1tSEXXvfM8+neub9zDvfM8+neub9zGaZpSoRde98zz6d65v3MO98zz6d65v3 MKKUqEXXvfM8+neub9zDvfM8+neub9zCilKhF173zPPp3rm/cw73zPPp3rm/cwop SoRde98zz6d65v3MO98zz6d65v3MKKUqEXXvfM8+neub9zDvfM8+neub9zCilKhF 173zPPp3rm/cw73zPPp3rm/cwopSoRde98zz6d65v3MO98zz6d65v3MKKUqEXXvf M8+neub9zDvfM8+neub9zCilKhF173zPPp3rm/cw73zPPp3rm/cwopSoRde98zz6 d65v3MO98zz6d65v3MKKUqEXXvfM8+neub9zDvfM8+neub9zCilKhF173zPPp3rm /cw73zPPp3rm/cwopSoRde98zz6d65v3MO98zz6d65v3MKKUqEXXvfM8+neub9zD vfM8+neub9zCilKjBPfEJn6pXqMX0dj1lSgBPTuZt92b9zELO6O0dLcwwKlOuuoW 0y40HUXTrVBKSfgRlxr7dxhRSzzsip+cfWucmSVKUNqcgTs2bIwCm2aS0J2awJSE AYk5ACwGzkjPWaFNVGaQ42lTSmlqKXNQVkXI8G5sDltsei0RbOiVWZXi7ZzqrqKl gtrGPIDOyr7uXxW2xppZZedVLSzUu2y0G2kBCQcRyAsN8ZO2jv0TXmV7Yq8xobNT MimXU9MpIDwKg2s4g6QVA3UTa1xt3g7s/r2idVdUlXbGcBSsrSdWu6eIU5ca2d7n 7MMBaRUl6tS1Jl0JTtKsXT09EfRUSSQFSpINjkvKIhUs9JUcSs1Lzk2VAIUUS61l YsQSbXtt5YglUlK3m3HJWsrISkLvJvfCELxG+4hWwgjYE8loC6ColSQpKpUgi4IC 84jUaTvv1KbkZKlOza5UI1q2ihKRiva2NxJOw7orkhSTIavBLVc4C3//AML3Gwiw BGy3QAPBTtw5zei0jPN1itTzslMNMTRZDRdRgUrDjvxTmNo3QG/23q/5OTPWM++h 23q/5OTPWM++jVb0UmpSXlJenzz8qwwyltTaUKs6QbqUbLBBOQyNwN8SlMp07ImZ MxMvzetdK0BabasfNF1HIfygPS6gtohLvBm1m3FVivfkyMO2CuWW8y4jZ+aW3U3r SNRcAGAluUcKVDK9iBY7PFGmXwUgGkVInK/9hcF7HZkm9ui+cBMTdZEnJvTLgYUh pBUQlK7m3JGRyqBp1xpTkprEJxKQMdwOW3JkYrVRL01TJmWl6XU9Y6lQSFSbgFzs uSn7TCaQtyfmZhEjVCla1OJTwBwcYpwbbbLAZcufJYJpjSFUxLpfRKp1akBdzlYE A58bkMfXK+pltTjrDSEINlKUoAJ8ZxdI88Rkro/MzNDblZlDrQUwlCm1NE54Ei54 pzBGWcZpjRpx1t9DS1M657XXQ0sFKrAXFgM8ifGd+whICtPEkCUSSDY57P3o+PV1 TDymlstBQUU5qtcgXNrq5I1pCgOSAmAhbrgeeLpxtquCQARkkcl/LGKq6PzFVVMN qUW2HFLCgWVlSgQLEEbLEX8YHJAbStI0oShSm2EpcSVoJWBiSBckcfMWzjKK08pI UmUSQRcEHb+9EWdGZwapTc2tLraVALLLirk3IuDtsTfO5yTnkbyMvSnpeWaZCcm0 BAwtrAyFsrgn7TAZHa04y44hUu3xFYSb2F7X3q5IwK0lQjBiRLjGgrTdwcZNr3HH zFs7xr1DR96oT4mgt1pbLrimrslSVYkYbkFPs38sfE6PTGqbSpy620qwkMLtjUQc ZG298WYIPGOYgN8Vp5SQpMokgi4IO396PbtWead1fBm1Kz8G+7xq6YwStJdlZRmX TiUGm0oBLa87C3JHt2SmHJ5Sw04Ecayi2rO5Ft0B8XXltlIcl20FV8IUoC9hc243 JH1FcccSFIlm1ApCgUkG4Ow+FsjTqej8xUWgyV4GilQWCwsk32WNhaxz37ByR9k9 H1yrUwhd3uEOKW5iZVbjbQBbwb3y6d8Bspr6lKKUsNEgAkBQyvs+Vv3R77du2vwV Fr2vffe1vC5YhFaFqWpgmYeAYW2tGFo7UhAzuk3HwafEb7crSHc+oyUtLKClahTa 0rLSr4kkG+zabG/jMBsory3QC3LtrBvYpUDexsflbjGyupOoWpBaZuk2NsXtiDkN ElyM8icD7y3Es6kp1SgkpskD5NwbITfPM+aJV6WmFPOKEu6QVEjiHlgMvbR36Jrz K9sO2jv0TXmV7Y1+CTPN3fQMOCTPN3fQMBsdtHfomvMr2w7aO/RNeZXtjX4JM83d 9Aw4JM83d9AwGx20d+ia8yvbDto79E15le2Nfgkzzd30DDgkzzd30DAbHbR36Jrz K9sO2jv0TXmV7Y1+CTPN3fQMOCTPN3fQMBsdtHfomvMr2w7aO/RNeZXtjX4JM83d 9Aw4JM83d9AwGx20d+ia8yvbDto79E15le2Nfgkzzd30DDgkzzd30DAbHbR36Jrz K9sO2jv0TXmV7Y1+CTPN3fQMOCTPN3fQMBsdtHfomvMr2w7aO/RNeZXtjX4JM83d 9Aw4JM83d9AwGx20d+ia8yvbDto79E15le2Nfgkzzd30DDgkzzd30DAf/9fpvbR3 6JrzK9sO2jv0TXmV7Y1+CTPN3fQMOCTPN3fQMBsdtHfomvMr2w7aO/RNeZXtjX4J M83d9Aw4JM83d9AwGx20d+ia8yvbDto79E15le2Nfgkzzd30DDgkzzd30DAbHbR3 6JrzK9sO2jv0TXmV7Y1+CTPN3fQMOCTPN3fQMBsdtHfomvMr2w7aO/RNeZXtjX4J M83d9Aw4JM83d9AwGx20d+ia8yvbDto79E15le2Nfgkzzd30DDgkzzd30DAbHbR3 6JrzK9sO2jv0TXmV7Y1+CTPN3fQMOCTPN3fQMBsdtHfomvMr2x5crBabU44lhCEi 5UokAeW8YeCTPN3fQMYJulzUy2kJadQtCsSSWyRexGYyvt5YDeNXWDYoYBy5d+Q3 x4RWw44ptHBlLQbKSkkkeMXivt6HuNagIVN4WloVZSCb4V4weg7E3+bcb8vcxotN PvOr4+FZJDa5cqSLrCjlfabEZW2neSSFgNVcSLltkC9s7+2PjdYLqMbaWFpJIxJJ IyyO+IWX0ZcYZU2WnnDwhL4WttSlYkkHaSczbO1s1KNs42KZRZimySZYImHQmwCl JUcgABtudgG/zCwASwqgLimg5KFxASVoBUSm4uLjdlH1VTw+EuVGROePYNpip1al pmZx5Ylqul4uJVrG5V0hJShKbJyttSDcbSBtjy3IJRJoluA1YoQpJH9hcGWEJUm1 tirEnpUTAW1U+pxo4HZdOJPFWgKuL7xuitz8mxLhgOzj7xceBQi+RWgFwFXFGXwf qiNbo6m0OANVwLWEguiVexGwNujbbYBkkDPbGRNMmOGy4lpKpFOtxKL0q4nCAw4g EqIzN1JG7d0kh//Z ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=tutori9.jpg Content-Type: image/jpeg; name=tutori9.jpg Content-Location: http://zippy-egoboo.sourceforge.net/images/tutori9.jpg Content-Transfer-Encoding: Base64 /9j/4AAQSkZJRgABAQEAYABgAAD//gAcU29mdHdhcmU6IE1pY3Jvc29mdCBPZmZp Y2X/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0aHBwgJC4nICIs IxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIy MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAAR CAEAANEDASIAAhEBAxEB/8QAHAABAAIDAQEBAAAAAAAAAAAAAAQGAwUHAggB/8QA TxAAAgEDAgIDCwYMAwUJAQAAAQIDAAQRBRIGIRMiMRQVNUFRVHN0sbPSBxc0kZOU FiMyVVZXYXGBlaTTUnLRJDdCYrIIMzZTdZKhtPDD/8QAGQEBAAMBAQAAAAAAAAAA AAAAAAECAwQF/8QALREBAAECBAUBBwUAAAAAAAAAAAECEQMEElEVISJhkTEFFHGB sdHxJDNBUvD/3QAEACj/2gAMAwEAAhEDEQA/ANl8ovyi8RcMcX2ui6LaWdwJ7aF0 je2MkjSOSNowQTkgYHbk1WNS+Vv5QtG6LvpoNrY9Lno+6tNki34xnG4jOMj6xVq1 aeG3/wC0nw288qRIbAIGdgoLNHMqjn4ySAB4yQKpb8EpZ8C6BNrJ1vRre916G2ur S8vFEQQoQ9yEKL0TdVgN+cKO0gg17mBRgaKIrpjnEfO9/szmZYvn34s820j7qfiq RZfLTxvqV2lpY6Xp11cyZ2QwWLO7YGThQ2TyBP8ACrdpGg8PcN/KNostvpF1pEq6 vd2cM1yehiuY+gdVCrJO8kh3FAJFVVbfjGSBXP8A5JkeP5adNSW07jkWW6DW2GHQ noZMphiWGOzmSeXPnWsUZaqiqqnD9Iv9fsjnu3OpfK38oWjdF300G1selz0fdWmy Rb8YzjcRnGR9YqB8+/Fnm2kfdT8VeOENQ0HiK90TgaSxns9Em1R764e6vlkkll6E qkYZUQKrEBcYLEsMEGtna8GaLLe8Mm/4ee01C+sr2S90lJZAYOjcrFN0Dv08gxlj GjhmCEr+SQbTh5aidOJh8/z37F5n0lH+enjfvf3w716d3F0vQ90dwt0fSY3bN27G 7HPHbikvy08bwWlvdzaXp0dtc7ugmexYJLtOG2sWw2DyOOyrVwbw5omhcS2+o9xw WN3DxRPpqkagbhEQ2TkRK/INmQgDK7xkKesDWh0zgjQrnQtJvLrROj1aaw1i4729 LMvdFzBKFig2Ft/VBbqqQx28ycGqfpb/ALfL89+3qdW7V/PvxZ5tpH3U/FWSD5cO Mrq4jt7ew0uWaVwkccdmzM7E4AADZJJ8VbS+4V4V0bQdc1afQEnvLXSNMuH06S6m RbO6nLq6EB94A6j7XJb9oBGNDqGg2PDPy/2Ok6arrZw6vZNEjtuKhzG+3PaQCxAz zwBkk86vTRla7xTh+kX8W794RerdudR+VT5SNIt1uNT4chsoWfYslzpckalsE4BY gZwDy/Ya1nz78WebaR91PxVJtdJ4e4k+XqbSbjTbpoZdSvxeLNebllZRIwKbERkG 5c43N4hnkc5+FOD+Hda0fQrufSka11J9RbVr2OeXbpIjUmJQ2/bGMYb8aHJz2kVE 0ZaiOvD52v5v37Snq3a/59+LPNtI+6n4qkWXy08b6ldpaWOl6ddXMmdkMFizu2Bk 4UNk8gT/AAqx6ZwPwm+j6c82gQTSyWGizSSNc3ALvdzmKUkCQAchkYAwT4xyqq/J 3p0Okf8AaAi0y3Z2hs729t42kILFUjlUE4AGcDyVGnK1U1zTh86Ymefw+J1bs8Xy 08bz2lxdw6Xp0ltbbenmSxYpFuOF3MGwuTyGe2o/z78WebaR91PxVa9e/BJPkm4u /Bbrd2dx6lcf90eg6acbbf8AF/k7NjdQ/k7u05rX6twFwpB3wjlt+9+l291pcWn6 x3Sw7vjmx07b3JifClnzGoC7cnkCKiiMrN9WHbnb6fc6t2s+enjfvf3w716d3F0v Q90dwt0fSY3bN27G7HPHbilr8tPG9903cml6dcdBE00vRWLP0ca/lO2G5KMjJPIV co+FdKm0234e1TSO9GjnjKWKKPfLH3TGttJ0TbpWJPSFVXKkA/8ADg861Gn6Ppml wazJZaPe6Vc3HCWpGeC6Tot4DoEcQtNLLHnrDrkBtoK+OqxOVm9sPn/u51bq58+/ Fnm2kfdT8VPn34s820j7qfiqgXGh6ta92d0aXew9xbO6ukt3XoN/5G/I6u7xZxnx VgvbG7027e0vrWe1uY8b4Z4yjrkZGVPMciD/ABrujJ5WfSmFdVTo3z78WebaR91P xU+ffizzbSPup+KuY0q3uOX/AKQapdO+ffizzbSPup+KrVwfx1x9xrHfPYNwzbLZ GMSG7gkXO/djG3d/gPbjxVweuyfIb4L4o/z2f/8AauXOZbBwsCqumiLxb6ppmZmy 89L8pf5x4J/9k/wVXrjjni2y4wj4Z1SbRJOntJJXm06FwU/FyEAM2MHKDsHj7c9m m713PdnTd6tQ/Azuzd3q2nfvz/33QbN/Qb+fRZ/59uOrWHXf99Vt/wCnv7mWvGw6 4rmaZpj0n+NomWkxZxSlKVyLPob5UuAdV4p4sjvrG4s44o7OKEid2DZGT4lPLrCq T8znEPnml/ayfBXe9U+nv/kT/oFQJpo7eGSaaRI4o1Lu7sAqqOZJJ7AK7sP2jj4d EUU2tCs0RLifzOcQ+eaX9rJ8FPmc4h880v7WT4K67a6wlxcpDNZ3dp02e53uVVRP gZO0Akqcc9rhWxnl1WxhbinROlsY4tStJ+7bg20TQzow3hS2Cc/5RyzzdR4604rm N48I0Q5R8znEPnml/ayfBT5nOIfPNL+1k+CutXetPb6m9hb6Ve3sscKTOYGhCqrl wv5ci8+o3ZUxNRspL+SwjvLdryJd8lusqmRF5cyucgcx9YpxXMbx4NEOM/M5xD55 pf2snwU+ZziHzzS/tZPgrsCa5pMlhJfx6pZNZxNskuFuEMaNy5Fs4B5j6xXt9W02 LuTpNQtE7sx3NumUdPnGNnPrflDs8o8tOK5jePBohxz5nOIfPNL+1k+CnzOcQ+ea X9rJ8Fdg1HWLLS5rOC5mRZ72YQ28RZQzse3GSOQzz/gBkkApdc0mG1F1LqllHbll QSvcIELMocDOcZKkMPKDnspxXMbx4NEOP/M5xD55pf2snwU+ZziHzzS/tZPgrsF3 rmk6e+y91Sytm3FMTXCIdwAJHM9uGU/uYeWl/rFlpt3p9rdTJHLfzGGEFlGWCk+M 9nILyzzZR46cVzG8eDRDj/zOcQ+eaX9rJ8FPmc4h880v7WT4K67Ya9puo6eLyK6i RFt47mZJJFDQI6b1Mgz1erz5+Splrd219bJc2lxFcQPnbLC4dWwcHBHI8wRTiuY3 jwaIcW+ZziHzzS/tZPgp8znEPnml/ayfBXV14n0t7no47qKSHo1lN0s0fQ7SJjnd u546B84zjt7AxEyTVtNhkhjl1C0R55GihVplBkdW2sqjPMhuRA7DypxXMbx4NEOO fM5xD55pf2snwU+ZziHzzS/tZPgrrWpcR6TpUN89xfW5lsoTNNbrMnSheWOqSOZ3 KBnGSw8te21/S44HuJ7+0gtlkWNZ5LiMJIWRXGDu8atnBwTjOMYJcVzG8eDRDkXz OcQ+eaX9rJ8FPmc4h880v7WT4K7H3203vl3u74Wnd3m3TL0vZu/Jzns59nZzqSJo 2maESIZUUOyBhuCnIBI8h2tj9x8lOK5jePBohxP5nOIfPNL+1k+CnzOcQ+eaX9rJ 8FdvpTiuY3jwaIcQ+ZziHzzS/tZPgra6TwDx1oMFzDpWuafapcsjTBHY7ym7bzMZ PLc31/sFdapVK/aONiU6arTHwTFEQ5n+DPymfpRaf+8/2qx2HBPE9vxGmva3qdnd mC3lRijNvIMbgADYAebV1Co9/wCDrn0T+w1z+8TF7UxHy3TZ8kUpSsEvsPiPsvPV x7sVg1zTLK9h1LTWtLWKCdZbctFbRq6q2Vyp28iAeRrPxH2Xnq492KyX/hG59K/t NBUL/QdT1sTpf3KWgNrLbBrS4lZJ96Mm54ThFA3FtvWOdvXAXrYbXh2/h1GzvxBb pLFdI0iSajcXLGIRzJkSSDtHTEhAoHI5brdW20oNO+g21zxLJqt3a2k+23gjt2kj DPE6PKxYEjq/lpzB8X7BWh1Hg2+1G6kU3UUVu8l0S4llORNFKoIhyI1KmQAkZL82 LKSQ12pQVjUdG1PVhFdXFtZQ3MEyOkVveSo0qhJFw1wqq6j8aSAFPYRk7ztwtw1e RW8EVtDZKWVlmLXEzAB5GdlkDbu6lPSMMPsOS5UoX6ltpQQNQspLq90qaNkC2l00 0gYnJUwypy/blx/DNaew0G90aw0PuGGykuLCxa0lhaRoY2Z+jZ3DBGOd0fYV57yS QRg2elBUtI4Qk0mezYSW8ht7qJ2mClXkijsu5wDy7d5ZgMkAMeeeVTINFvbbSuGL dDbvLpbRCfMjKrKIHiYqdpyevkAgZx2irDSgpj8GznRtGso2t4zYWIikETtGJJhL bynDKAVDGF8uOsCwOCa2Vvw87cOarp0uy3l1JZA7LPLdFC0YjBLyEM5woPYoxgY5 bjYaUFG1XhPVtXub67ddMtpbuEIUidzhhb3UQLPtG8/jo+eBgAjB2gtP1jhVry8Y 20UXcs1nHZND3XNbpCiF8dSLAlGJMbCVxtwD1ji1UoKreaBqVxpWo6SiaeYJe7JI LmVmMgefpCBt24TBlI3hmyoPVG7q+00jVrbWZtZiispLiVnBtnuHVFV4rZSd/Rkk hrcgDbzDZyCMVZ6UFVseFrmw0Z9PW4ikxeWMySHK7kgW3VsjngnoWwOfaOfks4Mn TMCiCIKCrBjuLc8gjHIDq4OTnJ5DHP3SgbYfHZ2bHxlrWMk/vJXnTbB5lY/c4vhp SgbYPMrH7nF8NNsHmVj9zi+GlKD/0L90cDXFqvclmubqAEpbRqcdIvjAzWC/8HXP on9hqQv0qz9bg96tR7/wdc+if2Gg+SKUpQfYfEfZeerj3YrJf+Ebn0r+01j4j7Lz 1ce7FZL/AMI3PpX9poIryJEheR1RR2sxwBWv03iDSNYd007Uba5ZMbljkBIznHsP 1V41Oyh1HWtAtb+2FzpL3v8AtcLR71bCMY9wHMr0gQnxYB3dXNdF1Ky0+eSC6u7a CSe3D9DM8YLxKwxJtPaMrkHHbQU+lVvi2y74vodrstH6TUD1bu36eI4t5j1kyM9n LnyOD4qjSNqOlTX9rpgt1i07SUuYrG1swqTXDdPyCgkhSVB2g5JxhvytwW2lUldT u7rU7XT9P4hlurKa4jU6hCIHbcYbh3iDBOj5dFEcbdw38zgjHvhi5muOLtTN1qLy zC1ESwsIxvWK5uIt+AoOeoCccsynkBtChc6UpQKUpQa3UuINI0d0TUdRtrZnztWS QAnGM+0fXWwSRJUDxurqexlOQam/JrZQwaLe3UtsI9WuL2bu6Yx4aXa7CLn2FRHt A28gd3/FurLqVlp+nR29rp1tBbQIG2Q28YRFUnPIDkOsXP8AGg19K5jbR23fFntb vRO+ffx8wxWw7v2d2nf+MEm7HR7iep+RkHlzqTb8Uaubh43vEaOaESyPhS1kOmhS TK9GFiZElZmR2lKbV3HHNw6LSqHdanImqWE9rq3dtuLe5jfURGuY4jJahnBAEb7S TlgAqgHIYowa+UClKUClKUClKUBfpVn63B71aj3/AIOufRP7DUhfpVn63B71aj3/ AIOufRP7DQfJFKUoPsPiPsvPVx7sVkv/AAjc+lf2msfEfZeerj3YrJf+Ebn0r+00 GFJHicPG7Iw7GU4IrNNfXE6bHk6p7VVQoP78dtRXkSJC8jqijtZjgCtfpvEGkaw7 pp2o21yyY3LHICRnOPYfqoNlSlKBSlKBSlKBSlKCRDfXECbEk6o7FZQwH7s9lYXk eVy8js7HtZjkmtXqXEGkaO6JqOo21sz52rJIATjGfaPrrYJIkqB43V1PYynINB6p UC3udQnhhlNnbosiqxBncMoOwnqtGDkZk5EA9Vc43HZ7STUjs32loudu7bcscfkZ x+LGcZkx2Z2r2bjtCZSocNxeG5jhubaKPfGzlopHcAgJyzsA7WccyCQoIBywWZQK UpQKUpQKUpQF+lWfrcHvVqPf+Drn0T+w1IX6VZ+twe9Wo9/4OufRP7DQfJFKUoPs PiPsvPVx7sVkv/CNz6V/aax8R9l56uPdisl/4RufSv7TQaLU7KHUda0C1v7YXOkv e/7XC0e9WwjGPcBzK9IEJ8WAd3VzXRdSstPnkguru2gkntw/QzPGC8SsMSbT2jK5 Bx21UUkeJw8bsjDsZTgis019cTpseTqntVVCg/vx20FT4tsu+L6Ha7LR+k1A9W7t +niOLeY9ZMjPZy58jg+Kq9BcXGk9zxxG3tpttwt2kFuqR2WJ7WORolOTHGELTdbk 24SMuDgdFrDdW0d5bPBK0qo+MmGZom5HPJkII7PEaCjadc32scVCKPWnaOBbqKK7 jtkV2h22TDbkFSSzZ37SrAkqACu2fwJeyX41W7uLzpLm5kt7mSDqgRdJawsCABkD mVGSeUY7TuJs9lYW+nwmK3VwGbe7SSNI7tyGWdiWY4AHMnkAOwCpNApSlApSlBWr Cy40g0W1uuD7awj1a41iXv5NdxgNKiuRDknkYRHgN0fWB/J62+rrqVlp+nR29rp1 tBbQIG2Q28YRFUnPIDkOsXP8ajw31xAmxJOqOxWUMB+7PZWF5HlcvI7Ox7WY5JoK Dw1rdtYcFT2dnPaPrNv3a0Onbh0rOskrKvRAI3iHIIvLxL2DDJc6hquh3MEutxXF ubyzi6azmjuNwkmCSRu4gSMjaVOzaTz62VYKbhYx39pZ2tr3LaBIY0jys+MABAcB YlH/AJmAAB1V5DcdmZJNSOzfaWi527ttyxx+RnH4sZxmTHZnavZuO0K9wlGFdgbt 7t4brUY3d1TdG3dIO0lYxtLcnwWGd2QpAGy21Aiiu5L+G5uYLeMxwun4uXect0ZI yYwcZVhyIBAUkEnqT6BSlKD/0b/SlKBSlKAv0qz9bg96tR7/AMHXPon9hqQv0qz9 bg96tR7/AMHXPon9hoPkilKUH2HxH2Xnq492KyX/AIRufSv7TWPiPsvPVx7sVkv/ AAjc+lf2mgivIkSF5HVFHazHAFa/TeINI1h3TTtRtrlkxuWOQEjOcew/VXjU7KHU da0C1v7YXOkve/7XC0e9WwjGPcBzK9IEJ8WAd3VzXRdSstPnkguru2gkntw/QzPG C8SsMSbT2jK5Bx20FPpWh40tLa74N1fum3im6Gzmlj6RA2xxG2GGewjy1rdZvDoc k1pYTxabHbWYm0+zhijRb6ctIWiClctzWPqx7W/G9uSuAuFKp+k61e3OspC2o9PI 2oXdvJZ9CF6K3RpdkvZubrIib87Oe3G8E1cKBSlKBSlKDW6lxBpGjuiajqNtbM+d qySAE4xn2j662CSJKgeN1dT2MpyDU35NbKGDRb26lthHq1xezd3TGPDS7XYRc+wq I9oG3kDu/wCLdWXUrLT9Ojt7XTraC2gQNsht4wiKpOeQHIdYuf40GvpXMbaO274s 9rd6J3z7+PmGK2Hd+zu07/xgk3Y6PcT1PyMg8ude9Q1a5vdNsjNrjqC1tc6iqiED TphcQARnqdQDfIcSZbMI54Dhg6XSqBpt93FbC0n4ie0te7tQ6e9cwKyTLcdSIlk2 AsrPJgjce0YUYr3Z6lxBqd1aC41GXT+mvI7eSCC2jDRk2AncEyKx5P2AjIy2SeW0 L5SoGh3smpaBpt/MqLLc2sUzhAQoZlBOM+LnU+gUpSgUpSgL9Ks/W4PerUe/8HXP on9hqQv0qz9bg96tR7/wdc+if2Gg+SKUpQfYfEfZeerj3YrJf+Ebn0r+01j4j7Lz 1ce7FZL/AMI3PpX9poMKSPE4eN2Rh2MpwRWaa+uJ02PJ1T2qqhQf347a1WqapbaP Zd1XXSFC6xqsUZdmZiAoCjmSSaj6dqt9d3q2t1oV/Zu6syO2yVMKpZtzRkhOQ5bs ZJwM0G1pXl3WNC7nAFfoOSQVdWU4ZXUqynt5g8xywf40GK2tYbOJooE2I0jykZJ6 zsXY8/KzE/xrNSlApSlApX4zBVLHOAM8hk/VQHL7NrhsMcFSOSttb6m5UEmG+uIE 2JJ1R2KyhgP3Z7KwvI8rl5HZ2PazHJNY2fayKFkdnO1VjQuxOCeQAJ7Aa/VYMMjI wSCCMEEciCPER5KD9pSlApSvwsA6LzLOSAAM9gJP/wAAn+FB+0pzwCVZcgMAwIOC MjkaUClKUClKUBfpVn63B71aj3/g659E/sNSF+lWfrcHvVqPf+Drn0T+w0HyRSlK D7D4j7Lz1ce7FZL/AMI3PpX9prHxH2Xnq492KyX/AIRufSv7TQaXUNKn1DVtGubd 4g1ncs7CV9ilWjZCd3iIDZAxzOByzkWS2tpbCdbm5XohHllVjgufIP8A4/dmtbSg 8ktHLFOi72hLMFzgklWXIPiI3ZH7R4u0fkltNLJAJo0ZQXKw9LEwBIABYtujA5H/ ABNyHlr3Sg8W+nwL3NJPBDJLndIZWEnZaqOwkjnIT4uZA8lLWxQSxNNG8jhYGdzP EqqAibhuIMmSwfITtzjxmvdKDCLJFSxgS3jYJApdd0Z3SlFyWaTcuBzHYSMAAczX qSIxwWxVd8sUUbEbgSz7AHGTkZOWGeeCc+KslKDDNYJFbXUS7ZjFEUjJbIklaMIW AJ7ARI2fLIPJUk2luk8mLS3WCMXG1QU2yEzqVJVT1hsxgMMdXs5CvFKD8SA77FTK 8eyEGV0dS27oCGGWBGSxx2Htrw1rHNLsWKVlWLZFmaFdpLMzsWdeRJYYKAHkfIKy UoPE9rCIkSK2RukneRwrqSR0r7R+MyuNpBwQBzyRmsJspX6dBa2puDDGgdZgFgZj KQQCdg5DxE7eQXJ5iTX7uYKVydpOSM8s/wD4mg//0r5JZRE3bQo4JaYpM0saDnuE YGFMrAApyJxkfsr2LaI30E8em20cQkPRRlosqNj4JAO0YJQkk7jgduKUoPMFqkb2 4dY+iighmkQbcNKsajafGcttJ58gjf4jX5Z2iQWoZo3DiIKZHliG98jJ2ou5uxsF zyB8pr3SgUpSgUpSgL9Ks/W4PerUe/8AB1z6J/YakL9Ks/W4PerUe/8AB1z6J/Ya D5IpSlB9h8R9l56uPdisl/4RufSv7TWPiPsvPVx7sVkv/CNz6V/aaDVapqlto9l3 VddIULrGqxRl2ZmICgKOZJJqPp2q313era3WhX9m7qzI7bJUwqlm3NGSE5Dluxkn AzXvUNKn1DVtGubd4g1ncs7CV9ilWjZCd3iIDZAxzOByzkWS2tpbCdbm5XohHllV jgufIP8A4/dmg1busaF3OAK/Qckgq6spwyupVlPbzB5jlg/xr8JaOWKdF3tCWYLn BJKsuQfERuyP2jxdo/JLaaWSATRoyguVh6WJgCQACxbdGByP+JuQ8tB7pXi30+Be 5pJ4IZJc7pDKwk7LVR2Ekc5CfFzIHkpa2KCWJpo3kcLAzuZ4lVQETcNxBkyWD5Cd uceM0HulYRZIqWMCW8bBIFLrujO6UouSzSblwOY7CRgADma9SRGOC2KrvliijYjc CWfYA4ycjJywzzwTnxUHtmCqWOcAZ5DJ+qgOX2bXDYY4Kkclba31NyrFNYJFbXUS 7ZjFEUjJbIklaMIWAJ7ARI2fLIPJUk2luk8mLS3WCMXG1QU2yEzqVJVT1hsxgMMd Xs5Cg8V+FgNvaSzBQAMkknAH1kV+W9oM26vDGWBgee4d0JVAkZdQSd2ciTIXt3fV jjtA5tWmsoniggiQIzxkuyyQh8AnlkK/M4yCc4oMhc9IsaxyyOwLBYomc4GMnCg+ UfXX6rK6hlIKkZBB5EV6MRe8leSV41ELhuhZBuJePkMgjHInkPFXmG2hkuy7QOUR owpM0SqkSKoC7ipkJ6rZCYzn9poP2lYDaKkNjDDaxuyQqWBMbAyGMZLdJ1SAeXaM YwMZNe7ezHdB3W8GBcoJJxOW2qiRF1G7nzBIyuS2SOQ7QyV5ZwpIwxIQuQqk8gQC eX7SPrrHBZRR2iGSCR9oQSlpYgZjvUuAqAM2QHAMhHI/tr8msmK3DCxtVlktZkQI 0XUJ2Y5A7RkBwAuT1iT20EhlZGKsCGBwQRzBr8pd2yme/MRjCIZe5gMAb5Nwzy59 XrnPldcfk1+pbwwQsYoXiDFQgeSLcVAPMpEoAPMZJJJxjxUH5SlKAv0qz9bg96tR 7/wdc+if2GpC/SrP1uD3q1Hv/B1z6J/YaD5IpSlB9h8R9l56uPdisl/4RufSv7TW PiPsvPVx7sVkv/CNz6V/aaCPSlKBSlKBSlKBSlYbt2isp5EOGWNmB8hAoM1K1+hc NcU63w9pmrfhRYw93WkVz0Xekts3oG256YZxnGcCth+A/FP6XWP8mP8AfoFKfgPx T+l1j/Jj/fp+A/FP6XWP8mP9+gUrZ2+jHS9LYancDULqMkvLHH0CtkrgBctjAbyn Jz+4ayPXNBm1WbS41Vr6CNZZIBc9ZVPYSMfu/dlc9oyCv3cxULk7QcgZ5Z//AAFV 0a/NFa8VX8kYkj0y4l6CAHHUSCN9u7HjJPM57fJgVM027ve+d3p1/JbzSwwxTiaC JolKyGRdu0s3MdGTnPPd2DGSG1pSlApSlApSlAX6VZ+twe9Wo9/4OufRP7DUhfpV n63B71aj3/g659E/sNB8kUpSg+w+I+y89XHuxWS/8I3PpX9prHxH2Xnq492KyX/h G59K/tNBVuILJLjVtFJuL2MT3TQSrBezQqyCCZwMIwGdyqc9vLGccq1Wu6/qSaFf 3KPFHBP3daQLErLNC8Mc5EnSbsHJgPIKMbhzO3nc3hjkeN5I0Zom3xllBKNgjI8h wSP3E1GbSdNe5uLl9PtGnuIzFPKYVLSoQAVY4ywwAMHyCgqt5xZrNvHqN4mnxCyi 7sjgaXYAXgWTBz0u58mI9QRrgEncQuWza/xLq2hxPK0NpJ3Jbi5u1jHIBmYIm55E xnYVDAOWOT0a9VWsjaTpr3Nxcvp9o09xGYp5TCpaVCACrHGWGABg+QV7utOsr50e 7s7e4ZFdEMsSuVVxhgMjkCOR8ooKxccT6lp1nNqdytpPam4vYI7eONo3XoBOwJkL MDkQY/JH5WfFgydR1bWtNEVmDZX1/cTIkXc8W1kUpI5LRPKMj8SwB6Rc5PLqYawr aWy7NtvEOjkaVMIOq7btzDyE7myfHuPlqMmh6THYSWEel2S2crb5LdbdBG7cuZXG CeQ+oUHjRbu9vrFbi8SKJ+tG0SYJV0dlYkq7AZwOoCdpyCzeKVf+Drn0T+w16gtL a2x0FvFFiNYh0aBcIudq8vEMnA8WTS7jeWynjjRnd42VVUZJJHIAUFZ0ULDZcMCA abcapMmjvDJLM0eoW0Gy3EscCFCZICqyszK4X8ZMCOq2bJwJ3H3x0TuLoO7u8knf /oMdJ3Zm3x3Vjn02e6Mb+tnpP+arZwnBNpnBuh2F5FJHdWun28MybSdrrGoYZHI4 IPZW46ZfJJ9m3+lB/9Pv9Kx9Mvkk+zb/AEp0y+ST7Nv9KCucU9+2h6PRoNNk3Men e+uWiCABMbdqNnJ8uMftzyqXcnGX/lcMfzOT+1Vq4t4g0nRLInVNQgs+6SRCJ22m TGwnAPPl5f3eUVz2Pi7QE1Wa6fi62e1eNVjsyYwsbeNgwG455cieXW7cjaEnhRbh LjiFbvufugaoek7mkLx56CHO1iqk/V9fbW6stOstNhMNhZ29rEzbykESopbkM4A7 eQ+qtFwfd299Jr91aTRzQSaozJJG2VYdDD2GrNQKUpQKUpQKUpQF+lWfrcHvVqPf +Drn0T+w1IX6VZ+twe9Wo9/4OufRP7DQfJFKUoPsPiPsvPVx7sVkv/CNz6V/aax8 R9l56uPdisl/4RufSv7TQR6UpQKUpQKUpQKUrTx6LZcQfKHa2GorO9qNKnm2RXMk OXWWIAkxspOA7dvloNxStvZ8A8OaTewX1paXIuIZFKGW/uJVBzjO13Knt8Y5Hn2i qPxbrF3olvp91bFOjF0TdKy53wJDLI4H/NhMrzHMDJxmgsNKod3xje2ur6lMydJY 2+e54EIQt0cd50m8lWPN7Y4wRyCH/Ep3c3ElxaTXYutKeOKzse77hhOrMiHpcJjx yfixyB28263VG8LDSq3NxHf219FpsulRPqEsiKqQ3e6MK6TMrF2RTyMDbhtOAQRu PVrxxPf6hbanZQ2ban0TWtzPKmmxwPK2wxAHEoOR125LzJI5Ggs9Kp/4WXlnFbQt Yy6hKbdbqR7dHkZoXZxHjoUdDIVTnkohb8k7eYn3PFUdmJxLauZbVrlrmJHBaOGF N/SAkAMWDwdXPLpf+VsBYaVVYeLL6VoYe8couZrgQRhjLFGcxyPndLEhOOi62FOA wI3Hq1JueJpLK7v1utOdLazhkmLCQ9K6Iu4sFZQjL2DKOxBdAwXJ2hYaVp9C1m41 buhbnTpbR4tpDFJQjhs8gZY4ySMcxtwMrzOSBpJ9T1LTLG8n1G/vYryO1mlNu8MQ gkKxs3+zyhDg5UlRIWbapLJ/xALnSqlqXFVxaSW933K6aWl1cpJIjqzyLBFPvUqQ NpLxZUgnIXmVzg7XQtZuNW7oW506W0eLaQxSUI4bPIGWOMkjHMbcDK8zkgBuF+lW frcHvVqPf+Drn0T+w1IX6VZ+twe9Wo9/4OufRP7DQfJFKUoPsPiPsvPVx7sVkv8A wjc+lf2mvOvo0r3UaDLNAFA8pMYr8ue6JrqaVbQhXdmGbmDOCfSUGKlOjuvNf6mD 46dHdea/1MHx0ClOjuvNf6mD46dHdea/1MHx0ClOjuvNf6mD46dHdea/1MHx0Cve mw2tnr41qSSbulLV7RI1QFNjMrEnmDnKLj+Pbnl46O681/qYPjp0d15r/UwfHQWM 8QQNgMJMAg8ox4jn/FVWmtYbiW3llTc9vIZYjkjaxVkz+3quw5+Ws3R3Xmv9TB8d OjuvNf6mD46DTycLaNLBHA9nmOO3W2VelflGqSRhe3/DNIM9vW8oGJ76faSzXEsk CSNcwrBMH6yvGu4hSp5Y67eLnnnUno7rzX+pg+OnR3Xmv9TB8dBrbfQdPtpY5ljl eaKTpElnuJJXB2sgG52JIAkfC5wNxOMnNTGtYXvIrtkzPFG8SPk8lYqWGOzmUX6q zdHdea/1MHx06O681/qYPjoNU/DmlOkaG3dY412dGkzqjJkkRuobDxjJARsqASAA Dipj6faSzXEskCSNcwrBMH6yvGu4hSp5Y67eLnnnUno7rzX+pg+OnR3Xmv8AUwfH Qa230HT7aWOZY5Xmik6RJZ7iSVwdrIBudiSAJHwucDcTjJzQ6BpjXMkz23SdJv3R SSM0OXBDkRE7AWBbJABO5s/lHOy6O681/qYPjp0d15r/AFMHx0EOx0u107pDAJWe TG+Sed5nIGcDc5JwMnAzgZPlNQzwvpDRyRNBK8LxvEIXuZWjjVlKkRoW2x9UlRtA wCQMA1uOjuvNf6mD46dHdea/1MHx0Gqk4b0ia77qlskkk3OwDszIpdWV8ITtAYM2 4AYY8zkgGpNjpdrp3SGASs8mN8k87zOQM4G5yTgZOBnAyfKamdHdea/1MHx06O68 1/qYPjoC/SrP1uD3q1Hv/B1z6J/YalRQ3LXVqWgVFW4idma5hwArqSeTk9gqLf8A g659E/sNB8kUpSg+y9U+nv8A5E/6BUOpmqfT3/yJ/wBAqHQKUpQK1i282o67qMTa rf2dvaWlrIqWiwdZpHnDEmSNz2Rr2Y8dbOoen+Htf9SsPeXVA7zp+kXEH1Wf9ine dP0i4g+qz/sVMpQf/9S5950/SLiD6rP+xTvOn6RcQfVZ/wBiplaQvfapqN+ltfvZ LYTLCqrEjrMxjSTMm4Z29cDapU8mO7mNoT+86fpFxB9Vn/Yp3nT9IuIPqs/7FaHh riebWrySNocdJ0dwqswAhia2hfapxmQ75OfkBySMoGtVBD7zp+kXEH1Wf9inedP0 i4g+qz/sVMpQVHUb680vj7h7SbfVdQubS9S4a4W8WA52oSoXo4lI5jPac8v43yEW 8WnCeS3WVjKU5swwMA+I1znX/wDevwj6K6921dEPgZPWG/6RQO6rT83x/av/AK07 qtPzfH9q/wDrUOlBM7qtPzfH9q/+tO6rT83x/av/AK1UtPvLyXSYeIp75+55rXup 7EpGI40KbgqudpDDllmbaetyUEbYcHF95c3EdlHpKLfvMiBJpJoY9rRyuG3PCr5/ EOMBMcx1u0ALz3Vafm+P7V/9ad1Wn5vj+1f/AFqpW/EV3fStFZaYkstupN2jXO0g iWSIiI7cOd0MmNxQY25Iydut1PjG67l1hbOwuI1t4btYbsRSMElhV+s2Y+j27kIG HYklQVGSFC/91Wn5vj+1f/WndVp+b4/tX/1qHSg1+t6q0WsaDaWsEcEd1cyLOQSx ZVgkYDmeXWAPLny8mcyL/wAHXPon9hrT65/4l4Y9bm/+vJW4v/B1z6J/YaD5IpSl B9l6p9Pf/In/AECodarUuO+FHv5CnEFgwAVcrMCMhQDg+PmKifhzwt+frH7UUFgp Vf8Aw54W/P1j9qKfhzwt+frH7UUFgqHp/h7X/UrD3l1Wr/Dnhb8/WP2oqua9ccH6 9f8Adb8Z3FmxiSNo7K+WNHClypYbTkjpG+v99B0Olcn71cFfrA1X+Zr8NO9XBX6w NV/ma/DQdYqBe6NY6jMJbmJ2bbsYLK6LKvM7ZFUgSLzPVYEdZuXM55t3q4K/WBqv 8zX4ad6uCv1gar/M1+Gg6Yul2SXzXqw7blpDI0gYgklFQg8+wqidXsyqnGQDUyuT 96uCv1gar/M1+Gnergr9YGq/zNfhoOsUrk/ergr9YGq/zNfhp3q4K/WBqv8AM1+G gsGv/wC9fhH0V17tq6IfAyesN/0iuS6VbcEaVrVpqo4yubue139Et3epIo3KVPLa D2HxHxCt9qfE+gaiYxHxw9lEmSIrWaEKWPax3IxJwAO3HLs5nIXClc/756B+sa++ 8Qf2qd89A/WNffeIP7VBbjoGmNcyTPbdJ0m/dFJIzQ5cEORETsBYFskAE7mz+Uc+ LbhzSrS7W7it3NyrK/TSTO7syq6gszMSxCyuOeeRA/4VxVO+egfrGvvvEH9qnfPQ P1jX33iD+1QWuThzSpTlrdwCzs6rM6rLvdnZZAGxIu53O1sgbmAGCRSbhzSrh7gz W7us6yK8ZmfoxvBDsqbtqMQzZZQCdzc+sc1TvnoH6xr77xB/ap3z0D9Y1994g/tU HQKVz/vnoH6xr77xB/ap3z0D9Y1994g/tUFg1z/xLwx63N/9eStxf+Drn0T+w1Sb fUuF4tStL6443lvGtHZ4o7ieEqCyMhPVQHsY+Otxd8a8My2U8aa7YlmjZQOmHMkU HzNSlKD/2Q== ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=tutori10.jpg Content-Type: image/jpeg; name=tutori10.jpg Content-Location: http://zippy-egoboo.sourceforge.net/images/tutori10.jpg Content-Transfer-Encoding: Base64 /9j/4AAQSkZJRgABAQEAYABgAAD//gAcU29mdHdhcmU6IE1pY3Jvc29mdCBPZmZp Y2X/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0aHBwgJC4nICIs IxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIy MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAAR CAHOAj8DASIAAhEBAxEB/8QAHAAAAgMBAQEBAAAAAAAAAAAAAAYEBQcDAQII/8QA XBAAAQIEAwIGCwsHCAgGAwEAAQIDAAQFEQYSIRMxBxRBUVRhFRciMnFzkZOxstEW IzM2QlJVgZLB0iQ0U2JjcqE1dIKUouHi8CZDRFZ1s8LxJWSVo6TTN0WEw//EABoB AQADAQEBAAAAAAAAAAAAAAABAgMEBQb/xAA0EQACAgEDAgQGAQQBBQEBAAAAAQIR AxIhMQRBFCJRUgUTFTJhsXEjgZHw0QZCocHxM+H/3QAEACj/2gAMAwEAAhEDEQA/ AL3H+PqzhnEUpS6VINzi5hrMlGS6r8wAGvPFF2ycd2B9z8nqbAbZF781r3iv4Y30 SuP6K+4qzbaEqWf1cwv/AAiql1HirKlL7jar2jgOq0gItrzak+WO2enHjg9Cdrl3 6v8AJVbtlqjhkxa5OPyiKC2qZl0rU80ltRU2Ed8VC2gHLzRzXw14nbkm51dGYTKu rLaHig5FKFrgG1iRceWF7g8xFJ0jHU/V6mpktcUmVZHFBKXlEaI3Hvt27lhtqVbw BUE4WpssppFDkp6YC23VKuoFsFC1ggEJLhtryJ5o9J4MUWk8Xa+/oylv1K5vh1xA 64ltumSilrISlKQSSTuA0j7muG/EklNOys1SJdl9pRQ404kpUhQ3ggjQxzlFYRZU h1CqQmuIlZVSrqHFg4Hjtik95m2eTd125YlYinsEzrVXm20U+cmpiYnlvPuTWzUF FXvJQMilKFrWy2F73PNb5PT6q+V/v/At+p65wxYuaqgpjlAQmfKkoEsWlBwqVYgZ bXubjyx1d4WcasPPMu4byOssGYdQplQKGhvWdNE6jXdC7WsQtp4bF1qkVGRDe1aD c0+SWCNilCgopBIG9Nxu36WvFvh+o4To9XmOOziDKO4ddZmpZuYU82h0uoOyaJVr dIvYK54S6fCop/L5SfcW/U87d2JeJib7ES3Fi5strlOXPa+W9t9tbRy7fFd+jpOP aInBknLTblVVQ5uaTPzLjYTcNra4sFNAC9wnPpbeDcR8MjBTu1eIora36Ow64HFL ytzORW0SlA3agXynMCQQCLiJ+T01v+k//It+p9dviu/R0nB2+K79HScZRBHV9P6b 2fsrqZq/b4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pv Z+xqZq/b4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ +xqZq/b4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+ xqZq/b4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+x qZq/b4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+xq Zq/b4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+xqZ q/b4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+xqZq /b4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+xqZq/ b4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+xqZq/b 4rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+xqZq/b4 rv0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+xqZq/b4r v0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+xqZq/b4rv 0dJwdviu/R0nGUQQ+n9N7P2NTNX7fFd+jpODt8V36Ok4yiCH0/pvZ+xqZq/b4rv0 dJxLpPDNiSsVeTpktISCX5t5LLZcJCQpRsLkDdrGOww4D04QMPf8RY9cRTJ0PTxg 2ofsKTN/M5j8GxOGb+Pc/wDriG5XsbtTzkqtWG0lqWM044p9wIQ2CBcnZ9f8I9qW KBJ1hUmikVGZQVAcZYQgta9ZUDpy6RHqn5RNVxtkha3KC62gA98orAA8MfOfNXtX +/3NqObONq9MvtsMV3BLjrighCEVBRKlHQADJqY+aPjHGdbqVWkpVqhJVS1pbfcd cWlCirNbKclz3p3gRwm10mYblW5KkKamBNyyw5xHZ5Ql5ClHNbTuQYi4CcbTW8eF eVSTMsWSSO6+F010jSE4uMm4rZfn1X5IaGfsjjuyTtcL2V3v5S5r4Pe4Q8S4zqeJ cB4hYnUsNqkpxtgmXvlXZzU6gG1xyxb0SizchWWJ2Zal1yiyvYygfv2Nvr3NzZV+ W269hpCKr4m4y/4qn/mGKqUZwl5UqX/tEmsY3wRTMVVhExPvTSFsthCQytIFrA63 SYVjgPCwbVSjiKcCUKKlSvHWrg21unLzRp1S/P3PAn1RCY0ifl5WrOsPXWqZcLLC WQV6rHdA8otfkiq6jKoqKeyFIpW+CLDTraXG5yoLQoXCkvIII8OSPrtPYd6VUvOo /BEygmuMzkjLu7ZmWbbbSGDLKylGzGYlVrBWfMLE30Hc8sOsaeO6j3sjSjNE8GGD lzhk01eZVNC4LAmmisW1Pc5bx2PBLhcPhgz8+HSLhvbt5ra8mTqPkMXdOmnWKjVW ErdLy3nlMNKk1hJVvB2tspBtuvyxSzTVUmpx4s9lHEOtS4fcdlSgpKFOKUEXQLgX BFr3Jtruh47qPexpR99p7DvSql51H4I+O1Hhm6xx6oXb7/39vudL69xppGhjcN/1 wv1mXe4+US6glFQQJd8hVtkQSc5tzozC55Qgcujx3Ue9jSj/0OTXBJhh9GdqeqDi L2zIfbI9SPvtPYd6VUvOo/BE9T9fTVUNNF1mUS6oMpTKlSVjarFiQLJSEBFiSm99 CYlU53EKpmSRNX2ebI8rLa+zSUrJ00C1m45wARvjq8d1HvZXSim7T2HelVLzqPwR H7VuEeO8T7KTfGrX2HGWs9rX73LfdGkwphY24kdm7xkVQzF9krJs9oVX2lsu7kvf kteHjuo97GlFV2nsO9KqXnUfgj5b4IsNOtpcbnKgtCwFJUl5BBB3EHJEmnvVKpt0 l/bT77IW0/MOOMZMi9RZHcDMg31IuLa3G+BE7iQ0pCvy4VAy11NmV7hKeL3Ch3Nt ptbDLe+/uYeO6j3saUcO09h3pVS86j8EHaew70qpedR+CLp12sS84GNrOOtomQlL iWAdoChB1IFgkEq5hpYqBtdnh47qPexpRn3aew70qpedR+CDtPYd6VUvOo/BGgwQ 8d1HvY0oz7tPYd6VUvOo/BB2nsO9KqXnUfgjQYIeO6j3saUZ92nsO9KqXnUfgg7T 2HelVLzqPwRoMEPHdR72NKM+7T2HelVLzqPwQdp7DvSql51H4I0GCHjuo97GlGfd p7DvSql51H4IO09h3pVS86j8EaDBDx3Ue9jSjPu09h3pVS86j8EHaew70qpedR+C NBgh47qPexpRn3aew70qpedR+CDtPYd6VUvOo/BGgwQ8d1HvY0oz7tPYd6VUvOo/ BB2nsO9KqXnUfgjQYIeO6j3saUZ92nsO9KqXnUfgg7T2HelVLzqPwRoMEPHdR72N KM+7T2HelVLzqPwQdp7DvSql51H4I0GCHjuo97GlGfdp7DvSql51H4IO09h3pVS8 6j8EaDBDx3Ue9jSjPu09h3pVS86j8EHaew70qpedR+CNBgh47qPexpRn3aew70qp edR+CDtPYd6VUvOo/BGgwQ8d1HvY0oz7tPYd6VUvOo/BB2nsO9KqXnUfgjQYIeO6 j3saUZ92nsO9KqXnUfgg7T2HelVLzqPwRoMEPHdR72NKM+7T2HelVLzqPwQdp7Dv Sql51H4I0GCHjuo97GlGfdp7DvSql51H4IO09h3pVS86j8EaDBDx3Ue9jSjPu09h 3pVS86j8EHaew70qpedR+CNBgh47qPexpRn3aew70qpedR+CDtPYd6VUvOo/BGgw Q8d1HvY0oz7tPYd6VUvOo/BB2nsO9KqXnUfgjQYIeO6j3saUZ92nsO9KqXnUfgg7 T2HelVLzqPwRoMEPHdR72NKM+7T2HelVLzqPwQdp7DvSql51H4I0GCHjuo97GlGf dp7DvSql51H4IO09h3pVS86j8EaDBDx3Ue9jSjPu09h3pVS86j8EHaew70qpedR+ CNBgh47qPexpRn3aew70qpedR+CPU8EGH0KCkzdTSoG4IeQCP7EaBBDxvUe9jShC 7UlC6fVvPp/BB2pKF0+ra6fDp/BD7BGfiMnr+iaQhdqShdPq3n0/gjwcEdBTmyz1 VGY3Nn0an7EP0ET4jL6ikIXakoXT6t59P4IrsV4UkMK8HtUakXZhxL77S1l9QUbh Q3WAjToTuFD4iTnjGvXEVlmnJU2KRoU800Zhx11xaRcJASgK+SOsRVNUmisTHGGZ dDb+p2iJRAVrv1Crxa1L5XjB6iYj4kxA9QWW1tMbYHYtoaQhGZSl2A1PWYyJPnJK /pnvND8UGSV/TPeaH4og+6bEn+7M3/7Htg902JP92Zv/ANj2wB9JotCRMCYRKNJe CswcEmgKvz3ve8TMkr+me80PxRB902JP92Zv/wBj2we6bEn+7M3/AOx7YAnZJX9M 95ofiiHMUehzbpdmZZt5wixW5JoUfKTHz7psSf7szf8A7Htg902JP92Zv/2PbAE1 LcmlISl10JAsAGRYD7Ue5JX9M95ofiiD7psSf7szf/se2JslWqvMMOOTcgqSKVBI S8hslVxe4y3gD3JK/pnvND8ULc7L0iTkHqmKPJrW0C58CgKJB33tvizkXnJhL7jq ipZfXcnwxR1ouJwxOE5ggNq1O614iXDZaKtlWjhCabQlDdJyISLJSl4AAfZjg/wo IZcydiVHS9+Mf4YSkuIWbJWlXgN4rKgq00dbaCOKObI3ybvHE0w8JaA3n7FK3Xtt /wDDHjfCahy//hShb9v/AIYRGy2ppIJSbpHLGh8G1GplRYqJnJJh8oU2ElxANrhU WhknJ6bIlCK3o//R0Kgt9nKHLVMHYh9JOzPdZbEjfpzRGxBMdgaM9USnbhspGQHL e5A3688Xss2zIyqZaVSlllsEJbRoE8u6Kl5LMw2WqoEKkz34mNEdV76b7Qp6fyXp WIDnCahu3/hKjf8Ab/4YdzMWwqa5l04lxvY3/Uz5b/wvaEThCkqKw7T+xbUmAUub Ti5Sfm2vb64XTXqrxAyRqExxXZbLZZzlyWtltzW0jl+c4NxluafLT3RfHhWbA/kd X9Y/wx9I4VG1i/YhQ/8A6P8ADCFMoYDYyhF78kfDNPnZpBXKScw82DYqabUoA81w PBELLNqw4R4N7l5vjFEl6lkyh5lDuzvuzAG1/rikq+LE0pLSjJl3aEj4S1rW6uuJ NPWtnCMi08ooUiUaSpK9CkhI0IO6FjEDkqtDG0caNiq11DqjsXBlSGCRxUmdlEvi TKMxIttL7j4IvZV7jL6GsuXPy3vaM0li7sBxbMWtbbPUfwjUadLlLzCtkQbb8vVC hRRYqxEMMTbDCpUzG2QV3C8ttbcxhbPCegOZexKt9vzj/DHxwwqcRWacAVJvLq9a EuloadnZNLoSrM6gKCuXURyzySjNo1UItD8eEZAH8lq8/wD4YrqhwttyDiEmjKXm F/zm3/TFzwqUen0vBTkzT5JmXmA+2kONIsqxJuIxeSWiYQozqkrUDZO1OtvrjSMc ie7KPRWyNdb4SkOUsTvYpQBRnybf78sV/beb+hVf1n/DGbMOzQqLbWZ3iGcAjXZ5 fRaLWookNkji+wKs2uQgm0TJtK0RFJjy3wsNrTfsMof/ANP+GLOn8ICJ6cl5cU1S NsoJzba9r/0YzGTbYLHdJRe/LF9h9Kez9PFhbbI9Mc/zpaqNvlxo0Gu4rTRCwDJl 7a5tzmW1rdR54v6C72bosvUQNiHs3vZ7q1lEb9OaPtmj02o5jOyTD+TvdogG19/o jO8UVWoUXEc3TqZNvSkmyU7NhlWVKbpBNh4ST9cbzk8b1PgzUVJUuTQa872Doz9R KdsGsvcA5b3UE79eeK7CtaGJxN5WDL8Xyb1582bN1D5sKuHX63Vq5LyVWM7MSTmb aNPpUUKskkXv1gGNKpdKlKZteKybcvtLZsiMua17emEJSm9S2QcUlQOyJbaWvaXy pJtbmiHJK448W7ZLJvffHSZmV7Z1BdOXMRa/JEZtxDCsyFpQd1wbRtRSiVMtcXWE 3zXF+aKus1QUikTM+WdqGU5sma19QN9uuCddmnnUqaU44AmxKLmM6rPuhmZqcllN 1ByVU4oZNmspIvpyRnknoRaEFJk7tsN/Q6v6x/hj0cKzZH8jq/rH+GEapU5+SQ2p 6TdYCiQCtspv5Y1Xg6w5RqjhBiZnKZKvvF1wFbjYJICtIxhOc3Vl5RihtW3kpgnL 3BbC8nh5LxXNVEOEjZWt+tF1Uy0mkvNoKAAiwSDujPqtMPS7bZZcUgkm+U2vHVRl QzGpgOZNly2vmjjXq0KHSlzxYLwSpKcgXl3m2+xiok3FuSTbi1FSym5Ud8VGJ35h 6iuIdWtSM6dFbt8Vm6i2So26OrfCYhwH/wAKULft/wDDHw5woIQSOxKjb/zH+GM6 myppSQ2SkEa2jh74pOZQURykiOT5s+bNXjilRpjPCgh5RT2JULC/5x/hhhpOKE1W UMwJQt2WU5dpfkHV1wlcFktSZrEE4irolVsiVJSJkgJzZ07r8trxqTtOpSF2pUvL cXtrxcApzcu7l3RticpbtlJKKVUfc4OKUV6o98GmC9s917Jva8VOFa2MTmbysGX4 vk3rz5s2bqHzYY6+htOCqgAEgiQXpzdwYzjg4dW2alkUU32V7f04tKTWRR7BRWls mYixwnD9dmKYaeXyzl98DuW90hW6x54V0cNTa1hPYFYv/wCaH4I+caJDuLJ1bgCl HZ3J/cTCJT5JpM+2p9gJa1zFabDceeKRyNyaDgkrNhwlj1GKqo7JJpypYtsl3OXs 97KSLWyj50OUZlwftyaMTOGUDP5m5m2ZHz27XtGmxsjNhBBBEkBBBBABBBBABBBB ABBBBABBBBABCdwofESc8Y164hxhO4UPiJOeMa9cQBoVS+V4weomKLHXeyX86k/X TF7UvleMHqJiHiKRZn5hht5TiUtlh4bMgG6LKA16xAF5/n/P+f43jz0f5/z/AHRA 7Io+a55R7IpTjukB1xCU1FZbcU2otyTq05kqIIuEWNiDAFU7VnJGbnHJSbcqNRQH lbNucWctgbB2XUbNgWHdADUJF+61irxTXElmYD8i5dDqds29+T5M7PvqjfL3OZab g2Gut7iL/wB3VK/RVX/097/6+uPhzhAozWXaJqaM6glOaQeFydw+D6oAisV+rTTb bL0/T5OYWynZDZlzjVyoFbeouAkJVoCmx35NYYMLTDs1hSlPvTQmnXJVtS3gb5jl F76m5vv6+u0Vnu7pW/ZVXn/MHvD+jg93VK/RVX/097/64Aaf8/5/z98Qah8F/SHo P+f7o4ytZZnJRuZabmQ26CU7RGzVobHuVJBGoO8fdHk1NpfbCUpUDmuSo3/zvgCm pfwD3j1+mIWJhfg9qI/8sr0xNpfwD3j1+mKzEr5GBKgmw/N1emD4ZaPJiVPcTLOL U5exFhaPieUJiY2iN1gNY5IWVE6R9xw8Ozp7GhSfBZiN2UYmk8T2a20uC7xvYi/N D9gTDc/h1meTPbK7ykFGzVm3XvydcLmF+FGoz0/S6KunyqWVlDBcBVmsBa+/fpGr stBwG5ItHTjjBvUjJtpUQnGVqcKha0VuK6XMVnDsxIyuTbOFBGc2GigT6InTc4qX mltJSCE8p8EU9dxI/SaQ7ONMNrWgpASom2pA++NZ1pd8FVzsZVXcOT+HlMJntld4 KKNmrNutfk64XX5toNuoOa4BG6NTkUDhKC3J88UMjZKAxrmz773/AHRGaVukNSVS qMuhxaksPOoBNrkJJH3R58oJeZcG6be3co9qlegvGl8HmNKThygzEpP7farmlOjZ t5hYpSOfqMZk20Aq9zujRcC4Ek8T0V+cmJt9lbcwWglsCxASk31/ejWF6vKUlxuP dTlXKpQ3KhL22EyhLzeY2OVRBFx4DGZ4ko80G5fvN6vleCNWzmTpaKOkZmpdtLCV nviEWAJ69ISMYji7UoU65lK3/VHYZH//0vjC35JQWWXO+ClXt4TGpTlUl6NTF1Gb z7BhAUvILmxsNB9cZlQGw9SGlk2JKt3hiHiDH87UqHN01yTl0NuJCCtJVcWI6+qK zyKC3NIxb4IXCPiqnYnqUk/T9tkZZKFbRGU3vfnhSkpluXn5Z5d8jbqVqsOQEGIa 1kkaR9pQFJBvvjkcm3ZfSktzRuEHH1Fr+FlyMlxnbF5CvfG7Cw+uMmFMmKl3cvks jQ5jaJ8wyFtWJO+J1FaDTLoBJuoRvjeuXmKy2WxGdnmZWhLprmbjCWig2Gl/DFJT EkPLv82OtTcKqw+1YWK7Xj1hsMKKgSbi2sTkezQjzY+YawFWcSUoz8hxbYhwt++O ZTcW6uuOtGl3JPFEpLO22jMyG1WNxcGx9ES8E4/ncO0EyLEnLuoLynMyyq9yBzeC HJGDZUITiPjT23UOObKwy5j3Vue2sY6VJrTyuS91bY0yUw2wF5762tYQk4iwXVa3 iCZqUpsOLvFJTncsdEgHS3ODFzKVJyYz5m0jLbdDDJTKuJt9yOX0x1TgpqmZqTXB 0kZVyXnEOrtlTe9j1RZPuJcy5b6RB4yr5ojoy6XL3AFouQU81TJhTzzwyZSoq38k Vz0o6tFhlvfni9fnlhTjWRNtU3iPKsB90oUSBa+kAe0RJlZVxDm8rvp4BFwgbS2X l3RVvp4moIT3QIvrC3TsczjuLkUcyjAaDyms4JzWF9f4RWU1Gr7kpNnfhGwnUsRy kg3IbHMy4tStovLoQOqKzD9alMC0lFCrG0440pTitgnOmyjca6RpDjpcAuALRh3C VMKbxm+kJB96b9WMsqcfPHkmLT2Zpj7KpiUUtFrLTmF+Ywq1ynv7Jnve+PLDw0yB SGl3N9ik/wABFTOSaJxKUrUpOU30jYqVVNpz5kWB3Oo5+uPqt4RqdQpi5dnYZyoH ul2Gh8ES25lUmtMulIUlBABO8xLr+JpikUpc20w0tSVJGVRNtTETrS74Jjd7GN4q oU5hl+WbqGzzPJKkbNWbQGKrjTZkCNe9PJF3jSvv4qmZR2ZZbZLCFJAbvrcjn8EL BGVot8lrXjikoPjg0t3+S5whRZvEVSelpHZ7RtnaK2isotcD742nCNPew3R1yU/l 2ynlODZnMLEAfcYxbB+In8K1J+clmW3lOs7IpcvYC4N9PBG0YTqzmLaQuozLaGHE vKaytXtYAG+vhjbFGF2uSJt8FtWfy6hT0sz8I9LrQjNoLlJAhNwlQpyimc43s/fc mXIq+7Nf0iHt2WSiXXZR0SYoZuZVL5MqQc198bOCclL0KXtQoYgwpUqnW5ibl9js nMtsy7HRIHN1QiVWTdmKa8yjLmNrXPWI26XdLzCXCACb6Dwx+dXMWTKypBl2gCec xCjGFv1Dd8jnwT09+RxLN7bL3cmq2U33LRGwRkXBVUnKhiSbzoSnJJqtl61o9ka7 CNdijCCCCLEBBBBABBBBABBBBABBBBABBBBABCdwofESc8Y164hxhO4UPiJOeMa9 cQBoVS+V4weomPiq/nifFI9UR91L5XjB6iY+Kr+eJ8Uj1RAEGOGCDloU4QCoiozZ sOX35X+f86d44YIzdgpzLbN2Rm7X3fCq/wA/5MAfUpjWQnTTmmWJhU5OPFlcnZO1 lsoOZTib6JFhc/rD6/MZ/m9I/wCJsen/AD/nQRafhGoSFTla0KilVYedtVXFZi1M M/MSj5OU5cp0O+97xLxnfi9Itf8AlNjdfnP+f8mALKr1yXorknxttwS8y7sVTIA2 bJI7nOSdAToDznfyx7R62xWxNrlW3Qww+WUvKAyPW3qQRvF7i/OD9f1Xqcaxh2pU 1C0oVNyrrCVqFwkqQQCbc17/AN0dKRImmUWRkVFJVLS6GlFIsCUpAJH1/wCb2gCP Ue/a/dPrqiHEyo9+1+6fXVEOAINL+Ae8ev0xT4m+I1R8Qr0xcUv4B7x6/TEDE8mr tfVF7MLcWUbfXB8Fo8mCM6k2jm+pxLtkkgW5I9S8GTcgm/NHinA6cwFo5Ut7Nr2o 0rC2FqsxVaZPGmPJbCkObXLpa17w54rOK0uSvYdU6E2VtNieXS1/4w20b+Qqf/Nm /VEVmJcWS+GnJdD8s68XwojIQLWtz+GNdEYQdsrqbfB3w8xNLw/KrqyFqnilW1Lv fXzG1/qtEVblJKSKupkyXy9r3t+S/wBdopk8KMg4oIFPmQVG3fJjzHNOXJYTmn1O JUEqRoOtYEWU4uD070Q073KrGNcpdJckxhSdalkuBfGOKG2Yi2W/lVGdTs6ZnjLr jxW85mUpROqlG9z5Y+VflWqe5y88cVSCzc50xxSlbtm0duCtZz5zmva0bxwM7P3I zme1+Pr3+LbjFhIrB79MbNwStFrC00kkH8tUdP3ERthdzKzTSLPEQUiWnly+jgUc pTv76EOYYnZ8JEwhx4I3ZtbXjRKkyZgTDQIBUo6nwxRrkFydipaVZuaOwxItIkHm qc2gMKSATpbrjJpp5SnHUZye6On1x+gqVJKep6FhYAJOh8MfnRxY7IOJt/rFekxh nV0XgfGRZ5DFiyGeLpCgnPb+MR4dqfwcTs9Qmquiel0trZLwQUqvYa2/hHPocuC2 sTkNhKrvpsj9aK6rTipZ1sSbxQkpuoIO8xazpzS5HWIoJ2XLi0kKAsIYpea2TONR pEdTiHElxSgp86lR3kxZ4do1Urs26zIyb02ttGdSUC9he14pkNnjAbuL5rXjRODT ELOEaxOTUww4+l6X2YS2QCDmBvr4I2lX/czONvg//9OVhGl0Ki0UyuKJWWlqhtVL CJlPd5CBY+DQw3TEwk05aWXPybZ2QB3uS2luq0KFVlFY+nOzMmoSrQSGNm9qq6db 6eGGCb/8Pw64F93sJaxty2TGeK/TY1kUE6qZSUcRKxvz5P4ffDZQWKg5Rpda0OqU c1yf3jCXSau3OB3K0pOS288940CjV5mXpTDKmVkpvqCPnGNipbbJHzRHiltMd8Uo v/GOkV9T/wBV9f3QAuPioOVlez2qmVP9zbcRmi7UzMyo2hQtsbrx8S5tMtHmWPTH TGFdapNGRMOMrcSXkoski+oPsiG0lbCVnaWcZcQTMqSpd9M3NEZ2Rw/TnF1Z2XlW VtnaKmCLEE8t/rimolaarcq5MNNLbCF5CFEcwP3xa1iiu1nDj8i06htb7YAUoGw1 B+6ItSVrcndFHiWuTNYZl0YTnlzDraiXxKq1CTuv/GEiewtiqqTRmpumTkw6oAFx YuSBDDTZNXBetyZn1idTOgNpDGhSU6638MaHhzEDNbo6J5phxtClKTlURfQ2jBwU 5bvf0LpuKuiGnEVCVTUSaKhLmaDaUbMHXMALiK52oybABdmEJB3XMUkvwczrNYE6 Z6XKdqV5Qk31v7YkYgw882yyS+2bqPIY1xuTXmRSSXYtm0y0wkPoCFpVqFDlj2ZN MDJ7L7Hil+62ve35I5Ulks02XZJBITa48MQOECVVKYTedUoKAcQLDwxabqLZC5ET hHNFM5IdgeL7PZq2uwGl7i14Uk0yffY2jcs4oKGhA3xZytPXVkqW2tLYbNjm5bwx SY4lKNyyu6U2LEjcY5VHV5pbG0VKTqG4uYdo76Z101CUVs9n3O0Gl7iHeQnJily5 l5F5cu0VFRQ2bC/P/ARC4yn5pjohYWm4Fo6IOHCIninFXJF3I1yeVUJcTM84WC4n aBStMt9bxfVaoUp3Y7F9lVs18v1QkQRoZHeos4mfnnHKQmbVIm2zLXe7he313jIW 6cqXeDs1L5GUk5lKGg/yY/QFHxTL02lsyi5d1am811JIsbqJ++MGqVdanZJ6XSyt JXaxJHIQfujJQSbbZLl2HrgtMmcRzXFdnfiis2X99Ea1GKcDKbYln/5mfXTG1xZF GEEEESQEEEEAEEEEAEEEEAEEEEAEEEEAEJ3Ch8RJzxjXriHGE7hQ+Ik54xr1xAGh VL5XjB6iYKi0t6eSlAF9ig6kAWyjlMFS+V4weomOk3+fK/mo9SAIPFHPnM+eR7Y+ qbJopUstiWQ2ErdW8q80jVS1FSjv5zEaCALXbO/Na/rKPbESfk26khhMy22oMvJe RaaR3yd3LCBPYoqUsalLIQ2X0TWWXcydyGhfNm6xkUOa6kX3xat4mWdi47JBMu+j bNrS9mIazBJUsZRYgqToCeXXSAHXbO8zX9aR7YNs781r+so9sIzeKnXZ6XZRS3i0 4UFTl1dyhxZDarZbaiyiFFJF7akQyQBNmG3H1IPvCQlNvh0G+pPP1xXuOtNzok1O tmY2e1yJUFdze17jTfH3FIj47uf8PH/MgCbS/gHvHr9MVOI555WCahLHLsywpO7W 14tqX8A949fpiFiZk9r2orDevFlG9uuIfDLR5MEXLoIG/wAsdGpVvJy7+ePhhKio 3BOnLEpKgkWJsY47fBszT8NY3rD0/TacsscXJQ1o3rlAtvvHXhRdUuYpl7d456Uw xSNZws1Rpa01TkTCWEagJCgrKOW2+M/4Rp9mpv08yEwJgNpWFltV7XKbRrJf02nK xH7k6LzD2FabP0aUnXg7tlgqOVdhcKI+6HeelGsQyi6ZPXMu7Yq2ZynQ3GvhEUGC sQUSSwhTpScqEs1NISoLbcUMwJWq1/KI6YyMxJYYmXwpxkpUju0kpIuoDfGkVGML XoUduVCpjbC9Ow05JJp4dAfCyvaLzbrWt5TCnD5gKtUtbc/2anWHDdGy40rPbvr2 v9UZ3iGaYXXqqqWdTsVTTxbyHTLmNrdVo5ZQUvMu5opadjqpIAjWuCz4tTX88V6i IwdhTziyEqWo2va5jceCFK04Vmw4Dfjyt/7iIvhjpmTN3EcpuVaS046L5t+/rhZr Lim0M5bak/dDnUQHKU4hsXcKRYDfvELzUi+q+1l1HmzC8dpgTcOqK6K0Tvur0mPz 29IMCedUM19orl6439EvMNpyobWlPMnQR+bXVPcfcupfwiuXrjnzptKmaY2t7J0w 2ltQCb6iL+U4Qa5JUtulNGX4shvZC7V1ZTpvv1w0cFs/QZWlT6a07JJdL4LfGUgn Ll5LwvVoSczjZ9ckllcqubGz2aRlIuN0Y7ximmWStlA42lxOVW6K+blm0rTa+7nj Ysa4dmJnDqm6dTM0xtUkBloBVuXdGS1Ck1KkuIRUpR6XWsXQHRYkREsbgy2tSRTJ l2+OA63zc8aFwd4dkK9VZtidDpQ2xnTkVbXMBCIWHdptMist73jUOBRQGIqjnItx Tl/fEXjUpJMo00rQ9y9FlKE1xOSC9lfP3arm5/7RHrSAuiziDuLKgfJF7Vykzvc2 tkG6K5iUfVNILjKlNFWuYXBEa58+Pp8blJpV/Yok5MzGT/IAvY/LtfNru/7w+URI fpEu6vvlZr2/eMeYxoz0wqT7HyObKF59igD5tr2+uLXDy2JChy0tOFDMwjNnQ5oo XUSL/URGHQddj6zEskdm+17reiZwcHRK7IP/AKvkjsx+X5tt8jdl03/9o5Y0lnZj Cc61TmiqaUW8gZFld+m9rdV4UcFzD2HxO+6J5yU2+TYcaURmtmzWvzXT5RHU51LT RVRtWPSZFlKgoZrg3GsR6zRZSuySZSdCy0lYcGRVjcAj74jNzaX30vNPZ2FqCkqC tCknfFw24h5WVtQUq17CLtJrcjg//9RocpkvhlQlafmDTnvitocxvu+4Qp1LhDrs g9MMsKlsjKilOZq+gNueNLqrQ4wjOgXyco6zC/i2Qlm8IT8wZVlKg0DtNmL98Nbx TJF6fK6o1i99xewvOvcI70xL1/KW5NIW1xcZDdRsb777od5KUaw9LCnyNwwglQ2h zG51OsYK3NvMkmRfcbUe+2Kym/htG1cHSnJjB7Dk0pTrpdcupw5j33OYzwyTe/Ja aa27DCuacS0VC17c0UdZmXH2mgu2ijuESW8TUJubAdqcqAlRCgpY0iVMVKlVlKUU yYl5pbZusNWOUHnjdST7mdM+qZJtLp7DhzZim+/ritx7LomsKvNOXylxB0PXBMy8 6hp3Ih1KQk2tcAaRnjk3MvIyOzDq0/NUskRTLPSq9Tp6fD8x36ESSl0SCVpYvZZu cxvHZSipRJ3mPII5bdUejHHGLtII+0OqQLC1o+IIJtcEyipKmdkPrKwDaxMSYgRI lyTmuSd0b4sjbpnH1OBKOqO1HeMYcbSkKIveNnikxDJy6aFMluWaCu5sUoAPfCNZ razgPvgWlW1zFZmzfatIZaTrplUVk+omNcjIuCYKbxBOo1SlUqSU7gSFpsf4nyxr sRB2islToIIIIsQEEEEAEEEEAEEEEAEEEEAEEEEAEJ3Ch8RJzxjXriHGE7hQ+Ik5 4xr1xAGhVL5XjB6iY51h6ZZeWqUlFTb5l0pS0lQTe6QN5jpUvleMHqJjpN/nyv5s PUgBV22J/wDdlf8AWE+yDbYn/wB2V/1hPsi2zHnMfDrim2VrBJypJteAKJUpW1lR Vg9JKgoKu8nXMQVcnKUpv4BHiJGst8YyYNQnjAIes8nuwd4OnXEak4tfm2drMMKU ktoVZplxBS4vLkb98ACirNoQbaanUR3Ti9oTE7tZWYbl5VptRWopHdla0KSTmsLF BFybaHXdcDo5K1t2ZamXMIJU+13jheTdPg0iTtsT/wC7K/6wn2RWtY5klJmH1oWm URs0tOlaAHFqzXSCVZdChWt7GxsTpdgkZ9qoyTU3LrKmnRdJv/n+GkAQdtif/dlf 9YT7IjyUvUziZybqMiJK8oG0Nl0KUru73sOSL7MecxRpJON3Ln/9eP8AmQBNpfwD 3j1+mIWJZ0jg+qDWz3S6he/XE2l/APePX6Yzau1epOLnpBb6jJlSkFvILZb7r2vG eSagty+ONsQ2HbqOnJH04cyrx1nmm5dCFMpykmx1vHxLgONZlC5vHNzujd7PcusP sdmK5I0xStkJhxLZcAvlvy2hnxhhFGE3ZRCJxUzxhKjct5MtrdZ54SabNTEhU5ea lFlt9pYU2oC9j9cbDgtsY2anHMTJ48uVUhLBX3GQKvm7219wiIxUlp7kuT57GVIl wqaQvN8oG1o13H8yZzB02wUZMym9b33LEXK8D4aQ6ctMQLHT3xf4or8dsS4wjN7I JK8zdspue/EbxhKEJWZtptUYqyzxfMArNm6ojOUsOLW5tSMxKrZY0TBFEptTbnTU 5ZLhbKMmdRTa977iOYQ01fCeHJfD0/MMyTSXm5RxaFB1RsoIJB388YwxTcdSZdyj dGYYKwgiuVl2WVOKZCZdTmYN5tyki2/rh5XUzwbHsQ00J8P/AJVtVK2dr9zltr8y 9+uKrguWlOJ5gqUAOJq3n9dEajNYboldcEzPyaJh1A2YXtFCyd9tD1mNMcXKGqPJ E3Tp8HakzJqVOk5sp2ZmGUOlIN8t03tE11rZga3vGMVPFVbpNbnKdT55TUtKvrYY aShJyISohI1BJsByw14Ar1XrT08mpzK3w0lBRmQlNrk33AcwjSGdSenuUcGlZ7iP HzlCrTtPTTkvBtKTnLuW9wDut1xkFBpYr+J5eRU6WRMuKusJzZdCd31Qy8JBfGNp vIFZcje5P6gjhgyVDWLac6GlJUFk3sfmmMZyk51Liyyqthke4LWpMhIqy15tfgAP +qPqVwC3LzTLvZFStmtKrbLfY354eptSlrSSb6R6htGyCrd1a8dHyYehTXKqI+Ic QqodKVOplg8QtKchXl39doxjHmKl4inZR1UoljZNlNg5mvc35hGi46cWrDSwo6bV EVvB9hfD+IJGcdrEm3MONOhLZU6pNhbqIjPI3LJo7Fo0o2ZMmfKmgzsxqLXvGjcD gtX6h/Nf+oQj4ukWKdjioyUg1s5Rp/K2hJJAFhymLvBE9N06ozLks4ppSmcpOUG4 uOeKxjpmkS5XE1fEVZVIVMMhgL97Cr5rc/VHzT8WrmpuXlTJpSFqCM20vb+EKc5O zE8/tpp3aOWy3IA0+qIbEzMMTiHWllKkLuk23RXruhxdXj05FbV1zs/7FYTcHsaT Xa4qjFgJlw7tc29VrWt1dcKU3XFTc4p8sBOcjTNe2luaF/EdcqMwqW2s0VZQq3cp 6uqPqnqdekWnVXUo37q3WY5fhXwqHRQTaXzKabV+t/8AHYtlyub/AAapiGrGh0OY qKWQ8WsvcFWW91BO/wCuEJ6ZPCLlLieI8R3ZTtM+fyWtk/jHOerM7U5RcnNzO1Yc tmRYC9jcbhziFip1Gdw/suxLqpfb32mVIVmta28HnMehlT5f2lYv/Jo4d7EUfZgb XijFgTpmyp/huhbb4U3aYrbikocv3Ni+R/09UOzMrLzfBwJ6YQFzTtKLq1kkErLV ybbt8YROBKmQDY91FMs5RaUSYpNNs0FzhVdqitqaQhvL3Ng+T1/N647pxcvGDQwy uTTKpnRsi+HM5RbW+Wwvu545cGeG6RVqFNPT0ml5xMyUBRWoWGVJtoeuGDEWHqXh +gTlVpEmJeoSyApl1KlKKTcDcSQdCeSJSyNW3sLh6CNiTAzeEWZd1E+qa4wopsWs mW2vOeeNE4Ovigx41z1oxmq4mrtXQ2ipTjjqWySgKbSmxO/cBGn8Hk3MjCLFln4R fIOeK4qeVtcEyfl3KSu4MRJyk7PieUsoJXk2dr3PPeJnBSm1QqOv+qR6TGiP0uSn ZVTMwwFtuCy0kkX8hjlTKBS6M44unyiWFOABRClG4HhJjT5NTUo8FdflplBWcZLk p2akBJJWEXRn2lr3HNbrhBi2xN8ZJ7xn3CKmMZybe56mGEYxTXc//9WritmKqWJh bWxBym180eVSZel1thpeUEG+gioccU6srWbqO8xwNnrZszT0x5LPs0r9APtf3RPk 5kzTBcKcvdWte8Lcdmpt9hGRtwpTe9rCIszh1Ek/NwM0dG3NnfS94jsKK5dtSjcl IJP1R0i6bTtHZKKnGnwTUKzoCrWvFbPq49JOSx7gLt3W+1iD90dNs4juUqsI5Rae ZtUjzvlJSZZcH9LElXX3Q6V3llJtlt8pPsjR4SMG/wArPeIPrJh3jXB9hzZVUggg gjYzCCCCACCCCACCCCACCCCACCCCACE7hQ+Ik54xr1xDjCdwofESc8Y164gDQql8 rxg9RMcqzOop7jj7jbzgEulIQy2XFElNhYCOtS+V4weomOs0SmoFQ0IlgQf6EAJ3 umb+iax/UVx8rxIytCkKpNZsoWP5CuGTjkx+lVBxyY/SqgBKXM01TTbYpFcTs2UM pUmUcBAQboN+dJvY9ZjkDTEqUtNMxAlxSUgrEq5fMFKWF7u+utWvXDMnEr66g9LI beLbCsrrudAydZTfNbrtaPv3VSuxU6J8lIVltkOYnqTa5Gh1tbQwAqNJpUuFbGl4 gbJVnChLOXSrMs5gTy++KHgMWrGIGJdhDSKXWyEi11yThJ6yYs0YtllLcSqcyBDg bCt4UMqVZrjcmyxqbCLTjkx+lVAC77pm/omsf1FccKa+5P4pdnEyU4wyJMN5plhT d1Z72F9+kNPHJj9KqKJU0+9jRTbjqlITIAhJOgOeAJFL+Ae8ev0xDxDJTAwJPzBR 73xdSr3G68TKX8A949fpj3FE1suC2o9xfLKK5euD4ZMeT8/uMrmQEtDMRqdbRIlj xVnZPdyu97b4jUedL7zg2eWyb746zq/yjdyCOCWq9LOmPFoeaThyqU2ZlKvNS4RI tFLy3Nok2RvvYG8aFSKhLV1Lqqe5tQ0QF3SU2ve2/wAES26SKnhJmUL2z28ohObL e10jkvHzhXCwwy3NIE2ZjblJuW8mW1+s88dUIODSjwZylq3fJcJQpunlChZQQb/x jFcH1GVpOJZacnHC2whKwpQSVWukgaDww7Yh4Q1UirTdMFMDoasnabfLe6Qd2Xrj JETWdYTkt9cZZ53JOPYtBUqfcbeE+v02uvUw098uhlLgXdCk2vltvHUYUQhSpSwG pb08kM+GcFpxeiZUqfMrxYpFg1nzZr9YtuiCmjhOIk0Tb6Cb4ptsv6+TNa/12vGU 9Uqk+5eNRdFTRcO1StTq5aQlw66lsrILiU9yCBynrEbRweUOoUCgzErUWQy8uaU4 lIWFXSUpF7gnlBjphLAacPVV2bFRL+dgt5SzltdSTe+Y80Mc9McTeS3lz3Tmve0d WLG0rfJlNpvYzOSwnWWuEl2qLlQJNU484HNqnvVZrG178ojUpH3kr2ml7WheqtcN LkH6gJcOFrXJnte5tvt1xGwxjJWInJlJkQxsQk3Dua979Q5ounGL092VptWNzqgp wkbohz60tyLq1GyQNfLChXuEFVFq7siKaHggJOfb5b3F92Uw1zo4zSl/JzoB57bo spqTaXYNNESnKEy2tTRzAGx5I79jpouhwNjLe98wiPSEcTZcTfPmVfmi6VO7OSU5 s75UE2vzCLECxjykTtbwyuTkGg6+XUKCSoJ0G/UmMaqmC69T3G0TMmlCli499QfQ Y1r3dK+jx57/AAwl42xupU5K/wDh4+DP+u6/BGU4Re7Ji2uCtpk6xKsS9PdXlmUD IUWJ18O6L6Vk35xakMIzKSLnUD0wrMSnGEorefKVe+7G1/qv/dDrgOZ7K1OaaKNl kZzXve/dCEZpPS/7Bpvcp6jKvSk1s3k5V5QbXB0hiVKPCk7Qo7nYg3uN1oqMdvcQ xCGQnP7wlV725TEhGJi9TkSvFAMzQRm2nVa9rRqQLFdlXpksbJObLmvqBzRp+Cnk SuC5Fh45XEpcuLX+WowgzW9P1w6UH4vy/gV6xgQYpSZxiRqTUxMLytIvc2J3gjk8 MOVPq0nVNpxR0ubO2a6SLXvbf4DGbk7YbPdfli8w3M9ihM2Rtdpl5bWtf2xy45qC pmsotvY1aYqUq5ht6TS4S+qUU0E5T3xQRa/hjJZiiz8u2FusgJvbvwfvh2TMZpIT GXe3ny36r2iuEx2X/JinZW7vNfNu0++LZdLr17ERtDtwQsrZw3OpWLEzhO/9RMM8 7Ns0tb0/OK2cs0SpawCbC9tw15YTcL1c4akHZUMcY2ju0zFWW2gFrWPNFtiic4/g 2dXkybZoKte9rkGNI3GG5D3lsV2JJtnHjMuxh1XG3JVRW8FAt5QrQd/a+47oY8Iy ztDw+1I1BOymErUopBzaE3Go0hQ4JWNlPVM5r3aRydZi1xXi9VHrrkmJIO5UJOba 5d45rGMouK/qt8k0/tHednZenyTk5MryMNpzKVYmw8AiJRsQU2vuut018vKaSFLB QpNgfCBHKeY7O0NciVbHjLQGe2bLuO7S8RMI4UThWZmXhOGZ26AmxbyWsb85jVuW pVwV2r8iVigFOJZ8HeHPuEVEXGKVZsTz6rWu59winjkl9zPZx/Yv4KetfCNeAxVx aVr4RrwGKuKM4c//AOjCCCCIMhnl9JVr9weiPVkG1o+WPzNrxY9EETJndlk1FIII IIoc5//WkYN/lZ7xB9ZMO8JGDf5We8QfWTDvGOD7DXN9wQQQRsZBBBBABBBBABBB BABBBBABBBBABCdwofESc8Y164hxhO4UPiJOeMa9cQBoVS+V4weomOdYnpSnOuTM 7MtS7CZYAuOrCQCU2AuY6VL5XjB6iY5VNLypsHNLJGzRYKcXe2UcyD6YAWPdjhz6 akvOiD3Y4c+mpLzoi72bv6SU845+CDZu/pJTzjn4IAS56qYdqE4HH8SyOxBOUJCQ 6kEapDl9EncRbUaRyfnsPzko3LzWJ5B5LZAQlSEFASARqkk3VrvOgIGm+7zs3f0k p5xz8EGzd/SSnnHPwQBm7UrhBpplBr9NeyNpaJfbbc7kIQjuQdEq7i97Hfuht92O HPpqS86Iu9m7+klPOOfgg2bv6SU845+CAKT3Y4c+mpLzoiJTanI1TGTzshNszLaZ AJUppQUAc+6GbZu/pJTzjn4INm7+klPOOfggCDS/gHvHr9MZfiE4lU5PoX2VNJKl Ag7TYZL/AGbRqFLuGHr2vt17t2+FjEWOaWrDc/QQ1Ncb2amc2ROTNfnzXt9UUnVc lo8mTBLbOrISgneUaRtnBhRKNUsHpmKhTJGaf4wtO0fYQtVhawuReMsw7hKoYnmX mJFyXQtlAWovKIFr20sDG44Ew1O4ew2JGccYU6Hlru0okWNucCMsUW5WzWVJUjPq RWp845YkhUpjiwnC2GNucgSFEBOW9rW5IZuENVdS/IdhzUQnKvacUz2vcWvl+uKM YJqdAxCvEU27Kqk5aYVMrS0tRWU3J0BSBf64fqBiWSxGh9cmh9AZKQrapA333WJ5 omMdnBvdjVvdFBR0UNWH2VV0U81YoVtzPZNve5tmzd1e1t/JaMnl5ZU28lmUZLzy u9Q0nMo89gNY0jEmAqtV6/Nz0u9KJaeIKQ4tQOiQNbJPNFVTMLz2AZ9GIqs4w7Jy wKVpllFSyVjKLAgDeRyxSUJSdNUkSpVuhaSut0HuQahT9trbu2s9vJe1/wCMRqHP H3Y02Ym5rueyDS3XHXNLbQFRUT9dyYYcZYup+KXJNUi3MoEuFhe2SBfNa1rE80fM rwTYgqUozPszFPDUy2l5AW6sEJULi/cb7GKKL1VHei0nat7GxOYkoGX3qtU3Nf5M 03e3liMuuUN05l1WnLO66phB++MarPB9V8LSaJ6fek1tLcDIDK1E5iCeVI07kx3o GDaliCRcmpR2WS2hwtkOrUDcAHkB5xGrzTvTW5RQjV2MUhL1Sfx0pLzM5MUZ2ZdK QtCly62+6KSPklO63JujQ2KZTqaVFiSlZUr0JQ0lGa3gGsFJaVSaNJMzFlKlmENr yagkJANrx7OPJqYQGLgouTn03xaUoYIPJkdL1fYrvJ0jm9R6TOul9+nSb7itC4tl Kibddoq56YcblHffVJSkW76wGsdHsQydHdMlMIeU6jUltII115SIopqrS9SZclWU uBx3RJWABz88a45RnFThumQ7WzIcxMz7ikmUemVJA7rZKURfrtHSWGIFutZxUlMl QzXCykpvrfktFvh2lTDcs8CpvVY3E83ghtRMIladlWCS22b28EZ5+pxYEnllV7CM XLgR+EKSYl8Krcp0s23MbZACpdACrcu7WM3pbKHm3DVm0rcB7jjQubdWaHnFOLae miqJbmPhE/JHtjN6hX5SeWhTSHgEixzJHticr0+YmKs6TclWG5lx1mVnk0oG4Wht YZCOe47m0PPBK6wquz13Gz+TcpHzhEAY9pLuA1UBLM3xtcsWQooTkzHrzXt9UfHB PIut1yeJKPzbkP6wjFU8idmj+1l3whNsOYlCghtXvCNQAeUx5LyssJZpWwaHcDXK OaOeNUFFeANr7FO7wmOTFSYcbblwlecgIuQLX8sdhieVFtm7eRCOW9gOqHXDqZYY blgsNBWVd72v3xhaYoM3U8xYWyNnvzqI3/V1ReSsm5T5JMq8UlxsG5SbjUk/fGEe pxSyvCpeZcr/AH+SdLSvsfnd9BSyooSQrkIGsaBwRppCxWOzgkjbY7HjuT9e+XN9 V7dUIUxMoQypRCrC0e0+psI2l0ua25B19cYxbirSs0552P0pNUmlu0d9UpISi0qY Vsi00kg9zplsPRGft0KcQq7VKfSq29MuQfRDzheoMuYZpACV3VKtAXA+aIn1jEEp huTE7OoeW0pYbAZSCbkE8pHMY67VWzPe6RT4XlKdLSDya1LyrT5dugTiEpUU2G7N ra94VcTpm1dkUSweMkVnZhsEt5M2lraWi1qE+1jV5M/TAttplOxUJgZTm36WvpqI +kvpmWE0VAImSNlmPeXG/XfbTmis5R0OTe1BJp0ZxKPVWQUpUmuclysWUWipF/Da HOiMN1CmImKo0mYmiohTkynMsgHTVWscK9T3sOtMuTikLDyilOyN93Pe0eU2qMLk 0qCXLXPIPbHN00sORasctSNJuXdUPmIUTCMKzXY9LgmQyNlxcHODcd7bXyQucHqq 8qcnezBqJRs07Pjee1762zQwSGKZGbfYlG23w4uyQVJFr28Mdq9iSSw6yy7OIfWl 1RSnZJB1HPciLZc+GGaMJzqT4XqRFScXSM7xO62MTTyS4gHabiocwisi/nsG1LEs w9iKSdlkSc178hLy1BYSBygAi+nPFBGcru2el0+TVGvQp618I14DFXF7UJJ2bWgt lIygg5jELsPM/Ob8p9kUaMMuObm2kV8EWHYeZ+c35T7IOw8z85vyn2Qoz+VP0LZj 8za8WPRBH02gty6EHelIBt4I+YiR0ZuwQQQRUxGLBv8AKz3iD6yYd4SMG/ys94g+ smHeO3B9hyZvuCCCCNjIIIIIAIIIIA//13+CCCACCCCACCCCACE7hQ+Ik54xr1xD jCdwofESc8Y164gDQql8rxg9RMdJolNQKhvEsCPsRzqXyvGD1ExzrE9K051yZnZl qXYTLAFx1YSkEpsNTAHHjkx+k/gIOOTH6T+Ahd92GHPpuR88IPdhhz6bkfPCAPtW O5VMk1M53vfJkyobyAKCgSCTzJ037tRzxNbxVJu5AmoNZlr2YTcE59e58Oh0hIcb wktK/wDSOTC1Ad1tBoc4Uo2vyhLY6snWYnSFQwvIpkwMQyK+LPOvAlaRmK79fJf+ EANRxVJAEmotABWTXlNidNNdx3b4seOTH6T+AjPZaaw0zMSDjmJpFxMgEol03SPe 0pUlIUbm6tQbi27dDB7sMOfTcj54QAxccmP0n8BFEqafexmptx1SkJkAQnkBz745 e7DDn03I+eERKbU5GqYyedkJtmZQmQCVKaWFAHPAFxS/gHvHr9MYViSbW3iGogJT o+rf4Y3Wl/APePX6YwnEez90dRBt8Ork64yy8F8atllgjFs7Q56adl2JdanGwkhw KPL1ERu2EMQTNboQnJhplDhdUmzYIFhbnJj8+4dpsxUZl5EjL7VaUAqCbCwv1w2y 1PxhItbGT48w1e+Rt/KL+AGMozkpcOjXSmqs2SpSTdUp8xJvKUlt9BQoo3gHmvFd h7DMphtEwiUefcD5SVbUg2tfdYDnirq2M6O3hJ9hqqpTU0yoT3IUFhwAX1tvveIX BhU5ysS9SVMTj00W1tgF1ZVluFbr+CNtUXNepSmkRcR4/qdHr03IMS0ottkgJUtK rm6QdbK64TMQcIdUr9Gep0zKybbTpSSptKgoWIPKo80dsdpWMZ1MWN8yfUTCC7Lz obJKVj+lGGuTk02XcUkmaBweYTksTNVBU29MNlhTYTsiBe+bfcHmi+kOEiq0/E8t hdqVklScvOIpyXFJVtC2lYbBJzWzWF91r8kZvh2o1amJmBLzkzL7QpzbN0pzWvvs euNRE/hL3NiY/IuznE8+32PvvGcl82e182fW99+sTFpbLZoO2rHjEdGYxNT25Kbc cbbQ6HQWiAbgEcoOndGOdAoEth2RclJV11xC3S6S6QTcgDkA5oySnVHFNWmFS8jU Kg+6lJWUpmCLC4F9T1iNTwK1VGKK+mul4zRmCUbdedWTKm2tzpe8aY5qcrS/uVlF pVZdOth1pSCSAeaOLEshgqKSo354XapMzrE3NObd1DCXFWIWbAX0jpQqsh1b+3m1 LAAtmJNt8eN8e6XqsuNyxS8tK4rlu/8Af8GuCUU6fJKqOGZSpTi5p159K1AAhBFt BbmhCbcMrNZ0AEoUbXizxKxiqbrjz1GcnTIlKchZeypvYX0uOW8WFTp7YpDuzlkC YyjUJAN7i+sa/BMPVY8X9eVqlS9PwRncW/KWuE51yblJhS0pBS4B3Pgi9dQHWltm 4C0lJt1xlUrMVGnpUhL7zOY3slZF/JGk0ZxbtFlXXVqWotgqUo3JjzfjvR9ZOamp OUW9kldbcmmCcEq7iZi3BcgKEr8omfhE8qfZCEnCEikaPzHlT7I0vhKnkt4QWph8 pXtkapJB3xiy6nPqPcTj9upwx7nS48uHHo6mWuXr+DFtN3HZDG3heTbWlQefuDfU j2QwYfeVhyadmJUBxTiMhDuoAvfktzQlU5dXnZlhhl2YccdUEpTtN58saJhbDdYa nXzVZJZaLfcbVQUL3HXHTBwclUSrut2RavOOVmd40+lKF5Aize6w8Phj4pUk27Vp VtSlAKdSDbwxPxAuRplSEu6G2VbMKy5ee+ukL0uZ3sgh1hbgG0zIUlVtL6WjbIpO DUXTKLnc12RpzUgHNkpas9r5rcn/AHj7ekm3VKWpSgSOSFrD9YMqmY7LTiwVZdnt VFXPe38ItXJ4TGZ2WfKmlDuSkkCPjMXw/wCI+OmlNqVfdTp8bf76HY8mPQtv7GMu 4OkXWyhT8wAeYp9kc28EU9q9piaN+cp9kL07VKkiUWpM7MJItqHDzxoXAqTWE1vs kTObIsbPb93lvtL2vuvYeSPsIOMlSRySuy3ptamKZIysqy20pEshKElYNyEiwvY9 UeV+sP4ip6ZOabbbbS4HAWgQbgEcpPPDFMU2WTOO2lGggLPyBa14qMR0xyapqW6R LAzO1BOyASctjfXTqjSdaXsFyVVFml0OVcl5cJWla85Lm+9gOS3NDrSaHLuLlquX Hdu4A6U3GW5HgvbWKvBlJ4tS30VyURxgvEo24Czlyjl10vePJOdmBiwSrcw4JUPK SloKOUJF7ADmjyvieDPm6asEtNJ2vVVwa45JT825e4gw3KYjaYbmnXmwyoqTsiBe /PcGEapUdihzqpGXW4ttICgpwgnXXkAi+4Q5ipy8pImmvvsqK1Zyy4U3Fha+sRMO JM1R0O1UbeaKlBS3+7URfTUx5vwDpepxVLI2o09mq7mvUSi1sX9NwxJyr0vOIefL iQFAEi17eCO+IMOSuI2WWpp15sMqKklogXvz3Bjm1iOlJWlBnki2lrHT+EShiKkc s6j7J9kcPUfD+vl1sE56n2lWy52/31LqcYwe1EmWl00fDfEGCVtsMKSlS950J1tG Q4UbFerzchMkobUhSipvQ6C/LeJtbrVUcxLM8VqE12PU6MqUukIyaX05t8OEhO4V kZoPy4k2HACAttnKRfrAj6rGm4xjN7x2f5M4/Mgm4p7i7iihy9Dfl0S7jqw6kk7Q g2seoCKCNEqtXoE842pbzD2UEAqbJt5RCLUlMKqLypbLsSruMosLWickUt0zrwZJ SWmSdkWCCCMzoOymU7Equb5bxDjvnURbMbc145qTusIZKfCOSWKe7k7PiCAi0EZG QxYN/lZ7xB9ZMO8JGDf5We8QfWTDvHbg+w5M33BBBBGxkEEEEAEEEEAEEEEAEEEE AEEEEAEJ3Ch8RJzxjXriHGE7hQ+Ik54xr1xAH//Q1CpfK8YPUTBUGi9PBOZKQGUk lV7ABPVBUvleMHqJjpN/nyv5qPUgCDxdrpTHkX+GDi7XSmPIv8MVdW4wKTNLlM/G UNlxpKN6lJ1Cfrtb64XZiqVNSFTDS1mWqSg3KZB3SE5gCsdZRnWnfoLnmgB24u10 pjyL/DBxdrpTHkX+GM+GLKm41LTDkuhA2ufIhSdUll5WRQStR0KUm5yk8wtFxTJm fqkpWkpnGVTDU2G2HWSdno00oc5CSom413mxO+AGni7XSmPIv8MHF2ulMeRf4YTZ mvT3F+yEswpKHFplkNOhICF2KnFKBUkaEZO+GoPML8HK9WJuXDiVScm21NSrbijd ZVnWkHcqwGvOdDbkuQHni7XSmPIv8MQlzUuip8QQ6HHtjtjlSbBN7coGsVdIq0xP VCaYfMtlRdSEtbwL233IV9YQRbvdbx4j47uf8PH/ADIAm0v4B7x6/TGCYk+MtR/n CvTG90v4B7x6/TGI4gl21Yhn1EG5fVy9cZ5HSLw5GHgn/laoeIHrRsLEkX2s4WBr a1oybgvZQ3VJ4pB1ZHL+tGqtTTrKMiCAPBFsf2ky5Euc4KpmaefcFVaTtVqVYsnS 5vzw18H+EHcJMT6HZxEzxhSCClBTlsD19cZpP8JWJZecmW25lkJbcUlN2E7gbQU/ hPxQtLmaaZ0I/wBQmMdWODtIv5pHuPjbG9UP66fUTCemaE0diEFJPKTFvVKjMVaf fnptQU+7qshNgbC276oXWSW3QpO8RzbSk2jThUyxabLF7m940Gn8Gr8/TZWcTUm0 CYZQ6Elom2YA239cZm5NO3Go8kbfJVWblcCyz7S0hxqmJWglINiGgRGuLGpN6yrl SWk+sKYKdw5VXJxydQ+FslrKlsptdSTff1RIxLjVrDdRblHJJb5W0HcyVhNrki27 qhdwjjKs1erOy8482ptLBWAlsDXMkfeYb3cLUrEyhOVNpbjyBsklDhSMo13DrUY3 jvD+lsUe0vMQqmOO4XVUh3CZhpDwQdSMxBtf64qcKyRnXJoBYTlCd4vzx0VOPdkF 0DMOx7S1MJRbUIR3ovv5BFhKtIo5UqTGUuWCs2u7/vGy43KEOp41ZwxPLpTkkt9T QCtolwJBzC+63XHadngZBx3IdQDa8SXMKUqvrNRqDS1zLmilJcKRpoNB1CFZc6+4 pUspQ2V8trcgisVO3q4JdVsR5qYEwtJCcthbfFpIY/Yk22KUae4pSbM7QOADU2va 3XFS+hKFAJ5oaqTguizcpK1B1hwzCwHCQ6QM1+aE1OvKI13KrhIlyMIr7ofDI5Iy KXlyUnuhv5o3HhIl2zhFeh+GRy9cYjNLMspKWtARc31jmzvzUjSCtb8FzRJ4UqqS c2psuCXcCykG17RsGGcZNYknHpduTWwWm8+ZSwq+oHN1wlymGaY7gFNXU0vjhlS7 mzm2bXkiPgCZdlapNKaIBLNjcX+UIjHqhJR9SZaWrXYssf0xU3iQOB0J94SLEdZi tkXckww1a5SQm8XGIJhyZqQccIKtmBoLc8LNFfXMYpk5ZwgtrmgggDkzR2mIw1Pe 19f3Rf0f+RWfAr0mI2LpBiRVJ7BJGcLvc33Wi6w9KMu4dl1qBzFK76/rGAPzFN1J L8stsNEXtrfrh14KsWtYaFW2kot/jGxtlWE2y5+rrhNckmAg9yfLEulASu12Wma1 7688crnUfIXUafmP0XKzIqkuzMpSWxMpCwkm+XN/3iwlqSqXdKy6Dpa1opcMEqol JJ3lhr0CLLFVTmaVSUTEopKXC8EElN9LH2R0XUbZEYuUtKIdeqaaXNtsqaLhU3mu DblI+6FGXrKJauieLKlJS4VZM3PePiaqs1VnA9NrSpaRkBCQNN/3xVufCK8MZ5Mj UU4nTgwpzcZ9hmrWJG662yhEspnZEm5Ve94hy1aRJMhgsqWQb3CrRVS3fK8EfD/w p8EQ5y0WWWGDzOFbHqVZ5jNzqJiVENr4VPhju8tSAMvLEYpVFtk9TBzyKK9Dg78K rwx8RJDaVozqGpERoynFp36nThmpLSuwQQQRQ2CCCCACCCCAPkoub3jzZ9cfcERS M3ii3ZfYPTlqz2v+oPrJh1hMwh/KrviD6yYc46sP2nmdVFRyUggggjU5gggggAgg ggAggggAggggAggggAhO4UPiJOeMa9cQ4wncKHxEnPGNeuIA0KpfK8YPUTHOscd2 yhT22XJlUukJD6ylAGUXJIB5I6VL5XjB6iY6Tf58r+aj1IAVuK4v/RUXz6/ZHyJL FgCQJehgI70bZWnJppFtHhClKaQlWUuOoRmte2ZQH3wBTppuKE3yylBFyVGzqtSd L7o+kSOK2k5W5ehoHMl5Q6uaLIKdKyhtpx45lAFKFE2ASSSEg/OAjxTjzTSVOtEL O0UpKQVFKUqIuQAebwdYgCuVIYqW2W1S1CUgm5SXlEHW+63PHhp2KSjIZWhFJtpt VW03ckWyg8FIGztmeDdgoZj74EHQ6b721j1ObLdQA1KdDcXG+xgD/9FoRIYqbUtS JahJUs3UQ8oFXh0jjJSdRaxK4/VHJEPqlMiWpZxSjlz98bjTXSL2KRHx3c/4eP8A mQBNpfwD3j1+mMQxAf8ASKfAOu3V6Y2+l/APePX6YwuvuWxPPi3+0K9MY5laNMfI 58FjLjlVnwlJNmB60P0/V5CmTPF52ZQy9YKyKvexhN4HlZqzUdP9nT60NOKMDP4g rBnm51tlJbSjKpBJ0hFyWPy7ltm9zGqmkqnJt4C7anFqCuq5iC06mxsqLaqNFjjU sTctqUgq57G0UbLJsdRHOne7NHGiXmJFwo2jnKEImEqXonXfAFZBl5o+22C4sJCg LxD4IjsMFLo87W0ummyqpkNWC8lu5ve2/wABjcqXKKaw1JyrzIDqJNDa0EDRQQAR CNwQS5YYq91A3U16FxdL4QpZFeVSuIOlaZoy20zi182W9o3wqMFqb5Kztui3Zfp9 AWZuo7GUZWNmFqTvUdbadQPkiwl65S6i2XpCbbdaScpUgEC+/wC8RQYqpysUUtuR acDCkPB3MsXBAChb+1FDT2Tg9hVPePGVOK2wWjuQAQE21/dje5aqrYrSq+58PXdx NMbO5Kphwi3LqYYKfLvBTmdB5LXiikBtq2iYGgWtS7c1wYv5yrIpQQVtKc2lxobW t/3i5UQcXs1H3Rv7DbBvKiwSuw70dccxOMuJDaHQXCLWG+8dq/iRp2rurEusXCfl Dmhfp5vUmjzqPojlc1CdR7vc1puO4102lz862tTEut0JNiQRpFA4uclMTpYccebL cykKRnNhqI1DA/5jNeNHojMMQziRwizTOQ346lN79Yi3UXSojHyzaJ+qUyUli7PP tJZuASsXF+TkjGeFSfptTqdPXSnWnUIZUFlpNgDmjUMQYXdrNLMoiZQ0orCsykkj SMmxdhJ7D81LNOTTbxdQVApSRbW0M0pLtsIJP+TyTw7iF3DTc23KTKpMtFQUFjLl 8F4l4SodWennw1KOqIaubEc464dcPYibXg2ToPF1hxTGx2uYWuSdbReYTpqqXPPu rcDgW3lsBblETjxJeYrKTexnNbkZ6Snw1MtONuZAbKPJrHGiUqfRXZJ9UusNh5Ki q43X3w04/XtMRggW94T6THCk1RDk7KSwaUCVJRe8blSdickqlbknRX3Qqv0LEM4t UxJS0yuWX3ikLsDbQ8vPeG3FbRbVKXN7hf3RWS/CRK0OVTTHKc86tkEFaXAAb67r dcZZYxkqkyYunsYWqVmkpupCwPDGk8Ek9TqcKv2Vcabz7HZ7VN72z3t5RCfNnLLK Pg9MX2BqA5iAT+zfSzsNnfMm975vZGeuTWyJUV3NOm6vIOsviWmUEKSoNhNxyaWh YS49f35ayn9ZVxeORljJTBlVKCiyrIVDlsbR2mPg/riVJyWp9js0KFY1xI5PKBUM p0tyQvTMrNrmnVJQspKiQbxeQRhJ6nZ0vCnFR9CFRG3mHHi+FJBAtmMcqpKzcxPK cYQtTZAsQYsolMfBDwxpBa1oZy58KxrWmK9MUvsowlSld9YgmLTEKillixI7o7vB HKVpi2qih4upICybWiZV5RU220kLCcpJ1EIr+mzFwnrS7nOTn5ZNNbaU+NrkIsb3 vFI9KTrDZcdQ4lI5SY+C0WJ0NE3KVgXhirn8mL/eHpiPvjb7FXcXQsbRfz1eWDaL +eryx8wRgWs+tov56vLBtF/PV5Y+YICz62i/nq8sG0X89Xlj5ggLPraL+erywbRf z1eWPmCAscuDlSlV+YBUT+Sq3n9ZMabGYcHHxgmP5qr10xp8dmH7DDJ9wQQQRqUC CCCACCCCACCCCACCCCACCCCACE7hQ+Ik54xr1xDjCdwofESc8Y164gDQql8rxg9R McqzMuyrq3GJN6bdMulKWWSkKJKQN6iB/GOtS+V4weomOk0SmfUQSCJYaj9yAFLs lXP91J/z7H448NRrSrZsJT5AINuMMbwbj5cWdSqT1Ppc3O5lucXZW7kzkZsqSbX5 N0Vj2KlU1Kk1hQl3bJUgMvFaVg3tYkJ10OluSAPo1KskJScHzmRN7ID7Ntd9/fNe TyCPlU/V1pKVYOnCk5rjbsWN9/y44nHlPRnW7NKS0VANLC75xlSpR6rZgOWPG8dy SZQTE289LBbzraAsnukoVYr1tpu9EAS+y1b2xe9yE4XC4HMxeY0ObNp3emusfPZO uZAkYTnwASfh2OX+nHWqV2bkXmUNbPI4kq20y+ptsdWYJVr4bCIs5jWVlVvy+2WZ xpBJZLlu6AzFFxfUC/kgDp2Srn+6k/59j8ccJBFRfxM5OzlMekUcUDSUvOtqKjnv plUdIY9u9+lX9oxRbRa8brzrUq1PFrm9vfIAl0v4B7x6/TFXX8NYcXg2en25GWVV iypYWlV3Cu/Nff8AVFpS/gHvHr9MZoxPMUzHInZlRSwzNFSyBcgXPJGeSVL+TTGr ZJ4Nm56Tqc6oNPNZmQLlBF9euNkpU0yZL8rfbDuY6OKANoraBiml4lmHmKa64tbS AtYW2U6XtywrY1wdWKviEzUoy2potJTdTgGovDeEPLuT9z3MprcwDVqgA6kp4w5b XkzGKVbxRbIsDnsYr6hLOMTs004AFNuqSqx5QSI4S8u46FZQNOuM9CTuyVN8H//S zSSyOqZLljmUL38Mfor3H4POjFOklOcgQu59Mfm+TkX+LNnKPL1xofBuoIxxJE7s rnqKjljNKWmrs6NG1mnppcrRNKZLCWDuq8gPdW3ekx9N4Yo630Ty6c2ZlSg8XDe+ e97+WO+IMT0yiKlxOuOJLoUU5UFW61/TExiuSMzItOtLUUOtBSbpI0IuI6fK/L6G e/J8lmWZ7ohCL6XJtCVjBIcqrJYGdOwAJRqL5lRZYwmmnqQ0lBJIfB3fqqiuw86l Eg4FHXan0CLkFHTFTbdUaKw4loE6lNgBYxPr8wlSGMzqTqeUdUXtVrclN0l6nNLU ZgpCACkgXBF9fqhLm8K1SshKZNptRauVZnAN/wD2ism0rSJik3TGih0fDk9Sm359 mUcmFFQUpbljodOWMrp6XuzyEhK8gcUBppbWIVepc1Rqu7JTiUpfQEkhKrjUXGsa HQ2lPVCUbQLqVu8kYRrI7aqi0tu4y4RUtqTmBcpu4N/gi3OGsKzMzx2Zk5Nc8pQW pal90V89r74jiVdle5dABOosbxk9Vm2kY5dSom4nE306xGmWelLayIqzcJ50syxW F5NQL3hCxWwmpzUutxG3KEEAjW2vVDDiuaaeoikIJJ2ieSImDm1LlJkp5HB6I0aT 5K3ROo1LozWHpZYZl0ziW7gZu7CvBffFhTkkOruCO55RGVOvIa4WAFk3TPJv/CNe 4/L/ADj5IpCWq9uC0lQg44acXiAFLalDYp1AvymKmhtKTXZErQoJDybkiwGsaLOO oefzINxa0UtRZWJKZVbTITvjQqeYzCHFSWwsuwXfJrbvY+6RhOiT9HZmp2mNOTKw rOtd7mxIHLzARFwnLuPpm8gBsUX18MObLampQIVvAN4hpPkH5YJLgyr1SeSLmgT0 7SxMdj3Vs7TLnyDfa9vSYoUzDZUNT5IbMHrSsTmXkyf9UccYybrg2bS3GFkOTEuh 5wKW+4kKUojUqMc3kvNou8laE3tdYsLw0UqTeMzJOWGXOhW/kuIlcKqFOYTaCd/G 0eqqNskKjdlsWfTyrEcKSoXSQfAY9jnheiTs5IOrZQkpDtjdQGthFzUMPVCmUt2o zTaEyzSQpRCwTa9t31xz6W1aO+OeDW7plVEpj4IeGKZqsSb5IQtRtv7kxZys00tg KSTa55IvhklLcy6nzwqO4N/DDwx0me9T4Y+UtqQvOe9GsfTh2wARraLpVBruVk08 sZrhEFUowtzaKaSV3veJOVMz728M6DrYx8qBSSDvEfbHwo8EZw2lRtljF420uxwf p0mkjKwkQvzjJRNuJbbISDpYQ1TPfJ8EcIjKlqdGWPEp4kKuzX8xXkg2a/mK8kNU EZ0T4Veoq7NfzFeSPClSe+SR4RDXECpyrs1stkAct73NuaFFZ9NStOyigib2Kmvm p+1B2Kmvmp+1EUY/Kn6DHwcfGCY/mqvXTGnxnHB/JPS1cfW4AAZZQ0N/lJjR47MP 2nNlTUqYQQQRqZhBBBABBBBABBBBABBBBABBBBABCdwofESc8Y164hxhO4UPiJOe Ma9cQBoVS+V4weomOVZnWqe45MPB1SBLpFmmlOKJKbCyUgmOtS+V4weomIE/Locn FqUVk6f6xXMOuAFucr9PnpGYlHZSrht9tTS8tPeBsoWNu564rlzNMdQC8mvOzSVB SJpdOWXEWBFgNnltZSvk8vPYhs4o1+v5xXtg4o1+v5xXtgBQKqPtdshuvoeOhdEi 4VFJCQod0g2vkSdLEW0IGkGekA3QivoO0cVcSDhIS4QpSLlu9iRe/fDnhv4o1+v5 xXtg4o1+v5xXtgBdnqxJzoSE9npewyqDVPcIUOsLbUPr39cQr0QIcaRL11EutOXY JkXcoNst75MxNuQkjltcAw38Ua/X84r2wcUa/X84r2wBUIxPKIBBlquu5JuqnO6X O7RG4Ryps2Kjix6aalpttkSQbzPyy2rqz3sMwF4vOKNfr+cV7YOKNfr+cV7YA4Uv 4B7x6/TCtXMCMKo07W+POZylT2y2Ytv3XvDdJtpaS8hAskOn7o+a3/8Aj6c/mx9M UnFOLsvBtMUuCJHFqxUVA5ry6R/ai3xnwjzGHa+ZBunNPJDSV51OEHW/VFNwWOpR VZ8rWEjYDef1opeE9AexgpaBnHF0C4154yjJrEnZpJJSozSedM7UJl4jIXnVLIGt rkmO0hLBAX3RN7ckDzbac5SBnF/LHsmpYC7k8kVk7ViqZrOG+D5iqYXlaiqoONqc QpWQNggWURvv1RV4FXsMWyrgF7Jc0/oGKymYsq8jS2pNipLbZQkhLYCdLknm64te D5G2xlJoUMwKXNP6BiicXOOlF1el2y64TJkzD1NukJypc5f3YZqGM1Epo55Zof2R E6v0KnzamDNSaVlIVlzEi26Kl6q02TlXJWXnZdt1lBbbbDgzJUBYC3PcR1KOmbk+ 5k3aSPvFDIbpjZvf34D+CoqaS8W5VYtfuyf4CJVGn26hOLarMwhcsGypIdUEjPcW 5tbEwVphCZtAoqM8tsxmLHdDPc3157WjUqQaewJ3ESWSrKHHFajW2hMOjEoKMVKQ su7XQ3FrW/7xUUtiTYXLvqShE0EgqJOoVbX74Y2VNTZUFKS5l690Af/TXeEVXGMZ zbhFrob0/oCGajzRkp2WmEpCy3rlJtfSKzH9OWvF80WpZakZG7FKSR3ojrITkq/M sy7Mw248rQISoEk25oyxvzSNpJ0jQGKoqqJLimg3kOWwN7wvzvBtLzdQdrZqTqVl e32QbFrjW179UTqa4iSaWmaWGVKNwHDa4irm8TPioOSjVSTsivIlAINwdLRrJRf3 FVfY51OurmpMtFhKRmBuFRb4Mn1Nyk0NmDdwcvVFVWKLNokCWJF7PmG5Bi5wHIPN yM2J2XWhRcGXaJI0tFiDoeDuXnK+MRmoOpcW6H9iGxa45L3hi7GJ/SHyRn0zjCek cfKpzlVDNObmQhTaikJSjS4Jh4TW5KonZ0ufYmXU90tLDgWQOc2jOEou6JaaPiZZ DDuQKvpe8V9S/k2Z8WfRFBileKuy47HtTqmNknVtnML635IbJqXAwopbzZExxQFe bQ5sut/riYzttVwGqVlJhCaMumcskKzFHL4Ycm3S9K7Qi1wdIUMGJYKZ3bZd6LZj b50NC65QJNCpZ6pSTTqRq2t4Ai+u6/XFm0uSKPyrRJYVOrsSilFsOZu6AvaySfuj WcGYNZSJ38sXrk+QP1uuM6w/Tpmn1uXmpuVdl2EZszjiSlIukgXJ6zG2YAmJWcFQ 2TrbuXZ3yqva+aKxSsb0fD00aS2soSHOKAkXNs2X/tCniPG72IqamSckm2Ql0OZk rJ3Ai27riTXa9JN1ioyrtRYSEvONqbU4BbUgiKLjWH+lSnnR7Y5c2SUtomsElux4 4NpQTFDmlFZFpkjd+qmLzHSMmAami97MgX/pCM9p2KpSksKZkKtLsNqVmUlLidTa 19fBHWdxizUZNyUm6yw6w6LLQXE2IiY5ahpphxt3YhU4WW54BD/h+ionaSh9Tykk qULBN+WKNDuHGySiYkxf9r/fFjK4jp8mwGZepyzbYJISHExlB1K5I0U3H7XuWcvK Cam0ypWUhSsuYCJNQoqKWhC0vKczm2qbWimlq3JKmkcWn2FPk9yEuAkmLB+dmZoA PulYTqL8kdja1pUZKUtLSexMTh5t6nGdMwoEtleXLzRm72LnZRsuiUQojSxWfZDk 5iZmWSqTcqjLYSMqm1LSLdUUC2sKupyrckiObbf3xzzmlK0jVZJuOls+sP1peIWn 3HGUs7FQSAlV73izWnKsp5ohSMzh6mpWmTmZRkLIKgHRr5TFltpVcuZoONlm2baZ u5tz3i2SnFSrctgzOD0yexwgjn2Wo/TpXzog7LUfp0r50Rhb9Dp8VA6QRz7LUfp0 r50QdlqP06V86IW/QeKgdII59lqP06V86IOy1H6dK+dELfoPFQGTCH8qu+IPrJhz hJwdPSEzVnkSsyy6sMEkIWCbZkw7R14ftPP6manO0EEEEamAQQQQAQQQQAQQQQAQ QQQAQQQQAQncKHxEnPGNeuIcYTuFD4iTnjGvXEAaFUvleMHqJiLOfnS/q9AiVUvl eMHqJiLOfnS/q9AgDhBBBABBBBABBBBABBBBAHCW3veNPoEe1tlR4OpxdxbixP8A GPJbe940+gR0bWanRexL+ku8gtqKNFWvyH+6IatNFo7Mzzg8SRUZzxQ9MRccfGI+ KT98aDKYTp+HVqek3JhSnRkVtVAi2/kAjMeEKbcZxQpCQm2xQdR4Y5pwaxaWbKVz sQnvhnP3j6Y+mnAgG4OsQHZtwurNk98eSLGlNJnUul24ykWyxMo1G2QnbpFjLsKd YS4CADrrDDg3EUtRcTy0++08tttKwUtgX1SRynrh7wlwb0WqYUkZx96dDrqVFQQ4 kDviPm9USm+CbD7SwtL9QuOd1P4YqsU35kTqS2LSWxXJ4oClSjD7Ql9FbYAXzbrW J5oySfmU+66ZRY34+of+4Y2Oj4Rp1ES8JVyYUHSCraLB3X5gOeM2qdBlEYjnJgLd zpm1rAzC185PNG0oSklq5KXT2JENGG/5Pc8afQIqqHT2alPLZfKwkNlQyGxvcD74 aGKezTUFlgrKVHMc5ub7vujcqR009xc2VhSLKUTyxdUqVXLqdKik3A3RBU4Wklab XHPE6kzK5hToWEiwG4QAm4s+ML/7qPVEZphlYk8WSkwu5ShxRITv3GNLxZ8YX/3U eqIWKZh6TFVZXnevmJ74cx6oznFtpolOhnnP/G1pdl+4DYykOf3QgvrEtiwNL1KJ pIJHhEOk9MroriWpUJUlwZjtNdfqtE+VwJSapLt1x92bE06NupKFpCMw13Zb2054 jJDUkTGWka52fbXLlISveI6UlwONOEA6KG+FeYqL2y3I380WFDqL2xd0R3w5OqNS pkGNGVLx1VLEazH3CGfgtPEq1Orc7oKl7dz+8Ib5vg8o9YnnKpMvTiX31Z1htxIT fqBSYn0jBVMor7j0s5MqUtOU7RYIte/IBHOsclO+xe01uf/UcavjynUad4q/LTS1 5Au6Am1j4T1Rd1I8Zwq/No0Q7K7QA7wCm8VFVwNSqxOcamXZpLmUJshaQLDwp64U JnHVVS47QQ1K8UQoygVkVnyDuQb5rXsOaM3Nxl5uHwa0mti2wz3s14U/fCriekvT GI5t5K2wlRToSb96OqHTBksiYTO5yoZSi1v6UVGJG0tV6aQm9hl3/uiLzgpqmRGT i7QkVeqszlMdYQhYUrLYqtbQgw3cDCChNbuRqWP/APSM9mEgMqPgjRuBzva14WP/ APSOfFNzkmzSaS2RlOMWVHGtcNxrPPeuYpNgrnEM+LmknGNaOus6965im2Kecx00 c+kg7BXOINgrnETtinnMGxTzmFDSQdgrnEGwVziJ2xTzmDYp5zChpOuHWlJxBJm4 0X9xjT4zyhNJTW5Qi/f/AHGNDiUWSozDETKlYgnDcar+4RWbBXOIv660lVbmyb9/ 90V2xTzmIorpIOwVziH+WSRgNSeXiy/vhO2Kecxe06pvussUhSUcXc96JAOaxOut 9+vNEpEpUKmwVziDYK5xDbXcPydNlG3WFvFSnMpzqBFrHqig2KecxFEaSDsFc4g2 CucRO2KecwbFPOYUNJB2CucQbBXOInbFPOYNinnMKGkceCJsoxTNkkfmSvXRGzxk PBU2EYmmiL/mavXRGvQFUEEEEAEEEEAEEEEAEEEEAEEEEAEEEEAEJ3Ch8RJzxjXr iHGE7hQ+Ik54xr1xAGhVL5XjB6iYizn50v6vQIlVL5XjB6iYizn50v6vQIA4QQQQ AQQQQAQQQQAQQQQBwlt73jT6BFhKISmitrCQFhF8wGu+K+W3veNPoEfExWRTsNOO 7DabFsm2e19fBC63JjySvfntLrXbk1MY9wkIUjFigtJB2CNCPDGh4UxgKtNzDfES 1kQFX2ua+vgEZ/wnzG2xgpeW35OgWv4YxyyUoWjWKalTMwaGaoBJFwXN31xtvBBS 5CalasZqQlnilbWXaspVbRW64jFZdNqilX7SN34HFZpWr6fLa9CoL70mRezofuy1 Hph4iJ+SlS3oGA6lGW+tsvJv/jEptD6VgrS4E9YNoTa5gE1KszNW7JBsLIXsthe1 gBa+bq5o+sPcKScS1pmlCjmXLoUdpxnPbKCd2Uc3PCedYouWXZL9DTf2jVP7a7ey z8t8t4zCtFSZiom5Cwpw35b3Ma0TeEyt4RLrNRm+OgZ0uu5dluvc2vePGx/H+nyZ 5Y2/LtpdPdv+xs8ElFMU8AOzD1eeTtHV/kyja5PykxobiVpVZwKBt8qEDCy/c3U3 JwjjGdktZO8tcpN7680Mkzi4TDgXxIpsLW2t/uj3MMZRjUjGbTew0OmW7H/6rPlF 917xCYzEq2F78uT+6KaQrAqc63J7DZ7UkZ897WF91uqGiRkeJlZ2mfNbktaPO+J/ FcXRQavz1aW++/r/AJL48Tm/wIWIc/Zl3aZs1k99v3CIdHmZddXl0h5skqOmYcxh zq2FzU6gua44G8wAy7O9rC2+8ZxI07sdVUTO12myWTly2vvEX6H4lDrIJ495KtS3 2v8AnnuJ49D3HmoSaZpxCkSwdAFrhGa0IE5WpySxCuU7JvsMNvhJZ26kpSm4uLXs BDpLYoEulSeKFVzf4S33QiVmgmrVqaqAmdlt3CvZ5M2XqveO3LFySopBpcjtVp6Q n5EsUyZl35kqBCJdYUu3LoNYtsESzyJOa42ysK2gy7VJva3JeM+w9T+wVVTOl3b2 QpOTLl39esPErjES6VDiJVc3+Ft90aRba3KiRi6tVGWxJUpeWqc00hDhCG231JCd BoADpFpwZ4kU1WJw16sqSwZf3vj0ycubMN2Y2vaKas0rstXZqpB7ZbdzPs8ubL1X vEF7DReSBxsCx/R/3xz6MkZWkaXFrc293E+H1Lu3WqcU2+TMo9sYo4RNYpd4v77t JtWTJrmuo2tbfHwzhstIy8aB1v8AB/3w80Lg6VJzshU+ygXs1Ie2ewtfltfNHF8Q 62PTRUsu3p+X/Y0xQT4IJFRpmh41K7T95Ga3p3ww05puapjb8w2l51QOZxwZlHUj UmLiuUI1ksETGx2Wb5Ga97dY5oXXp/sG4qmFvbbHTaZst767teeJ+GfFcXWwSup0 21vtvXP+CmTE4P8ABkVQuJFzLe+m7wiPmgVOdkOMbCdmJfPlvkdUjNa/Mdd8X7+H S8ypvjQF+XZ/3xHRhMov+Wg3/Zf3x0RwzUaolzjyRXGVTLin3Gy6tw5lOKGYqJ5S eWPniY6OPsQwtUzZMob218qQL5f74++x/wC1/sx3xSSMG2f/1UniY6OPsQcTHRx9 iGTsf+1/swdj/wBr/ZjTYtuLfEx0cfYg4mOjj7EMnY/9r/Zg7H/tf7MNhuUlPl0t T7KyyEAK77La0Nksw7OqUmVbW+Ui6g2nNbyRHp9EM/PsyvGMm0VbNkvb6rw/4cwu aA++4ZsP7VITbZ5bWPhMeV8T+KYeig1fnq0t99/U1xY5Tf4MfqsitFUmEuypCwrU Kb13RD4mOjj7Ea3WcEGfn5qodkAjOSvJsb203XzdUJHY/wDa/wBmN+g6/B1mPVje 6q+dm/5K5ISg90LfEx0cfYjtJywbnWVlgJCVg3y2trF92P8A2v8AZjvJ0czc6zL7 fJtVhGbJe1z4Y7JSjCLlJ7IorZGqMk9VGUtScsubWlWYoaRnIFrXsPDFFM0h+TdD czIOMuEXyuNFJtz6iNlw7hQ0GddmDOB/O3ky7LLbUG+880fGIcImu1FM2J0M2bCM uyzbiTe9xzx86v8AqLpvE6L/AKdfdT5/ijo8PLTfcxjiY6OPsQcTHRx9iPmp18U6 qzkjxbacWfWznz2zZVEXtbTdEX3VjoR87/dH0MZwkk0znpkziY6OPsQcTHRx9iIf urHQj53+6D3VjoR87/dE6o+o3Hjg9lw1XZhWyyXllC+W3ykxpMZfwb1sVLEEwzxf Z5ZVSr57/LQObrjUIhtPghhBBBEEBBBBABBBBABBBBABBBBABBBBABCdwofESc8Y 164hxhO4UPiJOeMa9cQBoVS+V4weomIs5+dL+r0CJVS+V4weomKp3jLrill9Ivyb P++AOkEcNnMdIT5v++DZzHSE+b/vgDvBHDZzHSE+b/vg2cx0hPm/74A7wRw2cx0h Pm/74NnMdIT5v++AO8EcNnMdIT5v++DZzHSE+b/vgAlt73jT6BFXLITUFpp8yM8s 6ooWjdcX5xrFuy0WkqzLzKUoqJtaLmnqQqgspFs+z5uuBKKym4Uo1JdW5JShbUsZ VHarVcfWYyLhSZQ1jJSUCw4u3y+GNylmXMyu55OeKisYqoFEnjJ1SdQzMhIVkU0p Wh3agGKTgnGuDRN3Z+bZeSlzNIVk1zX3mNa4M1GTl6iGDlClN35eRXPCdhwpf4SJ R5uymnJ8qSedJUSI3OpJSlTdgBodwjLFBuWpvgtJpKkZxiLGddk61NyjE6EsJIAT sUHQpHKR1xQ4EbTL4ulHGxZQS5Y7/kGNa4otTe12QKbXvpFZQcTUOpVdqVkpxDj6 wopSG1C9gSdSITwKTqbtPs/0FOlshjknnHgvOq9rW0hFruIam2qpy6ZgBpJdQE7N Pe6i26J+P5xmUdkA65kzBdtDr3vNCfNXmae9su6LjSsvXcaRwYvhHTw6meak06pU tq9P/hZ5ZOKQvTFYnm2wUvAG9u8HsjQuDuQlq9QZiaqTe2eRNKbSoKKbJCUm1hbl JjK5qQmpJoOTDRQgqygkg6/V4I1zgiUFYVmyD/tqvURHoYtSlUmZy33R3mJNilzT r8mjZuMrOQ3Jtrbl6ot8O1Kan1zAmXM4QE5e5Ate/NC1iqpShYqLAeG1DhTlsd4V CvRQuYW8GSVWAvY254w+IfD8fWYnFpKXZ1bW9k48jg7HrEFdqMjWHZeXfCG0hJAy JO8dYifP4epbdMcmEy5DuUKzbRW826450Kr0+n0lqXnX0tvpKipJSTvNxqBCbTqz JdmmyZnuc55FdfVF+j6TF0mNQildJN1V0JSlN2XLFNlFpJU3fX5xhHm5+ZaxaZFD lpbjSW8mUd6SBa++Nlok1LzbDqmFhYSqxNiOTrjFcYTDKMY1RJXYh88kb5pOKTQh HUzW8R4bpVPpKn5aWKHAtIvtFHQ+ExR0qmSky04XWsxBsO6IhUwDNIXidAU4SNkv Q3hlxnQqpWpyVcpksp5DbZSspWlNjfrIgsrcNVEaVdWUDa1Kx43TCfyQzSWy3+rz X3xfY/kJah0uVep7excceyKJUVXGUnlvCZSkqouLpU1IbDi0wkvX7rLbwXvDljZa ccU6WksNnj8ww7tXEJ7jKixF7rsN5EZRm3GW+5pJJNCB2Xnv039geyGrDuMa5MVm nSTs4FS63UNqTskC6d1r2vF1hCclMG0U0vEa0yU8XVOhpSSs5CAAbpuOQ8sJzuDM Q9nHayKcrscqYVMpe2qLbMqKgq177jzXjl6npI9RDTPd/lXRaM63So07FNVnKaqV Eo6G9oF5u5Bva1t464pUMoqbPHJsbR9wEqVe17aDQabgI9w13SZnNrqnf9cV9YNq w8BoLp9AjT4f8Ox9HiUUk5b3Kqb3szyZHN2Zw/iCpoZUpMwAR+zT7I6U2vVKY2u1 mArLa3cJHP1RsfCU2gYBqRShIN2tw/apjFaNRKjV9txCWL2yy57KSLXvbeRzGN56 k9KYjVWTF1uoBagHxYH5ifZHz2cqH6cfYT7I2gyqpTg0Wy+0EPNUlSVjQ2IaN4/O jziVIslVzeIkpxrclNPsMfZyofpx9hPsg7OVD9OPsJ9kfeFcOVas095+Qky+2h3I pQWkWNgbakc8a1VmOJ8Ga5Z9sImGpRtC02BIUCm+oiFrd7vYl6fQyLs5UP04+wn2 QdnKh+nH2E+yGnA4SqZnNAe4TydZjvXqXNTFVW4yxmQUpAIIHJF8cZTjqsiTSdUK kviSqykwh9mZCXEG6Ts0m38I0fg8xNVq9OzzdSmQ8lptKkANpTYknmAjtIT8it1h hLiS7YJy5Tvt4IMRgIYYyjL3R3ackcnXfDIdXjcZNauzq2iYZtPCFvFWNa/IYjqE jLToRLtryJRsUGwsOUi8KPZyofpx9hPsiXVJCacfmXktEoNzmuN1oTaO8g1BIzfJ Poiek6SPTx0QVcW0quu5M5p7vc//1kvs5UP04+wn2R0YxFVJd9DzUwEuIUFJOzSb EfVFPUnEZ27K5DE/CqS1iWlTTgswiZbUpR1sArXSOSad6W9jqVNXRpnB9imsV2sz MvUZoPNIlytIDSU2OZI5AOcxyx9iytUPEDcrT5sNMmXSspLSFakqG8g8wi9xDPSl Vkmmaa4HXUuZlBKSmybEctucRMwvllaUpuaAS4XSbKF9LCPO+hYfE/O2019unb+f 9RPiHVGATTDc5NvTT4zPPOKccVe11E3JsOsxy4hLfo/7Rj9GANCcz5U5dpe9uS8c a62ib4vxdCV5c2awta9o9ZYWlSZnrXofnniEt+j/ALRg4hLfo/7RjemFsS7KWncq Vp3i14ZpiWD0upttpJUbWFhE/JfqNa9DFODCVZYxHMqbTYmUUN5+eiNXj6XJuSpB caCM27dr5I+YvGOlUZSdsIIIIsVCCCCACCCCACCCCACCCCACCCCACE7hQ+Ik54xr 1xDjCdwofESc8Y164gDQql8rxg9RMV0WNS+V4weomK6ACCCCACCCCACCCCACCCCA CLCl/wAmMfu/fFfE6nuIapDLji0oQlNypRsBrzxKJRImKgKclKy2XMxta9rRg3Cn UBOYzU6Gsn5O2LZr88boJmnz3cJmJZ/LrZLgVaMS4UZdoYyVsm05eLt96NOWMszW k0hyVWCXb4yo4t/tCY/Qk1K8ZKTny5eq8KtMpmFmKZJzEqzTU1BLKFIUhSdoF5Ru 1ve8TOOTn6Z3yxbHHSiJNPgqqzjxFEnZmkmnqeLIy7QPZb3F91uuMuwlVBQcRy9R UyXg2lYyBWW90kb9eeOmMH5heLZ+61klSfVEQ0U2ellbV+SmGmxvWtpSQPrIjlnK Tbb7GiS2QzYwxSnEzkopMoZfYBY1czZr26hzR1Yc2VLbctfIyFW57Ji54N6PT6q1 UTOyTUyW1N5c6c2W+a/oiFXWm5Z2pstIDbTRdSlI0CQLgCNcSlTyPuJtbRF+a/0g aEon3goVtMx7q9tLcnPGlcGVNNLw5Msl0OZptS7hNvkIH3Rl9EmGkTqyt1AGzO9Q HKI0rDFQbRTXQ3NIA2x3LHMIth8y1PkrPZ0hOxa5sp6rLte0wvT+nFdhWrBpya95 JuE/K8PVDRieWl3KfPvbNClKVmzW33UNYW8NsS6XJjMhA0Tv+uNzMu3JjjSy6E5b 8l7xLe4PHKVLmpmpJcDQz7MM2vfTfm64huBCVkN2y9UO6Z+XnGUyqppp4LABb2gN /qikoxbVlk2uD5wP+YzXjR6IxvFyeMcItQlr5dpOBGbfa5AvGpVITsg6hFMQ802o XWGUmxPXaMzq0u+quTE06y5xja5y4pJzXHLGed0kWxq2OPuRVgL/AMcXOidCfeti lvZ3zct7n0Q44Nrqa7KTLqZcs7NwJsV5r6eARkz9arFXb4q7OzM2knNssxVu5bRo nBhLPs02fDrLjZLybBSCL6RnjyXOo8EyilEhVrAy6riGamBUEt7dy+UtXt/GPqXl DwYrNScX2RE0NgG0jZZflXvrfdGjOCSaZU66WULSLlSiARGc8J89KTFGkksTTLih MXIQ4CQMp5ovkxxinJciLbdMTsW14YmrIn0y5lwGkt5CvNuJ1vYc8bAt/wD0DSjL /wDr0i9/1BGEMSU5NN7SXln3UXtmbbKhfwiLeVr1ZLjUk7PzOxBDamlKNrbrWjHF kcZXLuXnG1sPeFGtomb1tYo++I9Xp5VVXl7TlGmXqETcHAlM5YE6o/6o+6mhXZJ3 uTvHJ1CO4wOc/PDG8k5h5DfE1TViHyc4TkIX3ul75bb+WKFylngtsHHRUeyO7KnZ bPZ+W98/8Icq6zIUijvz0mliVfby5XkEJKbqAOvgJEZjiKpzNZMttJpc5ss1u6z5 b25t17fwjHLstS5Lw3dPg1GfmhO8Hs3NBGQPUtxzLe9rtE2j8zQ5TmIay3SJiTFR mUsJYU1ss5sE5SLW8EZ2hcy6rK3tFnfZIJjNT+YS1oNY4PcaIw3RpmVVIqmC5MFz MHctu5SLbjzRpL/+lVA2KfybjzSVAnu8l7HqvCJwR0WWn8NzrlRkEvOpmylJeb1A yJ5/rgqb2IZKsTTMgJ9qWadUllLSFZUpB0A03WiXKUF5t0wqfA2UXAy6A484qoJf 2oAsGstrfWY+p9nYTRRmvYDW0VGF5+vPPTAqLs6UhIybYKGt9bXioxROVRFccDLs wEZE97e26NcVadlRWV3uWTEiZCbTOlzOG1ZslrX+uLNTnuh96SNhsu6ue6vfyQrt Tcy5lS48sg7wTDfgtLSpqa2oSRkTbN4Y0KixVZfiqZtgqzZEKF7WvpGKyU1xOZDx RmsCLXtG7YpCRUakEWy2Va37sYjTGEPTqULbCxY6ERSXKBIcqQnCCGijLp314aKE biTP6w9MUE3KIaUkNsBNxrZMXlEUEuSaLgHONPrjmy/cv5NYLY0KmTHF31qy5rpt vtyxfS1TGy+CO/50VWH2W3pxxLiAoBu9iOsRxxCXpWopblc7bezBsgaXuY7DIcw3 eWD196M1vqvHxLflOb5OW3XFNITUy43LNqdWoKCQUk74ukpUxuSUX6rXgBXrdTEn V32C0V5cvdZrXukGNIaXkUlVr2hOm6a1NTK3nJQOKVa6yi99LRnE/iDFMtKOOrnq i0hNu7UVADW2+M8mTRWxaMbP/9fUas7tNjpa2b7orYRuDit1CspqfH552a2RaybR ebLfPe3hsPJDzERlqVlpKmEEEESVCCCCACCCCACCCCACCCCACCCCACE7hQ+Ik54x r1xDjCdwofESc8Y164gDQql8rxg9RMV0WNS+V4weomK6ACCCCACCCCACCCCACCCC ACF+bxDI1OlPYal9r2QeSWE5k2Rmvz80MEVVHwRKGqy9a429tS5tdnYZb66RSep7 RLwq9ypwxhSpYemn3p7Y5HUBKdmvNre/NCnj11KMTKBvfYo++NynZJDiEgrULGFO scGchiCeM89PzLSykIyoSm2nhiJYvJpRdTd2I1EwJWZGekqw9xfiqCl85XLqy791 t8aPJjj4WWfkWvm0ixmJZMtRVSqVEpaZDYUd5AForqIeLoeCdcxG/wCuNIxUVSKN 2ZDjCWcaxpOqVayXEE2P6qYe6riinY2p7lBpG247MEKRtkZE2ScxubnkBidWcByd YnJqqOzj7bjozFCQLCwt90Y5h6vvUCss1Fllt1bYUAhZNjcEcnhjmeqLalwzRLho 0/D06zwZJmG8QZgqfKVM8WG00Re991u+ELdYrMpV358yuf8ALFObLOm3fk2vzb4X 8YYzmsULk1TEqyzxcLA2ZJvmtz+CK+mTyzOybeRNi4hN/rERra8seCavdltScBVq rzSpeVEvnSgrOdywtcDm64YZfDc/hdBkqjsts4dqnZrzDKdPSkxLlsRv4XcM7LsN vLWNkUuEgAHW+n7sW8pOrxu0alNoTLONK2AQ1qCB3V9f3jG0YwjOlyVepqyrqSg9 QnGU98UJGvhEKzA4gVF75e7Lruhiq7plGZlpICg0rKCeWxtC6g9kLhfcZN2XrjYo MlMknp6QRMM5ciiQMxsdDELDlPflMTSj7uXIhaibG53GHfB9GaXhthRdX3y+QfOM UFOQDWW0X0zkemKSgpNN9iVJoap3GVKoq0tTZfzODMnI3fTyxnFaxVTahVJvYbb3 5RCMyLb9OeHmewVK4hcQ89NPNFoZAEAa8vLGYVDDzMli1cih9xSG5pKAogXOojLJ OcXvwXjGLX5JuG2VYdq6Z+etsAhSDs+6Nzu0jRKZwj0GUbcS6Zq6jcWav98QcS4Q lpWjqdTMuqOdIsQIq8P4Ek6ww847OPtltQSAkDXSElki6hwQtPcYq/PsVTDk/PS2 bYvMKUjMLG1oxyYbU4kBNtDD+/Prl6grCKUJMsFcW257+x5ea+sUuLqAzh2RYmGH nHVOO5CFgaaE8ngjLLc/MuxaNLZj/wAFUs4MHq3fnS+XqTGbTgtiqZHNOL9cxpXB TNqVg5RKR+dL9CYiVXAMmyucqwnHy4FLfyEC17k2i7hKUYtEJpNk3AveT3hb/wCq I1er0lJ1yYl3dptElN7JuNUg/fEnAveT3hb/AOqFXF7AXi2cUSdVI9RMdRmXvCDT nzgmfAy72+X9omEbg/w5PzoqOy2XcbO91W35vZGy1ulN1ukvU91xTaHct1I3iygf uiDhrC0vhkTWwmHXuMZb7QAWy35vDGTUvmJ9iya0mN16hzjC6kF7O6Npeyua8JlF dTTZ5T8xfIUFPc663HsjXsQNCYqVSZJIDjjiCRyXJEJ68FSqhbjT3kEZLSrlHsWd urNF4MKvKv0GbUjPYTRGqf1Uw3VCvyVMkHp2Y2myaF1ZU3O+0Zlhg+5eQdlJf35L ju0KnNCDYC2ngifVaq5VqW/IuNpQh5OUqTvGt/ui3iIUR8tjBL43pFfKm5LjGZrV Wdu2/wCuKWr1Bjsgrvu9HJ1Qv0SQRRHHltLU4XQAc/JaJc1+VPl1XckgCwiI9RGv MHjfY97GvtnbKy5O+3ww4TYW/MTIRbRA3nrinXPLWzsihNrWvEmj1l2jOuraaQ4X AAcxOlo1WWLjq7EaXdFPiaqS7Fan5FefbBRRoNLkf3wjSGGKhS5oTUxstmkEHKu5 1hxqtNRVq0/U3HFIceWFlCdw3eyJMywJhktqJAJvcRXHlUrb4REoPgS6ioJWi/MY vqRgesPyctXUCX4kPftXO6yg66W6o9mMOsTBSVPuC3MBDbIVt2Qw2iioaQppDRaD hJzWN9f4xi8kJZLZdQaRzpVQYp0wt1/NlUjKMovrcRJnJ5moPB5jNkCcvdC2v+TF I4gOJAJtrHRhZYbyAXF76xvLNCLplVBvdDLTlBE3KqO4LSTDU/8Al+XY/I35tN// AGjPWqq40pCg2k5SIs5fF8zL5sss0c1t5MV8Rj9SflyHJqYRKNhly+dO+w+uE/hF kXk4DqajltZvl/aJjk9iqYedLhl2gTyAmI9fxA9X6JMUt5ltpt8JBWgm4soK5fBE PqIVsFjYs8ECwxM1aWX8I6hpxNt1klQPriNUhBwLRWqZV5hxt1aytgpsoD5yYfot ilqjZTIqYQQQRoUCCCCACCCCAP/Qf4IIIAIIIIAIIIIAITuFD4iTnjGvXEOMJ3Ch 8RJzxjXriANCqXyvGD1ExXRY1L5XjB6iYroAIIIIAIIIIAIIIIAIIIIAIrZ2qljD T6JOdSmdQ2Q2htYzhV+Qb7xZRk1I/wDykx/Pj98Vm6VepaPIxUCt4jdmHhUJqdyB Iy7UEC9+S4iPXa5idqolMjNz+xyD4IEi/LuEaXVaeuoNNoQtKSlV+6jpTZNUjKbF ago5ibiI+W9GmzRS3uijXNTi6GFOOOFwsAqJ33trEWivPFD2Zat43/XF3UfzOY/d MU9M71zwiNShnuK8UVuTxHPSsvVJhthJAS2lWgBSPbCGbAX3QwY2VbGNRH66fUTF ApBcTlBteOGbbluaxVIEBtd8+U23Xj2nKIrUoAe54wgD7Qgapzjt7LSLR8MniE62 +vugw4FkDlym/wB0TFq6G/I/Vhh6YlEoZaW6oLBIQkqNrHmi5wi3OSlKdQpt5ol8 nKpJHyU6xXYHx5JrrbwEm/8Am6uUfOTGitVVurpMw02ptKTksry/fHTo8+spq8uk X6nJy7lOeW4ykrUAVEjUm4iopsjKBTl2GxoOSLSuVJtmUmwW1HKbafvQv02ptzCn AltQygb40KjbKTEzKy6WpVa0Mi9ko3RWUEJViGW2liCs3v4DDNQJRUzSGnUqABKt D4YX0SS6bNccWtK0tKJKU7zyffAGhtTFNlAUuzEsyVagLcCb+Ux+fMYTq/d1Ulyj +Ycau2W1X10ta0WGO5lNVn5RxtJQENFJCvDChKNGVqsvMKIUlp5KyBvNiDHLllqe l9jSKpWaRhGoVqerqWcRPTSqeW1EicBS3m5NTYXhhxDU5WlPsopM6yw2tJKwy4LE 35YosdcIMliDDS5FmSmGll1C8yyLaeCFXC+CZvF8tMTEtNssBhYQQ4Cb3F+SLRyd o7kafU1ykydDmZOWqcyiUXOqG0W+tQzFXOTeFLhedlXKDICTdaWvjPdBpQUbZTzR 0dwTNU2gLZcm2VlloglIOsJM/T1ybSVqWlQJtpDJJxWyJgk3yaDwUKeGDlA5h+VL 5OpMOlbUE4fnVKIADCiSfBC9wY/FNX85X6ExPxpNJRgytXSdJRz0RrB+RMrJVKiH wfzUnkqGeYY3t2usfrRExCKa5X5lZVLqJKdcw+aIyzBEwmYTPWSRYo3/ANKLSdkV vTy3AtIBI0PgETFtq2VddjQsXVaek8MTb8pNuNvJyZVIOoutIP8ACKjg9rdYqYqP HJyYf2ezy5zfLfNf0CJ+MZJbGFpxwrSQMmg/fTCtg3FsthoTu3lnXuMZLbMjTLm5 /wB6MZz05EnwXjC42hOrNbqScfTrK510MipKSUlVgE7Td5IuMUT7qaWg02YJf2ov sFZlZbG+7k3Qn4imU1HElTnUJKETE046Eq3gFRNo+sP1FFHqKpl1CnElsosnfqQf ujVJehncji5W64yoJdnJpBIvZVxHx7oax9IP/ahkmpFeMXBOyq0sIaGxKXdSTvvp 4YVZuTVKTb0upQUppZQSNxtEaF6EXI7e6GsfSD/2oPdDWPpB/wC1EPZnng2Z54aF 6C5F7QK1U5iuyjL068ttS7KSo6HQwwYzn5uRlZVUq+toqWoKKDa+kK2HEEYhkjf5 f3GGPHSc0pJ+MV6IlRVVRNsWJev1ZUy0lU++QVgEZuuHrFU0/J0Jx6XdU24FpAUk 674zhobN5CzqEqBhzmaq3ilk0uXbUy4s5wtzUaa8kFFJcC2KvuhrH0g/9qHmXnJh WCTNqeUZji61bS+txfWEysUJ6juNIdeQ4XASMoOlobpYf6BKH/lV/fBQXoE5CX7o ax9IP/ag90NY+kH/ALUQ9meeDZnng4p8oi5Ez3Q1j6Qf+1B7oax9IP8A2oh7M88G zPPEaF6C5Ez3Q1j6Qf8AtQe6GsfSD/2oh7M88GzPPDQvQXI0fgoqk/PYnmm5qacd QJNSglR0vnRr/GNhjF+CFOXFU2b/AOxK9dEbREpURv3CCCCJAQQQQAQQQQAQQQQA QQQQAQQQQAQncKHxEnPGNeuIcYTuFD4iTnjGvXEAf//R1CpfK8YPUTFdFjUvleMH qJiugAggggAggggAggggAggggAjKJNIZx+h9HfpmyRfdvMavHKVn8OGQRL7SQ7JW KcuVO0z38t4pON1vReDOb1cnG0gp2ep+bCrW8eVqQqJYYMvkyA903c+mGKoIu2jK nl5BFjRqfKPSAXMSjDi8xGZxsE2+uLTi5Kk6Ji0nucGplycp7anbXdbBVYW3i8Sq ZT2MrnfbxyxFcfl0OKQFoSEkgAckdGK5S5AKE3PsMlfe512vaLcLcjkyDHUkynGN Ttm0Unl/UTCNTZpyYnkNOWykHcOqNDxdRatWcTT9SpklMTUg8Qpt9lJKFAJANj4Q YQVIDacyUhJHKBaOJ8u+5tzX4LR1apWwb+VvvFWVF+ZLa+9cXZVusxzu4v5SlW64 +M1l77KB/jCMaDY2YYprEnU3HGs2YslOpvpcRsWD5Vt+kuqXe4fI0P6qYxTCC1Kq 7oUpRGwO8/rJjVKIzOuSazLJeKNoQchNr2EdWK9O5nOr2KzFSQhupJG4OED7UK1J cU2p3LbUCL/ET6ESc6h1wBxKrKCjrfNreFukuIcU7kUFWA3RoVHemYlqEjIIl2dl kSSRmRc6mLmqNJ7EvOa5ikH+IhVk5GaflkraYWtBJsQIs5qaSqUW3trm1suaAEXE jikTLAFu8PpikkxxiqS7S+9ceSlVuYkCLPFiwmbl7qt72fTGxYLptPcwfSZhclKq cLAUXFNJJvz3tHK4apsvdIV8b4JpFJw4ualg/tA6hPduXFj9UI1MxfVMINuS9L2O R8517VGY3GmmsafwrPpXghwNOAq27fenXeYw5g9ydrqeTNrETioTuJZSuO5+jcPu qxHhGTm5+21m2bu7PuRrfdC9i/C9OlpBhTe1uXbG6+oxY4JS6MMUpQCg1shryWuY m4slnp6RYRKtKeUl25CBewsY6aTjuZXTImCm0yNBLLN8u2Ue615BHTGCQ7hCsJVu VKuXt4Ih0t0UyU4vOL4u7mKsizY2PLBX5tleHZ8bZKgWFcu/SD2jsTy9zK8Fy6Jd M7kvqUXuf3of5Ojys1LNvuZ86r3srTfaFDD5bImMmX5N7fXDfJsTa5ZCm0OFBvYj dviuJtwTYkqexacIKy3gioLTvBb/AOYmMRTOOn5vkjasYy0xPYWnJeXbW86vJZCR cmy0n7oq+DOgGWFU7L0xKc2y2XGGgfn3tf6ozy49cy0Z6UYq8M77ijvKiY55BF/i plKMW1hDTYS2Jx0JSkWAGY7op9mr5p8karZUYuW5Mptbm6UwpmW2eVSsxzJvra33 Rcz1GlH6Eurrz8adbDqrK7nMbX0+uFrZq+afJFrRFvOVWVZcWtTJVYoUSU2seSJs JlHkEGQQ5Yulmm2JUssoQSpV8iQOQQqbNXzT5IWG6JmH0gV6T/f+4ww42F5WU/fV 6IsKjLstUBx1plCHQ0CFoSAoHTlhGccmHgA6txYG7Mom0LJboiZBF5hNIFeb/cV6 Iqtmr5p8kXWFkEVxslNu4V6IWQmScbAGZlP3FekRZS4/0GI/8sv744YrkZqcfljL y63QlKgSkXtrHRMwzL4WXJPOJRMhhSS0o90Cb6WiSb3EbIIMgjvs1fNPkg2avmny RFlbOGQQZBHfZq+afJBs1fNPkhYs4ZBBkEd9mr5p8kGzV80+SFix24JUgYomv5kr 10RskZBwUpKcTTRIt+Rq9dEa/AkIIIIAIIIIAIIIIAIIIIAIIIIAIIIIAITuFD4i TnjGvXEOMJ3Ch8RJzxjXriANCqXyvGD1ExXRY1L5XjB6iYroAIIIIAIIIIAIIIIA /9J/ggggAjJ5N9PbAQ3Y342Rf6zGsRWsYZoaZcVVMmjshq5tdoq+a++17fwik4aq LRdHeZ71Phi4o/5gP3jC3MvOZU91y80KtYxPXKbPmXkpxbbOUKyhtJ1PhEWnNQVs tGNuhsm5FaXHnStNgom31wiYxF3ZT91X3RosuozMiyp45lONpK+S5I1hHx8y2y9I 7NOW6V38ojPO/wCmy2P7iXQ+ECRpGG2Ka7JzK3GkKSVIy2NyTz9cZA48FoKQDFhM vupmVoCrJvutHOoSzDMmtbaAlQIsb9cc6m3SkauK3aKwziJXvkqObmgDRc9+BACu 7t/GIUwc5TfW0TmCottIFyCALRo1W6M07Yw4O/ld3xB9ZMbXhGbRL0p1KkqJL5On 7qYw6j7eVnFLZStCi2RfLyXEbNwdgzdAmHJoFSxNKSCdNMqY5+p+I4ukx65pv+P/ AKWWJyexneLKm29UasyEKBMysXP78VeG/hJjwJ++JOL2C3V6wpCCLTTljY/PMUtD fmELesoi4HJ4Y78c1OKku5g1To2vDX8hs/vK9JirnKG9LMuzCnWylOthe++L7Arb T+E5Zx8BThWu5Jt8ox5WLGmTIBvpuHhEaEmM4z/PZbxZ9MbhgYZsB0gc8sB6YoKH hSjV5h16qyAmHG1ZUFS1psLX5CIZmEClMIkZIbKWYGRtA1yjwnWPOw9djydXPp0n cf8AHY0lBqCkKvChLqk8GOOrUFDbtiw8JjDzOIPyVRtnCY+5M4PW24vOnboNvrjG 2pNpQN2j/GOjLp1bkRtKz9EYJcB4PqUu2nFr/wATBVcTy1AYQ++w64lxWQBFrg2v yx8YUytcHtPSkhOWW0F92piLMSUpVkBqebDyEHMkFRFj9Ubb6fKV77lPOVBvE7/Z CWQplsDZ5XN9x4PDFdWJ1CaJOM5VXDKk3+qLWZlZemO8XkkBpq2bKCTqfDEqdpNP eo7ylsBSlsknujqSPDEpPTT5G1mc4UVmTN+FH3xqlF/khjwK9YxV4Lw5S1Jnc8mN 6LXUr9brhlXKtSiyww3kaT3qbk25eWODB12OXUy6Snqirb7dv+fQvKD06+x6y0Xn Q2CATzxPZkVt3utJvHr7bMuyp1nKladxveIfH3/038BHomZg2KGSMV1cXH5476xi p2J5xDLX2kuYiqS1JuVTLhJ5+6MV3F0fM9MVpkUir2J5xEmnrEnPszCxmSg3IG/d Evi6PmemDi6PmemFSJpFjNH3SJS3L+9Fk5iXOW/giinac5JTJYWtKlAA3G6LOWcc kyosEoKtDpe/li4lJBmoy4mJpkuukkFWo3eCDToikfdSF6A6P2Q+6EnYnnEbniPD 9MZwdNOtSgDqWEkEKUddOuMhMqkb2yPLHD0XXw62LnjTVOt/9ZpPHodMqtiecRbY dbKawg3Heq9EfPF0fM9MdZcKl3g4wClYFgQLx3UzOkN8I1aaKqxMm4777hGoYAkm avKzq6i1tVNrSEFV02BBvutCdiynsy+KKg2yyUtJWLDU20EcWPr8eXqZ9LFPVHf8 dv8Ak0eNqKkxR2J5xBsTziLPYN/Mg2DfzI7akUpFZsTziDYnnEWewb+ZBsG/mQqQ pFZsTziDYnnEWewb+ZBsG/mQqQpDFwYtlOI5kk/7Ir10Rq8ZpwdtIRXpgpTY8VV6 yY0uH8lWEEEECAggggAggggAggggAggggAggggAhO4UPiJOeMa9cQ4wncKHxEnPG NeuIA0KpfK8YPUTFdEirN7SdWkrcAFjZKyB3o5ohtSG2XlS66NCSS6QLD64A6QQd jB0r/wCQYOxg6V/8gwAQQdjB0r/5Bg7GDpX/AMgwAQQdjB0r/wCQYOxg6V/8gwAQ QdjB0r/5BiI4mXbqHEeMuKf2W1ypdUbJvbf4YAlxlEqtKMeJUo2AmzfymNQ4qn9I 951UZclCVcJHFE3SkzhSFE3tGOVXX8mmNpXZpLjaqkAiUG0UjUjdYfXHE12nYfPE am+WZgd3kCFK0O7UAiLOSl+xS1OZtrnGW1rWitq+BBiueNTNRMrdIb2exz7uW+Yc 8azckvLyI1e54ZplKTNFfvPf5rHd4IX8QU6axYthdFb4wmXCg6SoIyk2t31r7jDE /SBxJUlt9yNnny82l7XiywhQxTmpscY2mdST3lrWv1wlFTjTCdO0f//TRatTJunV J+VmmsjzZAUnMDbQHePDC5NHay6kI1UbaRo+PWrY0qab/KTyfqJhBnpTiUop/Pny kaWtvMcSaUtJ1NbWVCUln4QWvuhjwxUJaTxHRpl9zK0zNsOLVlJskLSSdPBC2XON a2y5fri3oVP49W6bJ7XJt5lprPlvlzKAvb641aM47H6gp+KqNiKYVKUuaLz6E7VS S0pNkggXuoDlIietCmzZQsYVcJYKGFqq7PCfMznYLOTY5LXUk3vmPzf4xfVOqFiY SnY5rovfN1nqjw/i/wAHn1SeeCbybKrVV/f/AJNseVQensKGJceYcEtP0oz5442s tKb2C9FJVqL2tyGFSnTbNVU4mTXtC2AVaFNr+HwQiYpVlxNV5vnnHVZfCs8sNHBW eyMzUwfe8iGzz3uVR6vw3oYdFh+XG993frSMMmRzlbG+Xw7VJpkOsy4Ug7jtEj74 s6Lh2pylXl335cJbQolR2iTbQ8xhrpLWwp6G817E6264lPObJlTlr25I7cuNZccs cuGmv8kJ07Ai0RJyZaEu+3m7rIoWsd9oVcUY/OHZphkU0TG1QV32+W2tvmmJklUu y9KbqBa2XGG8+TNmy9V7C8fJYP8Ap6Pi5xnehcO1b45/+I6pdR5FXIk1BaaXKmZn Ds2gQnNv1PgirTiWlK3TJ82r2RZY4Rnw2sXt76iM0Q1kB1v9UfV5Mri6Rzxinyaz J0+ZqEm1Nyzedl1OZCswFx4DHfsHUP0A+2n2xf4Pkv8AQimvbT/UXtbrMWEap2rK MTVUeeQbKZAP749sTpakztJcaqk60G5OXIedczBWVA1JsDcxaTr2zfy5b6c8T8Uq tgGpqt/sKj/ZimWCnCUX3RKdMk0XElKxCHzTJkvBjLtLtqTa97bwOYxHqGMKHTJ1 2Sm5wtzDdgpOyWbXAI1AtuIjEsKcISsGJm0imCb40UHV/Z5ct/1Tfvv4Rwq2KTiC rPVUyYY25SdltM2WwCd9hzc0fGR+AP58lJP5fZ2rvb/+9jtWdNV3NN9ytZ6KPOp9 sHuVrPRR51PtiZRuEVVWqrMkaWGtpm7vb5rWSTuy9UNfZP8AY/2v7o+1jNTVxOJp rkxudxDTKdPPyU1MFExLuKbcTs1GygbEXAsY4e62i9LPml+yE/F3vmMa0vdmnXjb +mYpcnXEayaRpXutovSz5pfsg91tF6WfNL9kZrk64MnXEaxSNK91tF6WfNL9kOGH uErCkhSEMTNSUhwKUSOLuHeepMYLk64MnXHH13SY+txfKyNpXe3+svCWh2j9aztV k6dSXKpNOlEm2gOKcyk2SdxsBfljOsUcImF6lLy6ZWoqcKFEq94cFtOtMLFZ4VlV fCz9ENGDQdZS1tuM5rWtrbKObnjNsnXHifCPgzwT+dnTUovbdVVG2XMpKkaV7raL 0s+aX7ItMPY6w9IVdD8zPFDYSoE7FZ3jqEZDk64MnXH0WeEc2KWKXDVHPGou0fqu g4npGJmnnaTNF9DKglwltSLE7u+AhfxZjzDknK1Sjvz5TPJaU2W9gs90U6C4FuXn jKcD49VguWnGRTROcZWldy9s8tgR8033wvYiqpxBiCcqpZ2BmVhWzzZsugG+wvu5 o+X6f4CodY3K/lqnF2rb25/89kdMs9x/Jd9nad+nP2FeyDs7Tv05+wr2QoZOuDJ1 x9d8w5thv7O079OfsK9kHZ2nfpz9hXshQydcGTrh8wbDf2dp36c/YV7IOztO/Tn7 CvZChk64MnXD5g2Nd4OqlKzlemG2HMyhKqURlI0zJ540yMX4IU2xVN6/7Er10RtE Td7mcuQggggVCCCCACCCCACCCCACCCCACCCCACE7hQ+Ik54xr1xDjCdwofESc8Y1 64gB7qX5+54E+qI+JXv3PFL9EfdS/P3PAn1RERa5xDTnEJZExMqQUpbWsoGu8kgH d4IA9isrzrrdNPFpl1maWsIY2WW61nQDukq05SbaAE8kebPGH0NIf1pf/wBcRpyl YiqCUpncM0iZSg3SHnlLy+C7cAcXq1M0pLiHfytqUU2y+8shLji1gEKAACQO6ERZ zFU/KJLfEpdx7i/GhZ0hIbKHFAHS9/ez5RE9ukYhZdZdawxR0OMpyNKS6oFtPMk7 LQanQc8eN0jEDLam2sMUdCFFSlJS6oAlQsokbLeRoeeAPH6zNdiXXcqGpliel5dz IcyVBTjV7XHKly0d6HV5mohCZplptbkq1NJ2SiRlXewNxvGUwGSxQUqScP0wpUoL UDMLsVC1ife94sNeoR63KYqaILdApqCEBAyzCxZI3D4PcL7oAuIpEfHdz/h4/wCZ HfZ4w+hpD+tL/wDriNJSlURiZyaqrMpLOKlMiGmnitRAXfNYpGnJAF7GTSq83DCh BULGfItGsxir081TOFlc6+FlpmeKlBAubdUZ5OxeBvc000EJuANeUxnOLK5jOm1s y+HxOGR2aVDYyYdTmO/uik+mGiQxTIYmcWxIofStoZ1bZIAtu0sTHzO4ypuHpjiM 43MqdAC7tIBFj4SImUouN2WSafBJDiuwyH3jaZLKVLKtDntrccmsJtdxbV6OthMj UAyHASvuEKva1t4PPDjUm1Kor88LbJTW0A5bHWM8m8OzmKyhdPWygS9wvbKKb33W sDzRORNw2ITpiXVq1PVGrPzUzMbV1wgqXlSL6AcgtyRHq5ZXTXE5knUaBXXH1WKa /SKu/ITBQXmSAooJKdQDpfwxFnJB1cspIKLm3L1xxVUlZs29OxQmzfwel9/LFzRl zLdTp7sqFmZS82prKnMc4UCLDl1tpFRNSy5QpDhSc17ZYacIa4loP88l/XTHTNql RlDl2bDg2q4lmqw6iucYTKhglJelg0M+ZNtco1tfSLivKcXOoLN1J2YuUi+tzFxU vzdP749BinW6ls2N/qjWEdKpuyG7Z+fa9nXiKpIeByGadvcW+UYdOCkSstM1QhaE ZkN7179Vc8KmJBtMQVXLyzTu/wDfMXXB/LL28/qnvUekxYouT//U0WVrFLYYDb1S k21i90rfSD5CYnzZBk1kG4IFiIy+YwJVaw8Z2WdlEtL0AcWoHTTkTGl9/KCXHf5Q nXdpFYyk200aNKthdnqVhioOIXXTLbVIs3tpktHL1AKF9YmtO4blKcJWTnZEIQ2U tITNBR6gO6uYocV4Jqdbm5d2VclUpbbKTtFkG9+oGKaV4Na2zMsuKeksqFpUbOK3 A/uxSUpqW0SyjGuSBjNMynD6i4haU7ROpTaM5B5zG18I9Oe9yS9UfDI5euMVmW1S qkpcsSRcWjPNvOi0ODc8FVaXVh2lSKp1jMWwgs7RObedLb4ceJS/6P8AiYwDDE81 T6hTp14LLTLiVqCRc2B5I2mg4up2IZl2Xk25hK20Z1bVAAte3ITzxpiyqXlZWUa3 J71Npy13dbTmtyuEffC1i6s08YSq8q3UZQqEs42Gw8kq3Wta97xf1H85/oiMrxPg Crt0+qVIuymwyuPWDis2XU7su+L5JNcIiKT5MxaZamb5gF5eY7vJFxJykoGG0qSk a7io8/himlDxEL2uue1suu6LJlxLiUuJvY88cs1fD2LKVdj9ADDWHaV+WSks20+3 3q9uo2vodCq24mJ9O4tM7S60Ly23L3b+aE9rFMhXXBTpVD6Xnu9LiQE6d0b2J5BD BQ5J2T2+0KTmy2ynmvHXDTXlKSvuYTiyVT7r6zlaVl467a1/nmKfiv7JXkMN+I2F qxNVCCNZpz1jFXxdfOI43k35NVApOK/sleQwcV/ZK8hi74uvnEHF184iPmfkaCk4 r+yV5DBxX9kryGLvi6+cQcXXziHzPyNBScV/ZK8hg4r+yV5DF3xdfOIOLr5xD5n5 GgpOK/sleQwcV/ZK8hi74uvnEHF184h8z8jQUnFf2SvIYOK/sleQxd8XXziDi6+c Q+Z+RoKTiv7JXkMHFf2SvIYu+Lr5xBxdfOIfM/I0FJxX9kryGDiv7JXkMXfF184g 4uvnEPmfkaCk4r+yV5DBxX9kryGLvi6+cQcXXziHzPyNBf8ABSzs8TTRyFP5GoXN /nojX4zHg5aUivzBNvzVW799MadHVidxsxmqYQQQRoUCCCCACCCCACCCCACCCCAC CCCACE7hQ+Ik54xr1xDjCdwofESc8Y164gB7qX5+54E+qI+JXv3PFL9EfdS/P3PA n1REN2c4iw68Jd585CkNsgFRJ05SIA+oo5qpTkpVZlS35Y02VYL74EuraIFjYBWe xOhPe7vLHvZ+a+gKn9lH4oqwGeMTDxw9W1GYKi8hcwpTa8wsboLmW1uS2nJAFmrE iELWyqQmhNNhS3WLouhCQklRObKRZadASdd2hjk3i6VdmEoRJTexKlDbkJCRlcCC bE3IupO4cvUbQCiXUixw5WSq5JcL52igQAQpe0zKScqdCbaDTSPsKlwkJGF6kEjN YAgAZlhw/L+ckH6rboAuZmdnXJ5+XkeLp4qhLju3STtM17JSQe57090Qq1+9MVk7 jBtGH0VKTlHnVuubJptWUd1sy5c90NLJPLBNzYnnEuP4cqxUBY5FBAWn5qglYzJ6 jcRFmmZOccK38LVQkkmyV5QklJSSAFgAkHUjfpzCAHBJKkglJSSLkHkilR8d3P8A h4/5kfKa7MoSEigVSwFtQgny5o505c1OYndnnKfMyrIlA0C+Ei6s99LEwAwx+fcR vq7YdQbsLcbUI/QUfnfFCV9sKpFKVfnarECKzScXZaLaZp/Be2HKpPAk6Mjd+9Fd wjjZ4rUkajYI3/XBwZLmE1Sespwe8jn+dGnpo1OqI28/IS8w/wB7nebClWG4XMYx x6sSia66lZ6JdM3hVthZIS5KIBI396IiYdorFPbmA044rOU3zEcl+qK+qzE1L0+a S0662htJCQkkBIG60GBZ119md4zMKWQpGXaLvbfzx0ozMhx+4U8I1SYAGXbNi/Lq hMP+NODumYfwvM1GWmptx1pSAEuFOU3UByJHPC5jKhzs3jydmWaZMPNLdbIdQwpS TZKeUCNRx/LzM3g6bZaZdeWpTdkISVE92OQRg4xep0XTfFn5tqUul8t5iRa+6Lqk oFMdkag0Sp2WU28hK9xKbKAPVpHxWKdMySmRMybzGYHLtWym+7dePnD5WrEdLbmc xkzNtJdDnebPOL3vpa0YbypcF60muYPxnPYuq7tPnZeWZbbYLwUyFA3Cki2pOndG HNyjsOKuXHPqI9kQZL3K014vSK6TLOqTlK2ltpJGhtceAR5P1JLz6VSU4lxsJsSy 4FC9zzcu6OyPFNmLMVxbTWpWq1d5C1lSJlywNrd+Y7cH8yvbz+ie9R6TEfFTi1zd UzLUbvrvc/rx5gN5pp6e2jiEXSi2ZQF98WK9x5ex7UaM6ZJiWlVto1ClhV9deQxp jDYKG3bm5SDbwiE2mUmQqEiiZXIsTBUSNpswq9jbfDBiYzTWF5wyG1TMpQnZ7G+Y ajdbXdFEpRtt2abOki5jxRyoUeYXhY4OXKk7TZw1gzRdDwycazXtbkzckOakslJF kbuqLRlqVkNU6M5x9OLfwwtCkpA2qDpGMVNsLcbJJ0EbjwitNN4TWpKEpO2RqBGE 1deV1uyrdzzxyZr+bsaQ+002UwLT08Gya8Jma4ymULwRdOS4vpuvb64i8GM84isz hCU/m/8A1CFzB+IJ5ys0qmTtUeNJU6lt2XdeOxLZOoIJtaN1kpLDLbijSGaWHbd3 xXIVZevLyXjSEItpoiTZ/9V/feU+5nUADa2kZ1iTH1Rep1TpapWVDJS4xmAVmtqL 798ao9Lo2nctC1uRMfnGuOr7NVFBWcvGHRa/6xjLO2kqNoJFIUB/vtLc0SWlFptK BqBzxFeC+52QPXljsyF7NOYHN174wfBdU3Q74WUWMRyridSM+/8AcMa7RHDObfOA MmW2Xrv7Iyqi02ek6sy/MyUwwynNmcdaUlIukgXJHPGiUR5S9vxdwqtlzbM3599o 26a9G5XI7ZHqvB5TJh2cn1TU2HFlbpSFJtc3Pzd0U9FwFTqlOqYdmZpKQgqugpvv HV1xpAGaTs4L3b7rN4OWErGky5SqIiYprxlXy+lBWwrKopsrS45NBFp48aTk0VUp N1Yg8ItJZwfWpaSkVuPNuy4dKn7Eg5lDktppDhQeD2mVXD9PqD01NpdmZdDqkoKb AkX0uIzmqz7tTmEO1OaVMupRlSp9eYhNybC/JqY2BFSlk8GEsxTZ1nsgJFpLbcu6 C7msLgAG998YQ+XK3RpLUktxMxrhSTw1Lyjko++4XlqSrakG1gN1gOeEV6cW24Uh KSOuNQwrtJt+ZGLcy2kpTsOyegzXN8ufltbdCnjhqlN4neTICUEvs0WDBTlvbXdF JxVa1/gtF/8AaLrUytbiUkJsYccGYblcSTU01NPPNhlCVJLRAvc8twYVmWA84luX b2jqtEpbF1E9QEaPwZyc3Iz0+qclnpdKmkhJeQUAm53XiMcVKa22IdqL3EfEUkik VqdkmFKW2wqySvedL62iPgdsYnxO1TJslplba1FTWirgX5bxvdRoNDmpGamnqbJO vraUouKaSVE2Ot4/PNDbnJepocpjb6JoJIBl0nPa2u7WNZY4wdtWV1OXBrvaupHT J77SPwxGe4NqW2V2m5w251J/DH1g+arRl5rsm5O5sycnGMwNrG9rxXTLmIVYxGXs iaeZhNyAvZ5dL67rb4tWPSnp5IuV1ZBreEpKmSrbrT8wpSl5SFkcxPN1R9UXCElU pFT7r8wlQWU2SU23Dq64aa60l2UbCkBVnL2IvyGI9MIl5UoTZsZybbuaNfk4/Qrr l6kNjg8pjsw22qamwFKANin8MT5zgupEvkyzk8c196kfhi3qNRkhQZlMpOS/ZAS6 g0lp1O12mXQAA3zX+u8L+D36/MGc7KqqC8uTZ8ZC9O+va/1RRwx6lGiblV2IWI6e 1R69MyDC1rbay2Uu1zdIPJ4YS04gmSu2ya8h9sN+PjMjGk+PfRo3z/o0xnbaVbQa HyRnDHHVKy05OlRqfBbUHZzEU2laUAJlCe5v89MazGN8EQIxLOX6GfXRGyRvBJKk YzdsIIIIuVCCCCACCCCACCCCACCCCACCCCACE7hQ+Ik54xr1xDjCdwofESc8Y164 gDQZttC56YU4VZUISrud570ffEb8l5nvKIlTX5zO+KT6URnnCBix/Dkg0xJtL41N AhD5T3DYG/XlVzD6zyX26fBPqMscWNW3siG0lbHgKk1Xy7U2NjZQ0MVlPqAn3J4J bKES80phNzckAJNz5TCfwSurewzPOuLK1rqC1KUo3JORu5MMWHO+rH/EXPVTEZ8T w5ZYm70tr/ATtWXcEEJVVq0+1XZ/ZzTiESs1JsttjvSlzvrjlOsYSlRtixPI2l/v b/2OsEEEWMiStuXaCAvalRQFGxFtRePhKpNQunakc4UI9mu/b8Uj1RGE4FxlM0Sp N0xxDszIzDuUNIGZTaid6Ry9Y+vfv6+n6OeeE5w/7Ff9irkk0jZaxUGadLS62m3F remmWBnIsAtYST5CYk5RzCKXE/5rTv8AiUr/AM0RdxyFgAA3CCCCACC1oIIAILwQ QAEA7xePMo5hHsEAeWHMI9sIIIA8sOYQZRzDyR7BABu3QQQQAQQQQAHXfHmVPMPJ HsEAeZU8w8kegAbhaCCACPMo5hHsEAeZU8w8kGUcw8kewQAb4BpugggAgteCCAP/ 1n7KOYeSCwG4CPYIADrvjzKOYR7BAHlgOQR7BBABHgAG4R7BABBBBABBBBAHlhzC PYIIA8sDvAgyp+aPJHsEAeAAbgBHsEEAEEEEAEEEEAEEEEAEEEEAEEEEAEEEEAEJ 3Ch8RJzxjXriHGE7hQ+Ik54xr1xAGgzq0ofnlLUEpDSLkmw3ohcq0nSq3TnZGeWy 4y4Pni6TyEHkIi2rshK1GYcZnJRmZaBSrI82FpvlGtjFP7laB9A03+pt+yJTadoF XgyiNYVpc1IrqDD6VzS3m1hQBylKQL9fcxNw2Qo1cggg1Fwgj91Md/crQPoGm/1N v2ROlJCVp7OxkpRmWavmyMthCb89gImUnOTlLlg7xXP0KnTM8Zx1gl5SkKVZagla kd6VJvYkc5iyynmMGU8xijSfJaMpR4dHkEe5TzGDKeYxJU+p2YZbdQlbzaVBpGhU Ae9EI2DcHU7DRXNzM1LzNRWSA4FDK2nmTflPKfq8LK/hyjTL635ijSDrqzdS3JVC lKPOSRrHP3K0D6Bpv9Tb9kXjklGLins+RRFxI+05L09LbqFHslKmyVA/61MX8VrW G6JLvIeZotPbdQoKQtEqgKSRuIIGhizynmMUB5BHuU8xgynmMAeQR7lPMYMp5jAH kEe5TzGDKeYwB5BHuU8xgynmMAeQR7lPMYMp5jAHkEe5TzGDKeYwB5BHuU8xgynm MAeQR7lPMYMp5jAHkEe5TzGDKeYwB5BHuU8xgynmMAeQR7lPMYMp5jAHkEe5TzGD KeYwB5BHuU8xgynmMAeQR7lPMYMp5jAHkEe5TzGDKeYwB5BHuU8xgynmMAeQR7lP MYMp5jAHkEe5TzGDKeYwB//Xf4I9ynmMGU8xgDyCPcp5jBlPMYA8gj3KeYwZTzGA PII9ynmMGU8xgDyCPcp5jBlPMYA8gj3KeYwZTzGAPII9ynmMGU8xgDyCPcp5jBlP MYA8gj3KeYwZTzGAPII9ynmMGU8xgDyCPcp5jBlPMYA8hO4UPiJOeMa9cQ5ZTzGE 3hR0wJOeMa9cQBos+640V7NxSLuC+U2+QmIPG5npDv2zH3iIrFPmy2+GFgHK6U5s h2Y1ty2hB7OvyEsUSS9q6p1CFuPTQmWGwUrOYLKk78lrFSbaG2uoD3xuZ6Q79swc bmekO/bMZ8cVVZp5/IwwSpwLyurBSPeGFbNJKk7ytRuMx39yYl1GuT7jClNT8hLZ Z1ttTSkKLjSBMJbuo5wCFA33J0Ntb3ADtxuZ6Q79swcbmekO/bMKFZqlRkMQrEsV OMKlG29jpZLq1O5V38KAm3LmHNECn4mqLFKaU6pqadZQlBYKSHpg7ILLoIOibnLb KdQdeQAP3G5npDv2zBxuZ6Q79sxn7mJ6mzPzDbT8lMA7Oz40ZT3JJAClpAJvbvz3 v1BxkJhc1JoecLedYCihGuQkA5SeUjn08AgCJLV3ElRdmjTqYl9iXmFy+0cqJbJK TY6ZD6Y78dxn9Ctf+q/4I7YI/M6t/wAUmPWEMU0287KPty72wfW2pLbuUKyKIsFW OhseT6uuAFfjmM/oVr/1b/BBxzGf0K1/6r/gj6dxTMiXVPJknQhhCGHZbfnmXHEo Cc1r2SeUA3Cr20AMOaxfV35SZTJ0tuXfl2WnHlvTFggqdW3lAyEnvNLgaE3sbCAJ XHcZ/QrX/qv+CDjmM/oVr/1b/BHWXxVNzE9NNdiSiWZU8hMw49lSotKyruSkAC4V axO4Xy6kXtMnxU5BucQkJad7pvurkp5MwtoeccnLyiAFwz2MwCTRWrDX+Vf8EXgM 0AvaTpbyKCTmWo6/UDFg58GvwH/P+f8AtXzfezHjx6DAHm0d+kx9pz2QbR36TH2n PZEKKPEnG1mlsSaiFPTZSpImFM5khlxVipIJGqQd3JADTtHfpMfac9kG0d+kx9pz 2QhVHEs5RqgJREumYaaSG9mVFTq1bPPfMTcjk7wgn5V7gfc5iOfl2WksP02aU4o3 mG05W0AC+UhTgF+vP/RgB62jv0mPtOeyDaO/SY+057IrJV1T8mw8tAbW42lSkA3y ki9r8sdoA8TV1OVGZkmpt1bkslBcUFKCe6vYC9jyc0d+NzPSHftmF6mfGmufuy/q qi7gDtxuZ6Q79swcbmekO/bMcYIA7cbmekO/bMHG5npDv2zHGCAO3G5npDv2zBxu Z6Q79sxxggDtxuZ6Q79swcbmekO/bMcYWa1OPM1haUzS2lttyypZpK8ocUp1aXO5 +XZITz238sANnG5npDv2zBxuZ6Q79sxR4mXMtYbqL0pMmXdal3HM6U3V3KCbDm1A 110vy6i2gDtxuZ6Q79swcbmekO/bMcYIA7cbmekO/bMHG5npDv2zHGCAO3G5npDv 2zBxuZ6Q79sxxggDtxuZ6Q79swcbmekO/bMcYIA7cbmekO/bMHG5npDv2zHGCAO3 G5npDv2zBxuZ6Q79sxxggDtxuZ6Q79swcbmekO/bMcYIA7cbmekO/bMHG5npDv2z HGCAO3G5npDv2zBxuZ6Q79sxxggDtxuZ6Q79swcbmekO/bMcYIA7cbmekO/bMHG5 npDv2zHGCAP/0NF43M9Id+2YONzPSHftmOMEAduNzPSHftmDjcz0h37ZjjC5OVia lqZOTIUFKZqKWQLDVvOkEeQnWAGnjcz0h37Zg43M9Id+2YWZTEbq52WlJyUaYcea S+VIfK0JbUlxQJJSNfe1XG7UaxHRi9fE0zrkgEyhk+MlSXrqJ2e0KRpY6dYPLa2s AN3G5npDv2zBxuZ6Q79swoKxRO7B1tdMDE0htx1QceypCEBNyCpIN+7GhAG/WJUz M1B6QprrT7yQ4wHHzKpbU8TZOoSsEFOpvYXuU9cAMvG5npDv2zBxuZ6Q79swooxb kDylttPSsuUoVModCSslgOhQQe9FrjU+XW3snimanZlckinNtzzZUVodfUlASAkn UovfuhoUgdcANvG5npDv2zBxuZ6Q79swsymI5idqZlmqaQyVqbQ+pzQrSLncCLaH cSerm+6zMzkvNlxM24xJtNBalMtocyG5uXUkZslgO9tuVrugBj43M9Id+2YONzPS HftmFL3WOBDijIoILjrLIS/crWh0N2IA7m5Um2867t1/unYoeqeYMyLaSwLzO0fy 5e7UnuLp1N0HvsvJADVxuZ6Q79swh8J7i3MI1JTi1KOZjVRv8uJjGKJqdmZVCZJc sy++nZuKN9o3exuCBY7t1x188HhM+J9S/eY9eANJqfyvGD1ExVBhkIKA0jITcpyi xhBqHDNSJqZWUSdTQ3fQDZi+lr7+qIfbbpHRqp5W/bAGllptVrtpNjcXHLAWWyVE toJV310jXwxmnbbpHRqp5W/bB226R0aqeVv2wBppSkm5SCee0eBtsKCghIUBYG2o EZn226R0aqeVv2wdtukdGqnlb9sAaVsGsuXZIy82UWj7AAvYAX1jMu23SOjVTyt+ 2Dtt0jo1U8rftgDTcMyy6XLTyZhxkF+ddmEWUdEqNxfTfF1xpq3wjX2j7P8AP8Ix jtt0jo1U8rftg7bdI6NVPK37YA19xqnOsPsONSq2XyVOoULhwm1yoW13cvN9Y5CR o4lVyolJES7jYaW0GxlUgEkJItqAVE26zzm+S9tukdGqnlb9sHbbpHRqp5W/bAGt GRo5ddd4nIlx0JDitmLry2Kb9zrYgeT6olNOSrGfZbBGdZWrLpmUd5Om/wDz1xjf bbpHRqp5W/bB226R0aqeVv2wBsyplpSFDatai28+z/PlvR1qenm1LRTpJE2FulZU p7ZgAfVrvjNe23SOjVTyt+2Dtt0jo1U8rftgBz4/iH6El/64PZHhnsQEgmiS+m78 rGn8ITe23SOjVTyt+2Dtt0jo1U8rftgBxM3XivOaFLFXPxsX9WPnjFbyZOwEplvf LxoWv9mFDtt0jo1U8rftg7bdI6NVPK37YAc+P4h+hJf+uD2QcfxD9CS/9cHshM7b dI6NVPK37YO23SOjVTyt+2AHOiy0+mp1KenpduXMyGghCHc/egg6264u4zHtt0jo 1U8rftg7bdI6NVPK37YA06CMx7bdI6NVPK37YO23SOjVTyt+2ANOgjMe23SOjVTy t+2Dtt0jo1U8rftgDToIzHtt0jo1U8rftg7bdI6NVPK37YA06PkoQpSVKSkqTuJG ojM+23SOjVTyt+2Dtt0jo1U8rftgDTSAoEEAg6EGPYzHtt0jo1U8rftg7bdI6NVP K37YA06CMx7bdI6NVPK37YO23SOjVTyt+2ANOgjMe23SOjVTyt+2Dtt0jo1U8rft gDToIzHtt0jo1U8rftg7bdI6NVPK37YA06CMx7bdI6NVPK37YO23SOjVTyt+2ANO gjMe23SOjVTyt+2Dtt0jo1U8rftgDToIzHtt0jo1U8rftg7bdI6NVPK37YA06CMx 7bdI6NVPK37YO23SOjVTyt+2ANOgjMe23SOjVTyt+2Dtt0jo1U8rftgDToIzHtt0 jo1U8rftg7bdI6NVPK37YA06CMx7bdI6NVPK37YO23SOjVTyt+2ANOgjMe23SOjV Tyt+2Dtt0jo1U8rftgDToIzHtt0jo1U8rftg7bdI6NVPK37YA06Ii6VT3ZszbkjL qmCLF1TYKrWtv8EZ5226R0aqeVv2wdtukdGqnlb9sAaI5TZF4AOybC7BCRmbB0Tc pH1XNua5j5bpVPadQ63IyyXENhpKktAEIAtlHVbkjPe23SOjVTyt+2Dtt0jo1U8r ftgDQE0amJl0sJp8qGULzpQGk5QrntbfHSZpkhOMNsTMnLvNN94hxsKCdLaA7ozv tt0jo1U8rftg7bdI6NVPK37YA//RcGKNIMTb00mWbLzqs2ZSASnuEosnTQWQNIOw dJ2IZ7GymyBCgjYptcbja0IHbbpHRqp5W/bB226R0aqeVv2wBohpkgZhcwZOX2y0 5VObMZlDmJ+oQTNNkZ15t2ak2HnG+8W42FFPgJjO+23SOjVTyt+2Dtt0jo1U8rft gB+l6JTpdt5AlWl7crLqnEAlYUsqIJtqLqOkfYo9NBaIkJYFlRU2dknuCeUaaboz 7tt0jo1U8rftg7bdI6NVPK37YAf10SlOh0OU6UUHlBbgLKTnUNxOmphR4RJZiUwR UGJZlDLKFMZUISAB3d9AIru23SOjVTyt+2KPFvCHTK3huakGJWdS86ps53spHcqB 5DAH/9k= ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=tutori11.jpg Content-Type: image/jpeg; name=tutori11.jpg Content-Location: http://zippy-egoboo.sourceforge.net/images/tutori11.jpg Content-Transfer-Encoding: Base64 /9j/4AAQSkZJRgABAQEAYABgAAD//gAcU29mdHdhcmU6IE1pY3Jvc29mdCBPZmZp Y2X/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0aHBwgJC4nICIs IxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIy MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAAR CAGwAkADASIAAhEBAxEB/8QAHAABAAIDAQEBAAAAAAAAAAAAAAUGAwQHAgEI/8QA WxAAAQIEAgUFCQoLBgQEBgMAAQIDAAQFERIhBhMxQVEUIlRhkwcVMnGBkbHR0xcj NEJSU3OSlKEWMzZVYnJ0dbLB0iQ1Y4Lh8EOis8NWZMLxJUWElaPiJidE/8QAGgEB AQEBAQEBAAAAAAAAAAAAAAECAwQFBv/EADIRAQACAQMDAgMIAQUBAQAAAAABAhED EiEEMVETQSJhoQUVMlJxgZHw4UKxwdHxFCP/3QAEACj/2gAMAwEAAhEDEQA/AIp9 99qZtqyrCvYFqCVBV+vhhGWwmLDLMyqpQa10BYsFKJ53hAXsMtlzFimJaUbUVcil yEJBvqknM3HkjKzLSLySpMmyADbNoQFbalpIH32ZFsOds88H8lRjS1KpdlsTuIFY DovkBfPMRYlNyaEuKMpLmyikANp69vmjMxKybzIc5GwL3/4aeMBW3GJBWHVzBCQj MqGZPO3eRIsON49FiQBSdbsFim9weu/q4ROFEkgpC5JkYjhyaG0bfJujMzLyLwJT JtC1vCaA/wB/6wFWDcuppjnJSopUVm+eK6rDblfLdGd2Xp6nCG3wlONWYOxNxbb1 FR8nXE8tqSbdWlUpL4U7g2m+7j4/ujykSCjbkLdyrCBqkwFVdS2lxQQsqAtY22xu amRWQNaEAqOYN8jgA9Kj5IsjUtIvAlMoyLW2tp4Xjw5LybS145RgpABFmhfO/qgI ANU/CbubQbZnLmqz8+HKMTjMohp4odxrAsgE7DdPDbkVeaLGhuRW7gEmztAHvadu fqj3MS0oy2FJkmFHPLVp4E/ygKZCLcoU9LuDkTXhFJ97TtEbXIJPojHZiAo8IvHI JPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo 8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPoj HZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiH IJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPo jHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8Iv HIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZi Ao8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJP ojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZ iHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAo8IvHIJ PojHZiHIJPojHZiAo8IvHIJPojHZiHIJPojHZiAq9EclWaq25OqYSwlDhUX8OAHA q18WW23ljYOk1GmxKvsIp7ZQ69dl1tlBXaXdKbgfFxYdu8CLByCT6Ix2YhyCT6Ix 2YgKZS6kl2bkEz9SpkyhVSbvgaZb97CFld0hCSEbPCv4O3ZHupVhLqZxoO0oMF1t MqZcMB1V3UAhWE32Xw2+LfFYxcOQSfRGOzEOQSfRGOzEBtvqk5NsLmprVCwJJSAk XFxmVDjGbVy6Wg5d1wFWG2SLemMdSp6Zl1scrDTjJTZSDmlQRhO0EbyI9OBKJZKA 4lSsZPNvssIDUkqpSqinFKFx0BCFmzlrBQunanhujFJVGQfkJB6Ymgw9OMocS0Qn MkAkJuoE2KgPKI+SVNk6cFCUYDWIAKsSb2JIvfxn/YjUldHG36fRlTjqEPyTDYwc 02UMBIJwnYUDYRvgJRL8rrplLjq0IYCVFZQLWIJuedlaxjxOTUpLMFaXHHFB5tkp CALFakpF+dl4QMekSAMxNlx1hTTyUJsSSCAFXBFuuNZ+jhNNZlZeYbVgfacKnFkl VnUrUSbbTYmArtT0gqcvV5yVYEnqWVpSnWMqUrNCVZkLG88I1vwnrPGQ+zr9pGlU nm36/VVNKxJTMasm29KEpP3gxgjOWcv/0Nn8J6zxkPs6/aQ/Ces8ZD7Ov2kRcIzl nKU/Ces8ZD7Ov2kPwnrPGQ+zr9pEXCGTKUOk1YNrmQy2f2dftIfhPWeMh9nX7SIu EMmUp+E9Z4yH2dftIfhPWeMh9nX7SIuEMmUp+E9Z4yH2dftIfhPWeMh9nX7SIuEM mUp+E9Z4yH2dftIfhPWeMh9nX7SIuEMmUp+E9Z4yH2dftIfhPWeMh9nX7SIuEMmU p+E9Z4yH2dftIfhPWeMh9nX7SIuEMmUp+E9Z4yH2dftIfhPWeMh9nX7SIuEMmUp+ E9Z4yH2dftIfhPWeMh9nX7SIuEMmUp+E9Z4yH2dftIfhPWeMh9nX7SIuEMmUp+E9 Z4yH2dftIfhPWeMh9nX7SIuEMmUp+E9Z4yH2dftIfhPWeMh9nX7SIuEMmUp+E9Z4 yH2dftIfhPWeMh9nX7SIuEMmUp+E9Z4yH2dftIfhPWeMh9nX7SIuEMmUp+E9Z4yH 2dftIoUx3ZtI2Zl1oSdKIQspvqnM7H6SLTHEZ34fM/Sq9JiwsOg+7XpJ0Kldk57S Hu16SdCpXZOe0jm8Iquke7XpJ0Kldk57SHu16SdCpXZOe0jm8IDpHu16SdCpXZOe 0h7teknQqV2TntI5vCA6R7teknQqV2TntIe7XpJ0Kldk57SObwgOke7XpJ0Kldk5 7SHu16SdCpXZOe0jm8IDpHu16SdCpXZOe0h7teknQqV2TntI5vCA6R7teknQqV2T ntIe7XpJ0Kldk57SObwgOke7XpJ0Kldk57SHu16SdCpXZOe0jm8Z3ZKZYlGJp1ha GHyoNLULBeHbbz/7tAdB92vSToVK7Jz2kPdr0k6FSuyc9pHN4QHSPdr0k6FSuyc9 pD3a9JOhUrsnPaRzeEB0j3a9JOhUrsnPaQ92vSToVK7Jz2kc3hAdI92vSToVK7Jz 2kPdr0k6FSuyc9pHN4QHSPdr0k6FSuyc9pD3a9JOhUrsnPaRzeEB0j3a9JOhUrsn PaQ92vSToVK7Jz2kc3hAdI92vSToVK7Jz2kPdr0k6FSuyc9pHN4QHSPdr0k6FSuy c9pD3a9JOhUrsnPaRzeEB+wKsqZXUJKVYnX5VMxPuocWzhxEBparc4EbUjdGfvJN f+Iar/8Ag9lHuZYDk6l8JSVy0y64jEqwBIwceCzGXlkxwY+uPXAVl2dXLYhMVeuB eBbiUtpaVZCbZqOpFrkgXF0knJRANvbU5yhDKmavpAQ4tpPPbYRhDirJJCmwbEXV lfIcconAEgkiVkrlSlk2TmpQsTt2kZEwASCkiVkgU7LBOXOxcflAHx5wHzvJNf8A iGq//g9lGB9pyXeYZXMvTBS2u7jxGJXO32AHVkN0b/LJjgx9ceuIx2bTNT5AKSpo KbXh2A81X/qEBzMf3pV/3g96YyxiH96Vf94PemMsZlmSEIREIQhAIQhAIQhAf//R 1IQhGGCEIQCEIQCEIQCEIQCEIQCEIQCEIQCEIQCEIQCEIQCOIzvw+Z+lV6THbo4j O/D5n6VXpMahqGCEIRVIQhAIQhAIQhAIQhAIQhAIR6bbW64lttClrWQlKUi5JOwA R2LQXuZIlEy9WrjKXJvNxmRc8BNhkXOJzGXWLxJnAgtBe5rM1YsVSrMOokFc5pkJ ON4bjs8H/ezbbe6Po9KyFAl+TSzLam1hLkuk6xYbKTZSrndhAFtl8rZxcqppGily jbs/MIlG1ZJSxe6yBmMdrkbPBCbZZ2ilTFWm9Jm3ZCVpS+QugKddcNlYAQSpI3nr 5xjhqzmJ8u3T226kTPZxeblOT4VJWHG1DJQGw8DGtHQKho6H2lTcotM5LqGJSkfj EjfiTv8A97Ips/T+SqxNuJcaOdxcFPjH+9sY6fqqasYzy9fWdDbSndWOGjCEI9b5 xCEIBCEIBCEIBCEIBCEIBCEID9j1KablETC3Q6Qp5aQGmlOG90nYkE7oh+/Mr81P fYH/AOiJ95SkKmSlRSdYvMG3xkxqa9751z6xgKZZ9E4p5udqOAuOlKDJTFkBaiof EzsTexyIATkI3JWacZn0PPTdSdaS3hKDIvWUbmxtq9tsOd9oPyjGRip6SoYYbfSv WqcbxrsVgJNivZh2bLWvzsr4ST6lazpG5OpQ9KYGipsEkrFgScVjnna22w5v6QgN 3vzK/NT32B/+iMVKUXJmad1bqEOPLUjWtqQSMLYvZQB3GJnXvfOufWMREgpS6jPq UoqPKF5k3+I3AUMf3pV/3g96YyxiH96Vf94PemMsZlmSEIREIQhAIQhAIQhAIQhA IQhAIQhAIQhAf//S1IQhGGCEIQCEIQCEIQCEIQCEIQCEIQCOIzvw+Z+lV6THbo4j O/D5n6VXpMahqGCEIRVIQhAIQhAIQhAIQhAIQhAdV7jFJk3Z2cq02yla5cWZURfA QOdlx5yfMeMdMrE5MUqn1OqpYaC2ClCS5cjwgnZttck243OzM1DubS5kdDZxZPPX KOEAZlSikrFk/GOEp2cPFFj0nnpfvcKNqQ4QUqUtXOSQLgAeYZxyvPdvS051LREK ZKyGKYTOTzr8xOqRZRmF48JvfKJOrTzR0anWplxxlDbN0Bjmharjw7bcrxrXN73z j5NSyZ+QdlVqKQ4nCVDMxilonh6Oo6adOIvEoedamJGqIfCw2tbKFpU0cJII2q4n r2xp11pucklzeqbZeTzXUsosFpNhiI439MSE66p1+TS54bcoyhSt6jgBuevO3kjB MMiYlnGSopC02JEfn9O01mtp7w/UxXdp/rDnE8yhibWhsczanO+XjjWidrkotMsw +UElJKFuA3BtkB1ZJ+/Prgo/R6N99Il+T6rT9PVmCEIR1echCEAhCEAhCEAhCEAh CEB+yKhKSs2mYRNyrMy2l5agh5OJN7pF7eUxFd5qL+Y6b9nEbNecm8bUtJKWl+an HGwUKSnYkrNypKh8ThEcijaSFaQuZeSknMiYZNh2EBqX0fRMPNPaP09vVkm+oGSA cJWb2yvbZfb1G2OQmdGqjNcna0elgvWKbOKSsEKAuQr5JuFD/KeqPUvSapOKdek3 HFoS+oaxa2EqK0kpxW1Bz253j09SKlTZTlD7rjOBSW2Q0pg5rITa+pGEbPNASfea i/mOm/ZxGvTEtNzc20wwyw028tKG2UBKQMLZ3dZMee8+k3z7v2hn2EbMnILkHAl1 1xx50F10rKSQohGXNSBYW4QHPR/elX/eD3pjLHhpBdrFVbT4Sqi6keMqiYdoTrDq mnZ6nNuINlJVNoBB8V4mJmeGZRUIku85/ONM+2I9cO85/ONM+2I9cXZbwiNhEl3n P5xpn2xHrh3nP5xpn2xHrhst4EbCJLvOfzjTPtiPXDvOfzjTPtiPXDZbwI2ESXec /nGmfbEeuHec/nGmfbEeuGy3gRsIku85/ONM+2I9cO85/ONM+2I9cNlvAjYRJd5z +caZ9sR64d5z+caZ9sR64bLeBGwjam6XNoQBKzVJdWTa659CUp6ztJjUTorMzXOq VcpriSPxDM4hDY8t8R8p3Q2W8K1HKrINTCGFzTYcXe2eXn2CNyMjuirKyloTVJSx gWDhm2xZRKbHbty29UajWi1RkknkdapQCT+KenErQsdWd0nykQ2W8DPCN1ilPONB T05TGnN6eXNqHnvGXvOfzjTPtiPXDZbwiNhEl3nP5xpn2xHrh3nP5xpn2xHrhst4 EbCJLvOfzjTPtiPXDvOfzjTPtiPXDZbwI2ESXec/nGmfbEeuHec/nGmfbEeuGy3g f//T1IRJd5z+caZ9sR64d5z+caZ9sR64bLeGEbCJLvOfzjTPtiPXDvOfzjTPtiPX DZbwI2ESXec/nGmfbEeuHec/nGmfbEeuGy3gRscRnfh8z9Kr0mP0B3nP5xpn2xHr jmcz3Ma07NPOJnqNhWtSh/8AEG9hMWKW8LCiQi7e5bXOnUX/AO4txH1vQWq0Glqq E0/T3WEuJbPJppLpBVe2Q8RhNZjvDSswhCIEIQgEIQgEIQgEe2WlPvNtI8NaglPj JtHiJzQ+TdndKZFDQ5za9cCdxQMQ+8AeWA65SeUMykvRmWSGnPenVIAONpdm/GBz 2gd+R4GNepThC1OPk4WgGxvNhkNm09e+JrR6ZSmmmaTLlLzalhKnQbFIC3UKAzyC VMZ2zAvnfOpVc2kgL7VgR5Ly93S/DW1vDUFWd5RmRqsfyc8N4mUvWaxpvZQuP5RV QLkAbTFjcsLIGxItHOJmOW4vNqWi3LReGJ/EcyAE+QAAfcIlpOSbfpvOtiXchRTm nP8A0iLd/GGJulEmRT1Ex+f6uZrnHl+l6fnSrPyhRq8hoy0zJqSEqU1rUkn4yVEn rub2y49UUWOtVENy08t1TKHA2vEcYFgk2JB6tkcsnZZUnPPyyvCacUg+Q2j7n2bq 7qzH7/36Phfa+li8X/b+/VghCEfTfGIQhAIQhAIQhAIQhAIQhAfsOeQpVdpZSkkJ qDxUQNg1LgufKR54+UOgO0qfmZhbjbgfBwoSD7xz1KwN32IzBt8q+7CE7Myyt157 C4lIDzhzQDvG8qHVGvyZXSG/qJ/rgNCXpC6no6+wlSpeZTPOusPAqSps4yMSSLEX SVJuNyjxjer0oiXoEvKyjAQyy9LobbbTklKVpsAOAA+6PvJldIb+on+uHJldIb+o n+uA9d51uaUd9H5eUWhsWYWDhW2SiylEYeco5pviyTsGZvjnMqikH5v+SY9cmV0h v6if641AtCpxSEPhxTWJCwEWseadtzfIiA59JflFP/vRz+IRAVpySOnukLMw1KLX ytxd5hpKrJCdxVuFs/8AZifkvyin/wB6OfxCLvWpVvl7RakJZ1b80UOrWwlZCcKi TtG8DPPxGOulqRWLRPuzhxrRma0J75z69JG8LPfGWVLBlolOqTrNZcJHgHmEgZnK 2wxhpkroMyiWfmalMOPBm7rLiFYMZbbuMm9y1OgC9rJScQvaOs0RyVqanUPURhko zxlpABzy5u0ZWz3kK4R7mhJy1VcYNPkdUmXQ4AWUglRUpJub5JAAJOE2FzfdH0Y+ 0ax7T/P+GdjkE+NDZFySRS3zPtpqCHHjNpWgrZBN0qKUAhJATfCCczbgMzg0Mek2 sU9q5tM0pa1tS5CVNFhnm2LZBId1lskiwUbC6RHWqCmWqkjrpmlSbS7iwSyOdkMx cbL3AO+0Yp1TMlMqQaLLOtoUQVJYSnECLoNzkALKCidlr5XtGvvOvif5/wAGxxut yWhrUrOLo1SnHnkkCWQ+TzhrnEkn3oDNtLawLi2MjMpsatH6Up5kZ54NKoaGCWys lxlFgbjK4yOSgYx1QSlPcUoU6SLaG0rwFgY3cziwn9EC5yOR3Run2vWsY2zP7/4P Tfm+EfohM5J6wYqJKlClrSkobBxBIGaThzxG4T8o2GUblPMhPPhpdGZYVqg5zmkn aAbbNtlC/XcC9rxv75r+T6p6b81wj9Td6qd0CV7FPqh3qp3QJXsU+qH3zX8n1PTf lmEfqbvVTugSvYp9UO9VO6BK9in1Q++a/k+p6b8swj9Td6qd0CV7FPqh3qp3QJXs U+qH3zX8n1PTflmEfqbvVTugSvYp9UO9VO6BK9in1Q++a/k+p6b8swj9Td6qd0CV 7FPqh3qp3QJXsU+qH3zX8n1PTflmEfqbvVTugSvYp9UO9VO6BK9in1Q++a/k+p6b 8swj9Td6qd0CV7FPqh3qp3QJXsU+qH3zX8n1PTflmEfqbvVTugSvYp9UO9VO6BK9 in1Q++a/k+p6b8swj9Td6qd0CV7FPqh3qp3QJXsU+qH3zX8n1PTflmEfqbvVTugS vYp9UO9VO6BK9in1Q++a/k+p6b8swj9Td6qd0CV7FPqh3qp3QJXsU+qH3zX8n1PT UHQ/SagUvQygykyZNcwoOiYJcYBYu+uxcC1BXgkHIE2GzZf3OVmhOSqtTVZdK8L5 aEtNMI55feIxYiMsOrt1Re+9VO6BK9in1Q71U7oEr2KfVHydTVre8355nLpEYf/U 1JCuUtqn1gydTozU47WnnGlTK28CmcDdibgnBtth39V4q2mc3LTtOr70o+280XKc MbakEYg27fwObe972yvHaO9VO6BK9in1RRe65Ky8toMeTsNNYptvFq0BN8lbbR3t qxMT35iI/wBv+kw4LCEI4KQhCAQhCAQhCARZNB54SOkChZJcmJdxloqNgHCLpv4y kDLjFbj004tl1DrailaFBSVDaCNhhI/RRmZE6Hy1QlXXGkcmCA04QFqUsIQonO1+ Zu+Li6rUysFRQ02kE3JNh1f+8WWgV9YoTU2htRbUEvy9icCioKS42SMuau44hKkj LKPqnKQKM1LITNGcbJJeUhPPvc2Ub7jYXtsEeS8cvd0+ZpNccT7qMywtbzaShVio A3HXE6s3WfHGzGFxvMqGzhHLDrqaM1rxy0nvxhiRp04yxKlLrljiNhYnKwiOe/GE cIxAW3mPjdRSL2mJ8v0HS5jRr+kPOkE/K6mYdUXdWtIQotpuQbXzFxuEcymJhyam FvvKxOLNyYs2k7nIpYSgcUpyaIccKwL4RkLcASP+WKpH2fs7RimnmPd8H7W15vq+ n4IQhH0HyiEIQCEIQCEIQCEIQCEIQH7In30y6ZhSm3l3dWLMsrdPhJ3JBNuuKTNS kwlTbsmKglzlLjro73PoK0LWDhxBu4sm4vmRfKLfXJluVp9QUuZallqLqGluuBAx ki2ZinLq7rqXMNbkWkrU8UDlTWJAKTq95zubHaMh44DYfam1rDiHampWsStaTT5l AWAgJNiEcy/OvYbxwjyWqlmrltVU5qikKNOmAMZWTiwhFvAOG2619ucJusqfkDye t05uYS8vDeYQkKQEqSL5nabKy2XHCPBrcwsO2rVMRlzPf2jnhVe2ezFa187HPOA2 KZyyUmy5Mrqb7ZByMhMHcAMtXmctu3LrMb1KXrJydXgcReYWcLjakKHNb2pUAREI K3Ol9a11ilhAaThSiYb8O4vtOyw2nMXVYGwvNUh5qYmp11h1DrapheFaFBQPNb2E QFOkvyin/wB6OfxCOrutN659SiyhDdlKW4Vb/FHKJL8op/8Aejn8Qjple/uatfs/ /pMSEhj75Ub87Urtlw75Ub87UrtlxJyrEpyNm7TF9Wm90jhETVG6i1NOLpsow+nA nAh0NJbBuL/pKNid6QCN94qvffKjfnaldsuHfKjfnaldsuNRjv8Aa51D1Pp6WtcQ 25gQtWA3zIxp2Gw8XExNU9hBpsry1ljlepRruYkc+wxbLjbfZAafK6eqWcfYm5KY SjaGVOKz4cIiK/UVydPm3GkoStDIUkEXBNyM7xM1xDSJIBpKEi+eEAbxFd0tSPwV rChYLEsLK3jMxJ7Ste6jTWn1cZZxpcYvf5oR7Y030hmSwhpcvjcKRm2NpiirmFLk ksqKisG5WTtzjp+j/czn1yNLqpqbOreaamA2UquAQFWjyV9Se0vRMVjvC+0KUnm6 U8uvhvlYdODUnLBYW2b74oq+ls5pFSi9PyJlxTMSEtlYBXcgA3H6146CtsrWLnm7 0nfFA030eqTq5icTU1CnrWgIk8SsKTYC9tm0E+WPTqRMVxXu51xnlEaQ6dOCWkTQ 1jW4Fcq1zWWKybW/5oj9HdOKzP1+Sk5xbJadcwqCWwDaIiY0emHQnBNJRa98jnFl 0WRIUKlOszcizNTxeLjU1q042xhSAAoi4zBOXGOdI1ZnNlnbjhOaRVifkUEyJbB1 oTz03ysY2aHVX6mVBRSSjBi5ttt/VFdq751Qm3CpbbixZBN7ZH1R5aW7KJCmHVta wAnVqKfR449LnhuaXaR1OmaUmk01TQu0lSQ4i+diTn5IjxpFpRgF1SuLfzBGtU2H KiFul08sIATMLJKwAflbdlx5Yg3tJEUlPJX2nX3GjgUsK8I8c44zXE8y3HyhOyuk WmOCZ5SqTxW95woG3Pb90S9G0nn5dCHdIFN6tJOs1KM7fFtbrtFDr2kWCRSGUvNr ebXhUldik2Fjl440tDpWpaUVaVpBqbwVMFfPdcUoDCkqzF/0YmtHwTWJnM8fylcZ foOWekZunszzWMsvC6Ccj5op8vpFNcpa5QpOpxjWYUZ4b528kZqFLTdKnl0eYnFv plWynwjhvcZgHZtiRqOjPfepyU1JKZlJeXUNayEWDvOvmBkcss483RdNq9PWfUvN 5mfee0f3u1ea2niMNBzSL/8AkrWBX/wfDz7o598J/naN+a0ipuFPJlO4r54kRLze j8q9RnZRqXlm5lRGF8NAFPOB22vsBHlitzGh8xLpSTNNG5tkkx74jDCRfr1N1Dj7 KnNW0kqXdOeQvHPK1p/VW6k8qmONch5ur1jXO8EXv5bxN1CQcp9mVuhaXUm4GwjZ YiMFMoEvV5wSqWZdJKSq6mgRlGL1tP4ZWu2O8LNoajSCfZE5W+TmUfYQ7LlmwPOz z8hjGqtltxLK1e+L8CycojKQqoTdSnKTL1B9hNPJaFnFBNknCAkA5DKNJ+YDs4y+ EkBvaOMWmMcJMcpLSDSKYkKMXJRSRNhYBxIuLGKYvujVsc0OMYxkfehE3V1JqUiW EJwLKgcR6oplRpfexBdcKHNYSBZOyOOrvicx2brFccugaKVHSvSGTVUQZQyTTxad NglWQByH+YRY9I5mbpOiCak0UCZ1gSSRcWKiNkUzuX0+ozFOVUWqk43IMzig9Jha sLpCEkki9jtG3hF90nk1VzR4yLCgyC4lQxDIWPARqu6aT5SYjcrGmmkU9SafS3aW pAcfaWp7WIvmAgi3nMVLR7TfSupVGSTMLlDLOTbbTuFsA4SpINvIYuWkmjrtUkZQ JfQgSjasWIE4sk/0xziQkXm9LKQth7VS4mmStpFwFHWDOwy4eaNRFszM9kmIw7jH P+7F+Qw/a2/QqOgRz/uxfkMP2tv0Kjbm4BCEIBCEIBCEID//1fz/AAhCAQhCA6Jo DOon6RMUZ1StbLu8olxjwpwLslwE7AAQhV433Zqfl3lNklYByJRujmUrNPyUyiZl nVNPNm6VpOY/3sjrVQnpqi6N06q6RocYnZ65SxhJWoJw84/JUQQbE3jhq0meYenQ 1Ij4ZnCONUm0mysIPWmPqaxMDaltXkMZBVaFPDGublgogXxuBBH3x9cpzEwq8m83 YDnAKxR55iYeuY1O9bZS8vT25lluYeKsTiQrCk5C4jK8JGnIC1tpvmRfP07IhKjp XJSEslgO4FoAThRmrLdYbI+T1Dr1Z7niq7IyuJDyllbaiS8WBYYkjZmcVxnkARty +JpdHr9RfdbMRMvs6vW6PT0xM5mI7Od12pqq9ZmZw+CtVkDgkZD7ojoQj9RSkUrF a9oflL3m9ptbvJCEI0yQhCAQhCAQhCAQhCAQhCA/Zr+HHMKUgKs64QDf5SeEagcC nAgMNZi+alX2gceKhGaoMLmEzCETb0rZ5ZK2UoUoi6cucCP/AGiEel0y60Id0gqS S4CB7wwcsr35mQuRty2QEoh5LiUqTLJwqAINzsIJHxv0T5o+F8JSklho3Ti5pVl5 7ZxFrDTaXSvSeeSGcnLol+b1eB+l98fFtsts6xWks+hsIx3LTAAAOXxOJ88BLpdC hcywSL5YsQv4s4jZSYXMT82F2CW3VIQANgwtn0kx6TJF0KwaQVBQCiDhal7BW8ZI yMYKYhDU3NtpdedKXlhTj2HEs4W87JAA4eSApcl+UU/+9HP4hHWJjIzhH6Ecnkvy in/3o5/EI6xMZmcA/QiQkIaqPzBlWkJmX29ZNS7alNuFKsKnkJNiNmRMe9RT++3e zl1Y5XfwOVu+Bhxazb4F+bi+VlHubkZiYQylLShgmWHSSk+Ch1Kj9yTEj3tp3fPv jydzlmLFrrLxeBgw/q2zw+DfnWxZxVQjcsyx33em5+qliUm0tAom3DgQW2iSc9gK 1EncL8IkJCWlnJVFQlZuorbUF6vXTLhSsDEAoAmxBtcHeCDGeVlAF1dEyhSmZ2Yx ABKs0FltBvllmkxtYGmpJMuwhYQ23gQnArIBNgM4CFqDi1ya8a1Kta1zfeI81CRY qVFqUlMvlhh5lKVugXwi5zj7UEqRKuJUClVgbEWNrxWdNarPSElMtyj+rC5cEjCk 3OI8RHi6/p7dRo7KTicxOf0nLppW22zKhVXR6hUyoOyqK0VobtZZSM7gH+cW+n0G oLpsqqXlXXWCygtuAeGmwsfKIoBQitSSWwMdXUbrWeaCAfNstujtmj9WZb0Tl5Nt ShNSVPQlfNyCkoAy45iO+hXbXHf5+f8ALVpyrK6FVG0Fa5J0JG0kRrSlbb0eqZcd KA6hOEoWbWuI3NGq1pNW323pqdS7TQ7q30lttJIsDuTfeIidOdG5xNTm6wlDYpTi m0o5/OvhA2bdoMWdWdu6sJt5xKvzUtSKnPhTlTDesdJNhsxGOr6MUem0LRualpao mYlVPKcW8oAYSUpFvuHnjkrdMk5NGsm2eeoYmSlRyI8vii2aIVKenWRT3HsTD75C 0YUi+Q3gX3R8vrejv1WyunbbMTE/X9J58e3l2rbbEzPLYqDWtqL5liXWyq6VDeIh K7JtspYFQdMsFhWrxDwtl/5eeLPUadN06YcLeFDOLCkA39MVrulTMvU26MmRvjZD oexC2ZwbPMY+taNuni3LjXm3CuClUkKCu+n3R6dpVK1YUqp2STkbRiohpkvXJc1x tTlPGLWpQTc804dhB8K0fa2JKZnHu9KCiR1l2UqJuE267mPPN4iM4husTMsM/K0C eVLhdZSgsk2sNuz1RYNHtBZSeDVTE873tClJXMhIwpNrW85A8sc873KcnmGm0jE4 4E5q2kkR2zQqlVaW0WTIzCm+9ZdUXGgRcm9xna+22+Oto9Wsx2zHfwxGarQuQpzG jMlKLn8Mq0QG3iPDyP8Ar5ojKXUqo+04qTp2vQk84g7IgNJJ6fS13vl3gmXYdGBB SMhY7yL74laBUZyWCnJJ3BJJWFTKSkElI22uL7L7I8n2Z0Wp0lLVvbOZmf7xHM+/ 0a1LxecxCX76Vxn3xVHsBxJjAmcrU06tTdKKiTiIB2RLI0gkaosScspwvOeCFJsM sz9wiRkGXpVa1GwuLZZx9NzVKpz9Vqkq7LKpuAOtqauk3tiFv5xESs2+mnN6JNsB cyxdZT8exJXs2fGiXkHanRmXHNI3UrKTrElsJNkDb4IERrtTpNZrTj2iiXG9JHAC X3QQkoAAIsolOwDdHKbRxb3axPZo1GSmaS025Psql0OGyCveYsOiLssgrQ6+EPKc GBB+NlHysNuaT02Tpz1np+SA5Ti5gxgYVEEWvmDCrS0lTXW5imNllxCcQUSVWPlJ jl1WjfX0badZxmOP8lZisxL7p2qQdprzDk4lDwcQSjeMo5/SZaUYmX1S81rlqHOT bZnF3q8nK1DRFFVnW9ZOOuALcxEXsopGQy2AboqKJOXkiXZZvApzwjcm/njh0fT2 6bSrTUtumIj/AMjtx4zy64nVt8PGW9CNVL68QxKy35RnS6lZsL3j211K2TU6e9O6 WpSJp6XnGGGC406gIdWP+GCCL+nzRMaJ6N0zR3ReYkZKpKmmFzYeLqkgWXzAE5fq p88VpFVnaZJTfI3tXrGzi5qTewNto6zEboBW6zUacJZ6aC0qnklQwIF0pwKOwcAY 8H2j0ep1OzZbGJice04n9O/hnTvFc5h1COf92L8hh+1t+hUdAjn/AHYvyGH7W36F R9FwcAhCEAhCEAhCEAhCEAhCEB0buQ6H/hBpH3zm2sVPpxCyFJul134qfJ4R8QG+ P0BWKLT6/TXKfU5ZExLLzwq2pO4g7QesRCdzilN0jQGktJbShbzCZhy20qWMWfXY geSLVGZZlxSd7gJxLVI6QCxVzG35bYOtQVmfIIiXO4PpEHyGqnS1NXHOUtxKuvLA fTH6BhDJl//W90DuH0OQ1b1YmHqk8BzmwdU1fxDnG3jz4R02WlmZOVZlZdsNsMoS 22hOxKQLADyCMsIyy413WO5vJJkZrSelYZd1s6ybYAOFy5AxJt4JvmdxvfK2fD4/ Ytdpwq1AqFPKUq5TLuNAKGVykgHz2MfjtSSlRSoEEGxB3RYWHyEIRVIQhAIQhAIQ hAIQhAIQhAfsioGaCZjkjLLrheXcPPatIF053wnqytFfnqbU6ilCZiSp5Sknmiok XvuvqrjyW++J+pTTcoiYW6HSFPLSA00pw3uk7EgndFdqVQYnJBxhtudClFJ50g9Y 2UCQfezttbYduwwGorRibWHccpKKU7jxqNTNzjyX/wAK2YuOq+Vso9O6NTLqMJp8 iPei1cVM3wFISR+L3i/1iducYA4vXsr10+222hKA2iTfASnEgqAs2AbhJGwWxZWs I13zPv4SZ+fGEotgkphJyTZWerNirjY2vATkjT6nTmVtS1PpqUKXiI5fbOwG5rPI AXOeWZMeqYh1E3N6/Uh0vLK0suFaUnC3liIF8rbt8em6vLoaQlaZ9agkArNPeGI8 ckR4pSi5MzTurdQhx5aka1tSCRhbF7KAO4wFMkvyin/3o5/EI64fhEx+u16RHI5L 8op/96OfxCOtrQlx2ZQtIUlSmwQdhESEhEa9n51v6wiGqkzV0zhNNXLrY1aDZak+ EFKxAXN8wU+RORuYle98h+bpH7K36ohJmo0+TqE0xMUKTDDOSXkstHGcKVHIgWti tt4byBFVmXP1oBBQxJG7iQq6wDgN7m2LIggZXI5wzyN5nXs/Ot/WEVY6R0RCmEOU RgLcQFLAlmThujHlbad27ed0WGXlqbMyzUwimyQQ6gLSFSrd7EXzygNJ5aV1WoFC gocll8wb/wDEdivd0H4M9Y2/swz/AMxiwuIbZn59lllllsSzCsLTSUC5W4CTYC+w RA6eoS406hZISZcXI/WMSe0tV7uUyzrksA626pK8xiSqx88dFTpSieoMpJU+Qfam W5dKJh9ravmgEqIzOdznHNw2OVGXbupAFwd8WvQ6q1OizM4iRlm3eVtBlzWJJskn aLEZx5a2mJxDviFp0JqrVFQmgPtGYdm5guJmwRgbBSBY3/VPnjHpXMPS9amkOzyp iRBRhlg4SgHCMwm9tt4NUKZpkg68WHRLoJUtxdubsiIYladO1hTtTmVS9OUn8ekg c4AAC5B333R1vmKxHuxHM5UybnJyamEoSuYtjISMRO07o6L3PpZ+TqUqiaQsKMzi stJBthHGNGuS+jlKnqU5SamuZSp3E8XFg4ACm2xI4nzRcq3U1zk2iuUPVzrMo2El wAlAWCSQdh2KHnjOl+KZn2atxGFrmqUZmacdWUFtRulCk3AjnmnyqfTlU9htmXec mC4i7ITdB5oz8/3RbdFa/pFWpot1KnMMSYZLjbrSFAqVcADNR3E+aOcK0SrzukBm HaXMJabmsaVACxGO9/ujd7zNeIYiOeX1xcnT9FH6FNUdL1UWoLTPqZGJIxA2uRi2 Ajyxu1WgSzugVLcl1SsvNKcSVrCQlZGFeRIz4RatImJedm1uNuKVOlKQlpJyI/8A a++KjXqPUG6c24uUcCC6ACR1GFtPbEz3WLZ4VhdSp3Jnm0STSZhtBSl0JSCFWyUD tvcXjqfc8mVO9znE+tS169fvi1XPhDeY5ZpbRaDTkU1zR+fenXXAtU8la0q1JGGw Fki21fHZF40Wmyz3LXgnCTrzkf10xNOZ34kt2aOlL2rmnlpJIL1rg9Rie0Bn2XGH 2XZIupceSk4kggAi2cVuZll1NlKQlRVfEQjzfziY0Kqs1JaL1udl221mXSp0YgSL pQTnnsyjuwkdLaWuQqjlZp80iXSyhIElLnAsk80kAeO/kjYkNMRKyjJm2ZgqLaQS 4vfbPbFCermkc/NjS1NNZLbQ1esShWq+Rnzr/G4xYdJpijzujlImX54Jm3kJcfbS bBCygFQGW4k7441v3mGpjsvNeckUo1jypeYQltRUklKrjeM45dO1liUrr01TqWuU RYBL7CAgeCLgKSOMbclLKrko+ZFKphpIKHFN/FuIjK1VK1IUf8HORNCQYWFJdUk6 wknHmb22qO6Lq2mIzBWI7S6JM1dij0Cl1BNOW+9OMoU4ppIxklIUSo78zGE1uT0q oU9OSslyUSwwkKAuSc8rRLaOtuzejVKTMIKEpk2SCnK/MEan4OSejmjVSZk3H1pd TiUXlAkEZZWAjUbsxPscYUR+bmS2ZYzDplwbhrGcA37NkYEupRk4RY5DEdkfXvxy ogZhb89MKZ1YKGlm5SMwL2uY81pmLzh9GbVroxnwnCkX5qgscU5x7QNWA4fNvjWk 36dIslpqaBSVYucc/R1RmUtLw1zZxNq2KGwxqaxX4oY09adX4Lf+tvmrSQQCCMwY 9UxpqUnJVMo2hlJmW7hlISDdSQdnVlGgHi2CE2N9t43qN8Llv2hH8QjpXW3Th5dX S2TOJdFjn/di/IYftbfoVHQI5/3YvyGH7W36FR1eZwCEIQCEIQCEIQCEIQCMsswq ammZdBAW6tKElWwEm2cYolNGptqQ0qpE4+bMsTrLqzcZJSsE7eoQH69l2ES0s0w3 fA0gITc7gLCMkIRhghCEAhCEAj8e6RplkaT1VEmDyZM46Gr/ACcZtuG6P1dpJU+8 ujNTqQNlS0stxHWoA4RsO+26Px9GoaghCEVSEIQH/9f8/wAIQgEIQgEIQgEIQgP2 ZMNNLdfU4Fc11ZyUriBsChxjW1cpwc86/wCuMtQMwEzHJm2VrLq7h50oAF07wlR4 boisVV6PTftjnsYDK3UaK6sIbmkqUUBywcV4JJAPh8UqHkPCM6XaatzAl3Ev5IcU Tsv8vhnFaTowUOY0yUgDgKLcudtYpwk/idv843GKXOS86ZtuVp+swlKQZxyyATiN veeJJ8pGzKAndXKcHPOv+uNBmYafnnktNFAZWpu5Wo4skG9iTbb90fMVV6PTftjn sY1qWHBNzmt1WsL6yoNKUpIOFvK5SknzQFMkvyin/wB6OfxCOtrBU7MpSopJU2Ao bR15xySS/KKf/ejn8QjrLzmrXNLABUC2QCbXO20SEhBd7h+cal2rfs41nUyjEzqH arUkLwaw3WjClOeZVq7DYdpjLjrHzEj2y/6Y1ZqQnpx1t1+Vk1Lb8C026Ak8QAm1 +vbFV6LlNC8Br01fDi+EtWAy2nBYbR443O9w/ONS7Vv2cQrmjpdfcfcpsit1xISp apt4k22btvXEtjrHzEj2y/6YDVU0hien2w5MOr5OwouPLSo2xuWAskbLHzxX+6E4 GpZ5Z2Jlgf8AmMWMy82HJybmwwkuNNNpS0oq8FSzc3A+X90a+kuj5rMlNuB8oLbA TgDeLFmeuOWtrU0q7tScR2/niGqRMzw47TpU1BpDsoka9QPOUbZA2jo9M0Jq7bFP mpZtlJWltbxLm0WBO3+UYdA1t0zStFJmZNJQy0sl9xOEG4xbCOu22JfRiaXMaW6U S7j6mmCt1DKlL5qQXFAYd2zhGK0iPnl1m0pHTiu0ylUibpC9YmZmJfGgBJIzNtv+ UxzigSbukUyilpAcaKVLCFHDsz2jOLFXHU6NUqZoa0CruTLetTOnIt35uEDnbMN9 o8KIVugLZ0UYr7NQU2+4oo5KhFlJGIp2g33X2b4zebTbOOzURGMNdVFlJ6psSzDA s08G3gVkbwMs+ox1eepNN0c0dnafIS+oQ6C6Uhal3UbC91E/JEcq0U0qc0aFRQ7R 1zqpzCErUspLZGLPwTe+Lq2RctG6vMVemO012UdHKHSjlC1FWAWG63898ajV09Os 3tOGZi08J/RXSKnupRTWFOCcYZJcujKwI3+URtP6VU5WsZQt3Wm6RzMsWz0xDPtJ KO9IbEsqWNzOhNi7bdu23vtOyJeoGSakmiky6lpbNyLXJAEdtK8alIvWcxLExicF EpjDhbmak0HJ0FQxhRGVsshYR90tqFDo9JadrDbhky+ENhAUSF4VEbDfYDGpo7PI n5NDbjiWFKUrNS72tn1RA91h5P4LSsuyRMqROo8A3JGBedheNWnEZhIc6m2pKpcq cobZQhGJTuMnMG+HaTwMXCgy7sr3K33nrYUvZ2P+IkRWdHNFlPyVSqap8sGRbTMC XLfwiwUrBfELeDbYduyLRTJddV0WXNhamSV4eR2veyhnu8ezdHHTxnd2btnGGGRm 0ssoeBISpNhlG9QmC1ojXZaUARr2XE2JvclsjfG8KGunUiXnrKfU7ZBY1Vim9zff w4b4hxIKXQak4mbLakMrIQBmo4T1xdLqNLXrM6c5xmP4Zms1nlCSNYXTKGrR2edO qWrGppKQQcwoc7btETr07oPN02UZflH1utITjzcAxWAOxUUfR596laVylTflFzaG gu7LgICroUnaQdl77N0dcrej8jpfRac41NS1LWUpeUlLaVHnJHNOadkZjMxirc4j uju5SGE0Sq6tJCdaL7fkxF1OSm61p/N01rCqWwJWltRCdjaTt27bxYaXJp0Ak5iR YdFWE5zy6gavV2FrWGK/HaIqtXlJibqj1UDjsoHMIuAcrJA8LLhGpraKREQzExM5 laKBpSmQmpilz7yyiSTqEIS2CElBw2uMzs3xJMN1xvRWqjSB5Dr5HvJQEiyd/ggb 4hqPU+QsIBpXKlatKS5vXYeF4J2xsaNSqp6YD708QGlgalZvrMus/wAo59Tr16bR nW1PZaxunbCouJK31AbYhZ2aZllrTJ3Q+pRS8SL347euOk6V0Zhtb88iabQpSkDU JQARkBx6r7N8c+doIdeW5ysDGoqtg4+WPP03UV6rSjV0vf6T49v57PRq24is+yAi yUpwCnNJX4GeXlMYPwdHTB2f+sbTcqZWXSyFFYT8YC187x022pyaWJmf0enG1IsT sVsiRo3wuW/aEfxCNJlSgSktlRVkOqLRQ9HXDKCeW6pCmZlPvZa8IApN736+G6MT raWjMXvOInj957MWzMYWqOf92L8hh+1t+hUdAjn/AHYvyGH7W36FR9B5HAIQhAIQ hAIQhAIQhAIQhAfr3RSpis6J0qoYipT0sgrJN+eBZWe/nAxMRxLuH6WBK3tF5pZ5 5U/Jk8bXWjzc4eJUdtjMskIQiIQhCA5z3aqpyHQMyiVWXPTCGrDbhHPJ/wCUDyx+ cI653eauH63TKS24CJZlTzgSdilmwBz2gJvs2K645HGoaghCEVSEIQCEIQCEIQCE IQCEIQH/0OjVKaRKIfWtDq8Ty0gNNlZvdJ2AdUUeWkTL8kSl+oJaYUhSmW5BxLay nD8W+V8N9+ecXWoa9dRlpWVQ0X5ucdaCnVEJACFLzsCfiEeWMVVkKjJU55vGyJ5T S9UWuclKrc3wgL58coCsT6DNvrfZVOyrq0JSXG5BzHkQciTkMiLC23O+UYWZd5l1 xXLaqttbpc1ZlHkgA3uOaoHab+OJFsaRNFKytl9OIgocQlCrHBnzVEXHvm/f4hGd Ca09JPJddal5gut4FtIBCUXTjGZNzbF5xAQktJusIYQudqjrbSmSG1SbuHmEHIX3 2tnfbnc5xO0vEqZmXVNuNpdeWtAcQUkjC2L2Oe0GNYu6TF10BmQCEtoKFFKueo2x J8PIDPPq64kJNc2tQM62226MYAbNwU3Fj/vzQFEkvyin/wB6OfxCOtqAU/MAi4Km wfOI5JJflFP/AL0c/iEdadCiubCFYVkt4SNxiQkNHXK4N9mn1RAVLS4UydVLuSRW lLoQXEpTbDgxEi4zIJSLdd43+9Cvz3N+dP8ARDvQr89zfnT/AERVa69KG23G21Sb wccc1aUatq5ViKflcQR/7i8xrlcG+zT6oj+9Cvz3N+dP9EO9Cvz3N+dP9EBgm5h1 yfnWVKGrRLMKSkJAAJW4Ccv1R5o2Z2tS9GlZt5x5pDqWkqQly9jmeEaa5VmVenEi cemZkstFZc3IxLw2skb8cVruhm0q+R0YfxGPN1fTU6nS9O/bif45b07TW2YeJary 9b0gXN1R5tinup/HtXAxAAAZ33gxan9H9HpaWlZh6oPoZmrahZWmzlxcW5vAxWNE KA3WtA5BtLbOvUXCVuEjY4rhG1pDQq20KIw9OsqlmJhCW2wtVkpFhYc3gI6adJ06 RWnaOzUzEzyjNOCnRmpty0ocbapcOkvZm5UobrZZCIfRjSCVqdcTK1aYZlpQoUou IuDcbBnf0RP915LSNI2MSLo5Ci4G/nrigU2nIm5sOS6EICgbYso5zqWi8w3tjES6 RQacXXp06QpXIy+JPIlpsnXJuq5zvfLBw2xZpFzvYtKKZZ+kYscxMrzKFbCLi24J 3b4intFdIaginKXUJZTDIBKFLV4Jw5Dm8BEhpDWqbQ2XKA1LOtuTbWsTq0jBmSMy Tf4vCHUaGn1GlOlqxxP9+jNZmJzVhqdSRVZhyVmloRIIXjaeRkVEZDM33E7t0fJe h0KYZdWieeUW03Nlpy2/o9UY6RSzUGG0ENkBGKyieP8ArGqqoSdQU6zRmVyvJSUz WMABzcLWJvsVtttjXTdPpdNpxpafEJa02nMvUzQ2HNGH6jTFOzE0lQDaLgpPOAOV gdhO+IXSSWmKHojI1MNETjzyW3G3M0pulRyAz+KN8WqQqctSdHFzzjbhkWl89pAB USSBkCbbSN8V7ujTvfPQuRm5YqRLuzaFNoXkQMC9trx0vOM4n2IUST0nqMxrUqYl 9YLBpISrnE3y2+KOg6MPts6PirTKg3XG3FBEqfAKScN7bfBJO3dFLo8rKUWblpmq MB9tbiHEhvMgJNzttxEdCqz9KndBJusUqUVLLSpKUKWkBQOsSDsJGwmMRWNSJpqc 59vks8cwmlaQTD1MZVJIZenyQXWQCcKc7m1+Nt++Kc2mn94KnNuzJTNy7K1sN3yW oJJAItxA3iPmjk0+Al4OKDimjdW85iJmpUiTplCqL0zLtrS3LuOEIzNgkk7bRx6P oNHo62jSjvP/AJH7F9Sb93KZPSavVGsNU6SkJd590HC2lCsRskk/G4Ax0TRekzVQ eebrrDkngbBGDm86+YzvFR0P0l0ba0wkXmabMIfTrMKwhNx72ofK4R15ppVRJflS EBz3zn5Gxz3Xj1RE95lnLUpctS1Mu96ZtU0xf31eIHCfMN0RtXU7MvOUurI5No4k hSJ1OSyu17XNx4RI8HdE4qSlaBLOiUZSy0pJW4lr41h1xS61WDUS5LLU4qTuClpY FgQPXeJf8PxS1Ss2tisLJL1FUnKssUHBOobQEArBUcAFgcrbYo9CnqwuYTUGJNC2 ZZYLi8Jwp8ecb/fVMrKsopusl3EpCVqAAuAPHGlIzL0m05Ky7im2Hj74hOxXjjlq TF8U9vd6K9PaKzaUhMM1yv1ZyZNPvLugEONJIBsAN54iIx9hyXeW04gpUhRSQdxE bqKzUZP3qXm3G207EpOy+caiphT7q1vqLi1kqJO8nfGNtKxGnXjHEf8ATvoxqUjd 3iWCMwdwMDDYq4GMa0Fs2NvJBCCtVhbywrNqziO7rqVpqUzM8d2RicfS6lxKEnAo K2GL/TdKET9OWX3GEzKnQ2htIIuDhHHbmY564QMmubuV1xuUdJE5LD/zCP4hHm6j o9PqrVjU715z/wAfv7vHNbUjMRw6JHP+7F+Qw/a2/QqOgRz/ALsX5DD9rb9Co+o8 LgEIQgEIQgEIQgEIQgEIQgNmnz8zSqjLz8m4W5mXcDjaxuIN/KOqP1pozpFJ6T0O WqMo62VONpLrSVAlpe9JG7MHxx+QozSs3MyUwmYlJh2XeQbpcaWUKHiIziTCTD9n wj8z0juwaXUsJQ7NtVBoCwTNt3I/zJsonxkxfKR3eKW+AirUqZlV5DHLqDqT1kHC RvyziYTDrkc17pXdNa0abcpNKUl6rrTz13umWB3niojYN207gYjTbuzSIpfJNFnl uzT6efNKbUgMDeAFAEq69g644a66486t11anHFqKlrWblROZJO8xYgiHuZmX5yZd mZl1bz7qitxxZupRO0kxihCK0QhCAQhCAQhCAQhCAQhCAQhCA/ZcwstTeuQEhxuY cKFFIJSSLXF9hsSPETGGYmn5pQU+5jI2GwjJO/jHPp3P5RXFjSBkOlpcs/d1RQHU 2woKlWFwRsSEbczc55QGzWWZOZp/Jp50NsuuI32JKSF2H1YgXJICVmkM6SPB11YL ZK1hLSdmEAHZs2W2brmJqXTVHKpSUPavXiorw8nugrZDDtwLk4VFOIA3FiRmNsdM kEPt06WRNKxTCWkB1V73XYXPngOdUZAcbcYZm1zq0qU4VKzISTkD/vyRtPJLM4y2 5zVrbWpKTtIBTc/ePPFvr6X101wS7zbS7HnuNFwAb+aFJ9Mc9DUw3pBJ66ZbeBlH 8ITKlm3PazN1qv8AdAU2S/KKf/ejn8Qjra1BDsytV7JU2TYXPmEckkvyin/3o5/E I64fhEx+u16REhIf/9GzVFKKklpDslVEoSu68Mm4CtNs0XtsJsT4vKIvvXOBwr5T WD76HgkyDoAVY4rYbWCionLjti069n51v6wjGp3mqwvNi45pK0k789vi64CDcklm XabaRVmVNspQFIkXBz0jCHNm3DiSc9hHARjakJlooXrawp3maxapR+6wlSjbwsgQ q3kixqdBWoB5lIuqxxpOV8j4Ufde0NrzZ/zD1wESpS3p6feMvMNIMuwga5pTZJC3 CbA+MRA6ffiXcr/2cfxGJ95aV1WoFCgocll8wb/8R2IDT42ZdP8A5cfxGJPaVr3S Og7gZ0KkHFKDaPfBiJsPxit8c0r8/NfhHOK5U8ptM44UDWG1sZtaOn6H06T0i7nN OpUw66klTiyGsjk6s7SCI55XKRK0yqzTU4460zLzC0yyrhRXhUbYrA7gOEcbbpis ezrERyzPY9Ikl2YeUw4Bqghw4yQM7524mNZ5hbcsKRLpUt5s31rY5xB52wZ7+Mak pNz9drspyNhp2aJDbaBzQo5neevjHRdHNHpzR+tCvV1lUo4UKbcCVpWgEiwsEknY BE27vw9/JnHdMVHR2ZnpajLTU3ZcMIBWAg87JO3nDgY3qnMyaplNGSliZVNIFp0E KLVycrZ8L7RtjXodZqtfNSYmZaXSwmyG1NXBKVYhc3Uc7ARXpqkS+idRaalluqRh DxLxCjckjcBllHavfMQk9sLGwyqWVyFCidSLa0C2LyeXjGlSdLJOoIqLBprEqtgY MWsF3TzhfwRw69sSlKmVzrKHGglS1IxEbBa/XHKlsIlqytU8VNOKmCWQMwo4t9r9 XCJqTaJjBWIxOV4p6UStN78TC0lLSiDIuZBVzhvn477N0YWJRGkdQd1i0ykqQXUB QxIByFhsG8xnrGjs7WtHph5lhS6yopS3LpWlKFAKF8yfk3Phbolafo4lOi0hKVjW y8w2kaxDaknCrPK4uN8bzO7GE9nKqJVHJFvSOWNPVPJWC2l2+TIGMYthttvtGyLd QApvucPVBSStCHiCwdh56Rt8t9kRdCmhTp2pUukETEtUnBLzq3gcTaCVJujYL2Ur cdg8t2m6e1R+51NyMupamgtKruEFVy4ngBHHTrO7LVp4Reic0hVTceMunCtg2bOx POT1RId0KvOUujzck3S1TKZqSeCnUqsG7pIzGE+PaIjdDmdfPrSL5ME5frJiY02m 645IPS9Ck2JqRdlXETbrpwqbuCDhupO652GOt844YhwXReUFZ0nlJFTgkQ7j9/Iv gshR6ttrbd8dVelV0qWZabqKnggBvEk2vYbdpihy9Np8tMJNQfeZnBf3tOYtbLYD 6Ys7ks8zJS6yizCkjVKuLqFsvujlFtvs7aen6k4mXqYnJhqXcu669zCbYzw2RBmr O3zk13/WPqiWQ6psEADPjHogOi4/GHdujnPxRw9u29J74jz/AHshDWiDYy9j+v8A 6Rnk6trpxpvUYcSrXx3/AJR7eozRcU4tTgK1E5EeqPsrS2GZptxK3CUm4uR6oxWJ i0ZZt6s1mYnMfs81CqcmnnGtTiw2zxW3A8I1hWs8pfP9f/SPtVkZl6pOuNt3SbWO IcBGFqREr77PYmha7ViDiVwNrwtEzeXGNXUrWPCQl6ot1aWXJVSAs2LileD90Juq GVWplMuVpTazoVYHfwjQfrczMMLZWhoJWLEgG/pj5LTiHJdElNKDcsm5xpBxXvfr 48I3ujtEsepfuy9+/wDy/wDz/wCkTuj05yl6Xd1eG00hNr3+Mn1xVJqUdlSkrRZC 7lBuDcf7IixaKbGP21v+JETSzFsSamre1cTLqsc/7sX5DD9rb9Co6BHP+7F+Qw/a 2/QqPW8jgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQ gEIQgP2TO/jHPp3P5RozD7crLuTDxIbbSVKISVEAbchmY3p38Y59O5/KNNxtDrS2 3EhSFpKVA7wdsBpqqN5qnCTmEIW9NFjHqgtSFFtZCQkkYVEgJzItiN7RZ5alVabl WZlrSAFt5CXE3kgDYi4+NFfl6fKJqMo8tCUMtTK5h0C4KlFtaLgjMKuoG+62WcW5 mtyDDLbLSShttISlIBsABYCAiarTzJU15yuVoOyltnwYYri11BX3RUpR6kLr8umm OtOqMq8XMM2XinntW2k22/dF4q1fQZFZlWXXXrWSlBCTnvubRUUvz05WZZ2ZYfbb al3U3edSu5Ups5WP6JgKTJflFP8A70c/iEdbWhLjsyhaQpKlNgg7CI5JJflFP/vR z+IR1WcW4gzOqWEKKkAKIvbK/wDKJCQrdVVIUxllzvVTl6xwospltPxFKy5puThs BvvES9pHRG0vlNDZWWxZI5I0MSs8jcZDIdeezKJnvXN/nib+qj1Q71zf54m/qo9U VWkajSVysy+zSZG0u9ql65hpA25kEA3GW4XO68ZJCdpFQnTLNUqTSU6wKUuVbF1J KRlzbkZk3y2bI2e9c3+eJv6qPVDvXN/nib+qj1QGJxDbM/PssssstiWYVhaaSgXK 3ASbAX2CPtUpbc1Ncsm223ZFhsa9o3usXOQGz7xHtNMXLpmXlzjj63G0pUpxIvhQ VEAWt8oxITU8KZS6hOqYD6WWkqLZNgrM5XsY8X2hr6mjo79KMzmOP35dNKsWtiUf JUWdWwie0feakaeu4ZZKilSM7KyAIzUCdu+OC6WT1VXpJUpaanVOlqdeRtyuFkHd HXatUnHdGU6SsLU0HlhIkG1+BYlN7j9W/g7459MaVMa4ldJbccKziJWCb7yebHor qbqV3RiZiOO+FmsxMv/S5tQeXSDzc4xMat1pzElaTmDbdlHc5CvS3ucSdSrqHp1S 1qDigAVKOsUBtI2ACOXMV9hxsnkLaDe2HGM/ui+Uigrq2i8tUDMqaZdKrMYMSU2W RtuBuvs3xw0+bTizvb8PZOzurSzLTFCTyJspxvjYVjIjZfZzvPGg6lNYcFZeGskZ Yat1tzw1WzyGz4w3x4plGROPES9XS8GFJxob52HPYbKy2GLg8ZeVYWClpKbXKMgD Hk+0uq6jQrWdCm7MxmePPb9/Psada2md0qtLTHfN0ytBxSa0DHdzmjBstlfeRHJk TT7+kAanHVOrRNYUk7Acef8AKOvHR5NQn3ZiXqIYLnOwNovhGWWShHOqnMzFJqLT MzRnWy66UtuuIKMdiBiF057QfLHstm1azbifCV98OgaVTs7QdHJuYamFNvtYClbZ zF1pG/qMbFKnpmt6KU9zXKM0tIW4458baN3kiHRRhMSxXUqjyZm9lmZHNHC+Igbb RqT0hNyEulynl6clyrC2uXScChY5gi4tlHbHxZyz7POltNZolWoKKc2iWenXyHFN /HUFIsT5VHzxKuNz8vLqNSmA/Ij8Yykk4s8siBvsdu6IuvyiaTNURM7OhQnV21j3 N5Pmi5zO7F1bIlEyiqe130p7xrjTWQalxiS4TzSLgq2XvsOyOdrbK2msZmPb9u37 rjOIlmpwaoS+/K0f2KZTq2m2s1pJN8wbD4p3xq1Wbnp/RyqTlNmVMMS0q6p1KzYq sgnK193ii2yjzk5SZZ92mKbWsAmWUm5b29X8t8VGr0WTo9InXl15guIl3HESiiEG YISThAxZ32bDtjw/ZvVa/UUtOvTbieP78vPu3qUrWY2y5zoDq9INPKdLz6eUId1g Ul3YbNLI9EdgkKLLOVCalplhpyWZUUst52QAbADyRyzROrGtaVydLRTTILex2mEm 5RZClbLDba23fEzO1eWkKjNSqquyHGXVtqJmAkkpJBuL5bI90bKRz7s5nPDU0Wo9 QrLTpD7RKXAkaxR3+IRhqswKJXX6U/dUwyE4lN5pN0hWRNjsI3RmarVOZ/FVOVbv nzX0j+ceHKrSnXS65PyS3DtWp5JJ8t444pjief0l3jXvEY9ntp9LiApd1JUAQDG3 IU96bnmWG1IC1qsCom3ojS77UoCwn5Ptk+uJ/RrS2iyMwGHpuQIdWDrlzKBq8uv1 xw6rVtpaNr6cbrR2/vybjVzOI4ie7QqVPcptRdYmChZRa+AkjMA77cYjH225iyXE hSQeaDui1aTaY0OaU9JMzVPXZSSJlE0hWLIHd5tu6Kx33pf5wk+2T64x0etfW0It rRtmfr8/lnx7L6tazjGWtyGV+YTDkMr8wmNnvvS/zhJ9sn1w770v84SfbJ9cejbT z9JX/wCiv5f9mozKqcS4mcKXdzP6H+8vNFg0X0anESKZsusatqcQVDEb5FByyiMa rNKbdQsz0moJUDbXpz++L9TNMqHUJJSUTdOZfW6GkSyZpBUsmwBAyJ28N0ePrep1 tHZ6Nc5mImfHP959nHFLfJJRz/uxfkMP2tv0KjoEc/7sX5DD9rb9Co+w8bgEIQgE IQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgEIQgP2HOtoXOv laEq98VtF98a+oZ+ab+qI2pv4a/9Ir0xhgMeoZ+ab+qIahn5pv6ojJCAx6hn5pv6 oj6lptCsSW0pNrXAtHuEBy6XqEqxpRPMuO4XDVF5YSdqh1R12c8N/wDXR/CY5XJf lFP/AL0c/iEdUnPDf/XR/CYkJDThCEVSEIQGN/4O7+ofRGKpsGdoVUkWRjmn2Upa Re2I3O85Dyxlf+Du/qH0Rsy6QBMOW56UJwnhmYYzwteJc9rUm/Ru56zKz6NS807z 03CrXWojMXGwiOQPzDapxzCq5LhtkeMdz7pDLi9DVzC1AhTyPHttHD6JLomtIUtu pC0coSCDwxxwtWIt+zrmcLdQdDq/WaY7OSMhrktulvFrm05gA2sVDjHSNE5PTCRk pelVGSbap7QWRZbZUCVFW0KO8mJ5uo0rR+rS+jknKOMOTtnU6pI1dzdNySb35nDh G5pDVE0CkqmpjWKwrSk6oAnPx2i0061+LPYm0zxhyGjaSVDR+vTLLam0JmpoIXiR iuAojLh4UdcqeB9zDe6Six85igaZUOVkp2gzLLDSDNuKcum9zmg5/Wi/OILEwgP2 WLXNuEXRiYmayW9pfaS3LtvFLZOsCCCDfZcRy6eXXdOa0nVMomGqTMHEUFLeBKlb 7kX/ABe7hHSQ+hM24pgFBPoirUrSvRykTc4zL06ZaemXAlxSEJspQJFzzuJMa1MZ jM4SufZl0lU7VZB+j08B2eeCS214N7KCjmbDYCdsbtOmXqZo9JU6ds1MMJCXEWxY TnvFwY0NJg5TqRM12UVqXWAgJWnwxdQSbbtioiaXWxpTKtSUuXU1JCNc8++AErAy OYJN7qG7dFzEX+ac4f/Tl+6BQahpQmjmlS/KRLBzW89KMOLBbwiL+CdnCNqhUzSO g6GrlJSUSmeS4VIbWtCtqhfO9tl98afdAqs9QJWjop8y5LuPocDhb+MQEWv5z541 tHO6dKSFJTJ1kT81UMala5CEFOHcLlQP3Rxmaxeczh2iJmOF2oukCJltFPdeT38Z bxTbAQbIsbHPwTtTsJ2xD6S6Myk9SJyenG3OUSss4pnCuwuEki48YiG0LqLNV7od VnWErS09LrUkLABAxo22Jiw1uZeVQKiC4ogyroI/ymNVnfSckxts5hoCge6JTVHb Z3/pLipaVy2LTGuHCc6g+dv+IqNtmfmqZXmpuVfW0tsHCpG0XSR/ON5ySM86ubdw rdfJdWpW1RVmSfPGen5jCasc5lT+Sfonzw5J+ifPFu70I+Q398O9CPkN/fHo2OeI VHkn6J88OSfonzxbu9CPkN/fDvQj5Df3w2GIVHkn6J88OSfonzxbu9CPkN/fDvQj 5Df3w2GIVHkn6J88OSfonzxbu9CPkN/fDvQj5Df3w2GIVHkn6J88SmjUth0qo6sJ ynWTt/TETXehHyG/vjeotLS3XqcvA3zZps5X+UIbTEOyRQe6+hbmhKUISpSjNt2C RcnJUX6K7ph8Bkf2v/tuRlH5p5FN9Fe7Mw5FN9Fe7Mx26ETKZcR5FN9Fe7Mw5FN9 Fe7Mx26EMmXEeRTfRXuzMORTfRXuzMduhDJlxHkU30V7szDkU30V7szHboQyZcR5 FN9Fe7Mw5FN9Fe7Mx26EMmXEeRTfRXuzMORTfRXuzMduhDJlxHkU30V7szDkU30V 7szHcEIU4sIQkqUTYBIuTGZ+SmJZOJxAKcgVIUFAG17EjZGJ1KxMVmeZOe7hPIpv or3ZmHIpvor3ZmO3QjeTLiPIpvor3ZmHIpvor3ZmO3Qhky4jyKb6K92ZhyKb6K92 Zjt0IZMuI8im+ivdmYcim+ivdmY7dCGTLiPIpvor3ZmHIpvor3ZmO3Qhky4jyKb6 K92ZhyKb6K92Zjt0IZMuI8im+ivdmYcim+ivdmY7dCGTLiPIpvor3ZmBkpoAkyzw A36sx26ME98AmfolegwyZdXm/hr/ANIr0xhjNN/DX/pFemMMVSEIQCEIQHN5L8op /wDejn8Qjqk54b/66P4THK5L8op/96OfxCOn1BCVzawtIUMsiL7okJDBCMeoZ+ab +qIahn5pv6oiqyQjHqGfmm/qiGoZ+ab+qIA/8Hd/UPojTn6e5VC7IlDiWHm0pceS m+DM+SNzUM/NN/VESNOJvMI+KpKb/fDGeFjupGluirknoAmnU5MxPLbeSQG2ypRB USTZPC8cs0doM4uvqDctMreYeSp5tLRJbsrPELZWPGO36daRq0c0aW/T3UpnUOoT ZaCoWP3RTu5VNLqOkFbnHCC/Mt61ywsMSlkm3lMcb1jdFYdYnjMpzTWs1SYlH6TK 0px9iZYsp5tClYSScshbcPPGroBos5TBLVVxMwh8ocSWXG8NucR49giU0nrcrQaZ MtLfDdVLWsl2ygqBF7DMC20HaYhWe6EpGhMutuaa794zrG9SrCE41dVvBtvhaaRf NpWMzGIQmn2jEvQn5WYRNLWqaU6spWALEFJsPrRaO5s8V6Ez67C4m15f5ERzbSPS Ku6Sql+WhpQl8eDAkJ8K19/6Ii+aAuPSvc3qztgHEzSyL5/EbjOntnUzUtE45eK4 /wAqdWy0AtxLmIpRmQLcPLHQpGX5NTQQSSpkGxHVHIaVVm16RzaphwBRbN7JO26Y 6LVHtJg3IGksNuMKHv5UUZJ5ttpG68emZxGXOIygtMVTDuhs8pUutKfe88Jt+MTE nRaoz+ANIlZR1mZnG0DWS7awpxA51yUjMZkeePmnLha7m1SWDYgt/wDVRFL0LTOU LBXaogMU2aYLbL1wrEoqBAwpuoZJVtG6OVrTF/k1ERMJjTCbl6/U9H5FD7RxPFlz VLCi3iU2MxuO3zRFPyruh+nbDFNbXUH22ytDWElS8SFA5JzyFz5Imq9ok5LTtLqO jsut15ThfUVuC2K6VJyURvvGGpTTNNC6xU16nTNkAMtAFTeA83O10+AVb442j4pm 3E+XSJ4iIV+UlJOv6ZVF2tzqKS4tKnFodUEYV3SMPOtuufJHRJ+ZmU2nWZVTr8sk uNtJSTrFDMJyzzItFK0qo1NXolJaTu6zvpPvp5QoKOA3Ssmw3eCI6EFqZqEq0cit aQBxzjroxjLF5cW0rqs/V9MxO1OnqkHy0lJaWlSbAJNjzs84hZ7R+ZYAm5liZZYm FFTTjjRSlYOfNJyOXCOqabaKvvaYmtVOXUigoaSl+YS4m6TYgc0HF4RSMhvjS7qJ ZZ0N0cTJqJlwEhonaUasW29VoxNZzM5WJ4iHLmKPypxLcupx5alBKUtpxEk7AAN8 bKtGJxM0qVVLTYmUi5ZLJxjK+y19hi3dzNNA1inKm+tE+iabMolIVZSt17AjbbbF 1eolUf05mauJa8i4gBLuNOZCEp2XvtB3QiLT7rw//9TmrejM264ttuXmlrRkpKWS Snxi2UZHdEqgw0p12Snm20i6lLl1ADxm0dUmJR+QnH3ZFF3nHFa3EQRtvv64tiJa n1mTelJhSlId5hCbg2jnOnPtLrujw/OIprRc1YeJWPi5X80E0tCnA2l1RWThCQMy eFoltMGZXR3uj1GSZJRKspbCcV1HnNIV6SYw6Pqana8yom6dehQIy+MI52iaxnLU TEzjD0dC6ulYQqmVELOxJlV3P3R9/AmsY8HeupYuHJV39EfoGtzbErWWCldiGwRc E7zHxM2o/wBsBFlZYreTZ5I6+n82d0eH57TohU1qKUyE+og2IEuo2+6JOh6I1ST0 jpjz1On20tzbS1FcspIACwbm42R16bfbpc1LkqwGZXvF75jzbYtE0wwthbq761I5 sPT+ZujwiorumHwGR/a/+25Fiiu6YfAZH9r/AO25G3JV4QhGGCEIQCEIQCEIQCEI QCMiGitOMkJbBsVH0DiYzS7LQl1zL5OALCEpAvc2J4jIW4749tKYeLzuucUpkWAL QGe3IX3A3tuuDHC+tEZiGoq8qdEs3haGBat/xgOs8erd48xgamHGZt5xBulWAYVb CA2kEEeMGPZTLE3LzxJ/wh/VHwIlFhDrUw6pCmgogNDbjWMXhbCALeLrjM7ImM+/ Haf77Ncsq22X0lxslB35ZA9fDx7OoRrLQptWFQsfTGZHJ0KCkvOgj/CH9UZm1yzs pr0LdMuXFILZbBAItmOdcA/y64u/ZOOZj9JTGWjCPa9UqzjBWWlFQTjAvkSk3t1g +S0eI71nMZhmSEIRUIQhAIQhAIQhAIQhAIwT3wCZ+iV6DGeME98AmfolegwHV5v4 a/8ASK9MYYzTfw1/6RXpjDG2yEIQCEIQHN5L8op/96OfxCOoT3wxzyegRy+S/KKf /ejn8QjqE98Mc8noESEhrwhCKpCEIBByoIpVPn59banEsNpUUpNiczCNBVGk5ivS 9Ym50SwkUpPOICSLq2k7Ik5xw1Xvyr2mdUltItARONSuqU88k3WASMKiNvkj5obV 6dNyrcjTqciRm5WXQiYmG0pSXyAASSnM5i+cWfSOn0LSGQW2/XZZiWWtKg+l5BTc brk2j3MNSkrSaVKsTbbzMulDbbgWDjSlIAOXEC8Zis7s5bmeHPNMafM1jTmnU7lR CpiXSgKWSQOcuNvRTRtqR0+XRJ9MvOBllRONsKQSUhQyPjiS7osjS5yXfqL9UZan mZUJalC4nE4AokEAm52nZwjnkxpdMu6Fs6OCUb1bS8YdBOI88q2eWON4iLctV7Mc 7OsydbduxdpuZVdAAsQFbLR1ej1WQr2js3MU6npkJVLhbXLpSkBSgEkqITlsIHkj ijU045NyryW7mWcSuwz2EHPzR2drSh7SahzU45LttPoJaS02onFYA34/GPmhoYiV vnClJDEtpLOqLCCLEWCRxEdJrukCaMzSGi24rlacIwKta2Hb9aOYzCXqjPvSymVp Ug4iEpJI3bPLHW6c2iVkEIll68raSHAnMoy328Z80eqYmY4coROnmFjuc1IuJC0g tXHH31Ecz0dTO6TBNKROuty7DRdQ04tSm02IGSdg8L0xb9OND2lUScrjsw62tsNp 1ZSAnw0p2+WJOlSVM0o0EpNDFUZD0skPKQy4lTgtiTmm9wOf6I8967r4mP8ALpE4 jhbZuZaodEQ7MMh8syxULAXGBN8rxyKfmRp1pwyzKgypmG8ILhvbCgq3eKJ1NJYp a106iTBqrc+dROLZs4ZUeCCcN7eErb8nxxo0GUTo/wB1in04KKgELXdzI5tL3RLz NsRMcEccwqmlDdRkyuivVF51qUeASnWKwAgHMJJy2x2qpNFqpSbmLwFBWXUYoXdT o7dJYVpA06p12cnA2pojmpBQo3B/y/fFq0qlXFaWUJ3AvC24gk4chzxtjejWazMS zeYnlUtJ3qnpD3S2qCzU5lmUmGQSwp1RaulCl3KAbHNPnigabvVBhYpj8++83JPr ZQkuqKU4ebzQTkMo7s7T6QvTZiqKq7KZ5CClMprUXUMChe177CT5Io+n1ZpukTxp sxUJSXEjMuAFLybkjm5gnLZGLxid0tRPGIfe5popioNWQ6phybUuzEwpF1MqwmxB 2ixscos0ho1XaW+H5qvOzLABGqLiyLnfYm0UbRaq0vRaWmGGKnKPh5YWSt9ItYW3 GC6rS16SvVvvnKaxxISW9emwskJ236os3pmJwmJ7JCoNz0rUppxc86tC3l4U41c3 MxbZOqN0KjTs9MMqf1PPsLX8hMUpiv0xiYdeFQkyXCSQX05Z34xuP6X09+izlMM7 IhE0nCpYmE3T4s43OtXHCbZc/wBIKgxpT3QJ2oIY1bb6UENu2URhbSn+UfaM2JKv MZCxmEJASLW5wjeZp1FZnTMity5JFrF1HrixaMVumaMTs3Ms1GTfMynCQt9Itnfc Y5WvW1YhaxMTl03SttDzTi0IShwM2Su2YzO+IfR5t94NSzj6lgJUecSRtiqVPSin VOfbm1z0khSEBASJhJBsSePXGWV0vp8qoFM7IqsCM5hPrjt61U2SvczS++TawVIx sg4FLTcpJ3jhsjnfK63Se6DSaVN1mcmW30hxSTMLKCCVixBOfgxNu90iTd1d5inj Bs/tIz+/qiGn6rTtJtM6TUlVCVQ80tppDTbyVYrOEjfe5KrRi2pWcTCxWX//1b/F d0w+AyP7X/23IsUV3TD4DI/tf/bcgKvCEIwwQhCAQhCAQhCAQAJNgLkwjK0pLKVz KzZLIxXPyt3r8kS04jKw9zjim5JbLQClJcQ2ngVWWST1bfIBvjy2BJsyzaedhBWs K2kq238YsfKYxSTa3mnypJ1iwlSU702Ngn/mJPX1CPk89/aShmylE4W77MIsLnxC 3jjjWsbpr/e0NTPGXiaRimVS6CS2kgqVxScwPGRa/UeuMiV6uccwgWbbQ0E7ikpx 5+Vw+QDxx6Q2BIoSm5LJIJO0gm9/OTfxiMTigmamlKICRqySdg95RGo+KYifn/wj 5OJzQ2yo4Xr2VfNKRbF5cwPKDG5KqSiVcbw+9psSkbk7CBwNyk+TqjTk1EY3XUmz 1roO1I+L5RcnxkjZG4y2UTSW73S4ChKtxByB8/ohf8OJI7sEs0pMo6yrMpdW62Rv SVG9vJY9Vj1x5j1TXLLdZtiLTpKBvUFAKUjy4jb/AFj663qnSm9xtB4g5g+aLScW msk9svEIQjoyQhCAQhCAQhCAQhCARgnvgEz9Er0GM8YJ74BM/RK9BgOrzfw1/wCk V6Ywxmm/hr/0ivTGGNtkIQgEIQgObyX5RT/70c/iEdQnvhjnk9Ajl8l+UU/+9HP4 hHUJ74Y55PQIkJDXhCEVSEIQCKtW555zSun0JRTyGoICXxbnEXVsO6LTEPO6NvVK uS9YamENiRQLpIOI5q2HdGbZxw1XuznQiTWOQLQvvanNIDnOvt2+MmPVSp7EnLyc syFBtkhtFzc2AsPRGrOS1Uqjy5GUqj8s7koOBxQyA2ZGJKXl3GmpeXmnOUOshKFu L52JQyJz4xYiIniGs8OV901VtJJdPGTT/GuKWhp9bvvWHqvF/wC7ClCdIWWm0JQt UimygLW56456zNGXlUsnEXU7XAcznePLfO6cOkdnuRmWpOdQmaJDbjiQrCL5Xz9M drpLVCTTXX6Nr+ToWcWtvfHYX+60cTp8ww1OIXMsJfSHEmygDvz2x26Qr1MnqDNI kqWiVCllNkpSBewzyEdNLG75pbOEC09JGvzbkvj5QoHHi2WuP9Iv8qWaLKLeeuNa 2Fi2ewX/AJxyUrUivTZQopOeYNuEdKfl3mZBhqYfLxmWsLZUScGQ4+MeaPS5qBpr pzUavKzNMlFtmmPJRiCm7LuFBW3xgRryVbpmjGj0nP0VTqa84A1NF1OJvAbk2HG6 UffGKc0Qmvw0Z0bE42HXkYw7Y4RZJVs/yxYNOqJJ6N9z+mNrlZZyaRMoacfbaAUv mOHM2vuEeON85tLr8PZIaG0bSCiSdXnXRLh6fbS6wQoEFVlnMbs1CI2mNT0z3WJC Yq+DlmrUDqvBtql2jP3KKnOzRqbc/NzE2j3hLKXnSsNA47gAnLds4R6qThY7tskE XSgMHmpyH4pcdMcVmPLMT3bPdmeZa0PlEqvYT6B/+NyFRndKhXKazVTK3ccSE6sD wSoAx57p6Uz+jcu2pINpxKucL/EX643ZelzlGnWEVacNSeW4lTTjhKi2L7AVXIz4 RvP/AOif6UFUpmWpXdJl52olQbba55bFzmhQGXjIjk2kK25vSWqzLFyy9OPON3yO ErJH3R0zSelP6Rd0lunMTGoU8yLKVcgYUKVu8Uc5qsgqn1ieknFpWuXmHGlLA8Ip URf7ozTO6c9kvtxCH1RhqjG5gHVDAOqOvDnw09UYaoxuYB1QwDqhwcNPVGGqMbmA dUMA6ocHDT1RhqjG5gHVDAOqHBw09UYldGGiNLKMf/PMf9RMa2AdUSmjSLaU0jZ8 NZ/jEODh+iorumHwGR/a/wDtuRYorumHwGR/a/8AtuQFXhCEYYIQhAIQhAf/1tSE IRhgj48CvVskWbRZxX6SjmnyAWPjUeEfYyuzcy0+gGYdDbyQpvnkZ54h5wT4j1Rz vndGGoZZRwMNTb6gbNM4hbbixJCbf5ikRoNNlJUtdi4vbbYBuA8V4k2nX3ZR8GYe S4fxa8ZysCo5b9gHljTaqE0sFK33UuJ8JOM+cdX+9t450m2+3H1+X6LOMQ9sLSly yzZtYwr8XHybfJGnMoUuqzMsoWDami74w0iyfOPu64kWZiYWs4pl4ISMSiFnZ/vL yxqzM9NoqM2+H3Q2SgrQlZsPekG4HVw/ntZv6vEe3n9PkcbSMra0lOqcNkE3B+Se Pi2Xj6JyYIBEy6Qd+MxkbmJg89cy8GwcyFm56h1x0tNscx9f8JGGs6lTdTnieaov JXa+y7aD/PbG3M2flW5hNrg6tY4HaD5ed6N0Y5ioTfLdUqYdADKFpssjaMwPFl5+ uM63ne9a0uOLWpa0EhaicI51vEcr+K0cIm8VpMxzw1xmWhCEI9bmQhCAQhCAQhCA QhCARgnvgEz9Er0GM8YJ74BM/RK9BgOrzfw1/wCkV6Ywxmm/hr/0ivTGGNtkIQgE IQgObyX5RT/70c/iEdMnnkcsc8M2IGSCd3ijmcl+UU/+9HP4hHUCAagQRcF3MHxx ISGnrk8HOzV6oa5PBzs1eqNjXK4N9mn1RBN6TOWzRLvpU4oJW2hKUhOdirbkLXUf ihScs4qpXXJ4Odmr1Q1yeDnZq9URrOkj77byk08tlMqp9GNA5xBIwkWyNxEhT6k7 OywcXLpZXldJQDtSFCxsNyhu23gPWuTwc7NXqisVeRnpnS+mTrEo6uUZSA67hICM zx8cT6H3HK7NNqVzEyzKkpAsASp25sPEPNERW61OyOkFNkWn8EnMA65vAk4s+JFx 5IzfGOWqZzwmGqlJU+dL83MIaaAtiVsuRGhVmUPy8xNSy9a28lbiVDYUkEgxjqst T0yBn6o0V0xSgAEk4sWwbCDtBgqelG6Y00ziTLvtBuWTbYCLJB37LbYueZhr5udt aUO07RaeoLcu24JsleMk4hcJGQ/yxRJl9cs4pRR74LApMW3SahTuj86hE4lCXdSH BgViyuR/IxTJ1S3Zhbrhug29EeSme1nW88Zhv01KE1KUcKrJ1yFLPyRcR3mu6R0w aOzzMjONTJU2bWJ25ZRzPudJ0TmHZprSGVdfWpTKZbCpYsTixXwqH6O2Lvp3S6Do 5LPsSkqplZlw6my1qzKiL5k8I76WWLYw5zTZpCq5MuOEIJQbjhmI7VyIzEgw25iQ lxoJB6iBHD6HIuVSpu8mAKy2VkqNsrgR+h0SzipKRSALttpCs+oeqOznDlVNorWj ndmp0oh5TjSWlq1ixbayvhEx3XihOjMu6yvWLVPIungMC4xVk/8A91Sg/wAD/tLj D3TZlnvAw2q90zab5foLjjEfDaHSe8SxdxlbgY0hU4jDZLBHXk5FsqFdqCZoyaZB JkFAFU1c5HbbzgDyxSu5e8/qqyhhdgtLQIIGfhxfUsgyZbmRiBOYB6+qNafNIwk9 +VH06Q6uhsOpbJSqZTY/5VRatHNJpnSll11+UQwppYQlKCTiv44gu6Oy9K6KyjjV ksmbSEDafAXGp3Mq/TZRiYk5wuGdmZhCZYpSbBRFhe3WRGZtjU+SxXNXTGWG2yC8 5gWPimOB6RypVpPVlJuUmdeIPEYzH6JRKtuMYplGJ++0E7PJH580iq1OY0nqzKsY Lc48k2SdyyI7SxjKG5IvgqHJF8FRm7903/E+qYd+6b/ifVMTEeV2sPJF8FQ5Ivgq M3fum/4n1TDv3Tf8T6phiPJtYeSL4KhyRfBUZu/dN/xPqmHfum/4n1TDEeTaw8kX wVDki+Cozd+6b/ifVMO/dN/xPqmGI8m1h5IvgqJGgSq06R0tRBym2j/ziNTv3Tf8 T6piQoNYp7ukVMbRjxqm2kpuk7SsQxHlNruMV3TD4DI/tf8A23IsUV3TD4DI/tf/ AG3IMKvCEIwwQhCAQhCAQhCAR7cbExT1IUTdCwQRtAO/yEDymPEZpbnOFr51ODy7 vvAjN+2fCwSz+rEsl2wUhZcXbeCbZDgQn0jdGvMMKDlrhLrSiAd3WD1f6R7qCFB4 KaHvjKAjDuNgMSfPfPj4zfZxJWoTo5yFJStJI8JZGf33J8Vo5Vnbi3n+x/u1PLAX AGtRbC4CC6k7lWyHkufOeEY15Tf67CFq6zdaL/VQkeSPDqFKXrUGzu++xQ4H17vO D7btMTDahzU8nwqKvilK14gfFjT9YcY3MbcTP94Tu//X0EN6lSlqOGVHhK+bPqP3 bdlyM7jmMiwwpAslPD/WDqwtIQB72L2B332kxqpJl1YFH3tRshXyf0T/ACPk4X5R GZzLLammwZ+XdUbNoQgOqvsSUJ2dZUEgeOMr6yuXQpVgVOKVYcLAC3VtA8UfKu2r VzLCPxq1FY6iDzPX5o8LcS4zLFOzUpV5FXUPuUI46fxRWf72anjLHCEI9DBCEIBC EIBCEIBCEIBGCe+ATP0SvQYzxgnvgEz9Er0GA6vN/DX/AKRXpjDGab+Gv/SK9MYY 22QhCAQhCA5vJflFP/vRz+IR09acc8pNyLuWuk2Iz3RzCS/KKf8A3o5/EI6g429y lbjbaiQskHCSL3iQkIeYp1OlpZx9XfNSW0lRAqTt7DxqAjUJoKE3dfqTSgAVJXUX 7p3Z2NsjzSdgOW2Nicp9WcllImpuTSyogEmUcRncWFw6N9o1FUGZWDjekFXABxSr huNtj79mL5nicznnFVlSiiuMhxhdUeu6WglFQeuVAEkZqGwAn0Xyj6w3Q5qZQww/ UnFraLwKag/bCFYdt7bd3UY+GlTxQtHKaeAtwuqtJrBKjtNw7vGXiJEfZeiz7U0X 5d2QDxSQSiSc2E3OWt4wGaTYl5atTjTCHvg7KlLemFuqN1O5XUTYC27iYr9fsvuh aOMqsUrJBB2HOLRJ0yoNT0xNTS0urdbbbAal1NhISVnepV74/uigaeVNVM00oU4w W1ushZSleYxBRBBsdxuIzftlqnd0CvTktRZBTszTe+UslQTyRLYULnfhIIyjVemJ FNOlagqQbQ0tCXkS5QkFoWxBNrZEbPJGm7pRPtaHM6RhmX5U6vAUlKtXbEU5C99i eMZqszMVSh0qZQ0VLnUJW+EbE40gm3Dadt4RaJnjw3MYhzzTfSiU0mrjDzMoplAl 0tELIOYUo3y8cc7qiQ3UnbEasWsgbNg3RfdLNFGqVpbJUancofcmWErShwgrKipY sLAD4sVHSKhv0qcfZmGXW5tBSFNLtlcAj7iI89YmL/E3ac14XDuYzslIzE4Jqjcv U6pgNr1QVqTdWeYy2jzR0Hukhpykzjq2UurTK2CykEjnHK8VXuT1KTpDdTbqEwiX XMhhLIX8cjHe3nHni36Xys3+DFRSlhRSWczbrjvpcxli/hzTuXtj8KZpbq0lsyar IVsBxojvTMwy7LkMvNrKE54FA4cuqPz9oQy2jSKZS4opWJdVxw5yY67opI0eT5aa POrmlvYOUhSgdWeda1gOKuOyN5xMQzEcI5zR4P6aMV56pyzYbQUFlxXP8Ap3+OKx 3SSkyASAFoE2myxmk81WyL1VdAaVV58zkxMTiXCkJs2tIGXjSYrvdBo0lI6ISUiy 86oMzSUjEoE2wL25RyvmItmOG4xmET3JHpds1ZlzVhb2oS3iI288ZecR0yYpTjjC kh5KSbZ+WOD6LS1SExM1KSlC6imrRMOKIulASSoFWezmnzR2bR/SBzSDRozczqUv qcKcLQIFgRxJiaN/9JePdVO6u+0zoZJSYmELeanUYsKxfwHN3ljmejVPm3arKNNz ymnXJltKHMRBSSoAHyRbu6XSqEJTlLE+6upOTY1zGMWQMKr5Yb7QN++KZSZ56Xnp eZKEB1l5C0Ag2JBBF84xqTmVjjs79R5SekGkSE3VVzT5JVrVOKJtttmbx+f9KJRf 4W1m5xHlz+dtvvio7VorOGtFmoTGFM3iUkNt5JsAdxufvik6QaL1Tv3PzKpF8NPT TikKysoFRItG72xWNqRHM5c25Grh90ORq4fdFynqBO02elpKdlnmZmaISy2u11km wt5TaM09ovU6bLGYnJJ9lkEDGq1rmOPqW8N7I8qPyNXD7ocjVw+6LDaXuRrDcbc4 3maLMzMm/OMsOrl2PxrgtZPjierJs+aocjVw+6HI1cPui0yNPVU5/kMklb81hKtU jbYRLK0KriBdVMmQPEIsalp9jbHlQORq4fdDkauH3RdF6Oz7UyiXXKvJeWLpQbXP +7Rst6G1p5eBumzKlcABF328JtjyoXI1cPuiU0alVJ0qpCrbJ1k7P0xE7UaHN0kI M/Luy+O+HHbO1r+kRi0fmJJekVMDcwFKM21YX2nGIRqWyTWMd3c4rumHwGR/a/8A tuRYorumHwGR/a/+25HredV4QhGGCEIQCEIQCEIQCPoJSoKSSCDcEbo+QgM6px1a ipQaKibk6lHqhyt3AEWawgkgalGRO3dEW9Nr1qEtKbQixKnHEkggWGViN5H3xiD9 RcdXg1GqQBfE0rESeAxZZZ2OeY2Rj0qflj+Gt0+Uxypz5LXYo9UfeVu4AmzWEEqt qUbTbPZ1CItTsxhTq32HFLF0pS0bkcfCyHXGszMVNx54FUsttsgEoaVe+dxmrO3k 47wIelSfaEzPlOcqc+S12KPVHxT6lpKVIZIO0alHqiODzxbK0zLCgDawZN78LYtv VGEvVBt5IdLIbWm6cLJKgeB52eWeXXtteL6dPEGZTTk8+84pxzVKWo3JLKMz5owK UVEEhIsAAEpAAAFgAB1Rpys0pxS0OqbVZeFLjfgqyBG852MbcK6da/hjBMzPchCE aQhCEB//0NSEIRhghCEAhCEAjBPfAJn6JXoMZ4wT3wCZ+iV6DAdXm/hr/wBIr0xh jNN/DX/pFemMMbbIQhAIQhAc3kvyin/3o5/EI6LX5mYk5CYmZWUVNvtoWpDCDYrO I5f7z4ZxzqS/KKf/AHo5/EI6NUJapvzalSz6G2gSADLFZOZN74hxhWcTmUUnRurT lb0PTOz7mN9VTaGywSNe3YAcBF4iM7wz5AQp1pLRfRMOJak8BWpKwu5OLaSMzEvq HvmnPqmOmreL6lrVjETM8ePkRxCD0cnpyoSC3Z1OFwKRbmYdrTalDyLUtPVhscwY nG/Ae/U/9QhqHvmnPqmPD0vOlhaJcFpagBiW0V2F77LjhHKIxDd7Ra2YjCl0Cv1S a02rNJdYW/IsuqKX8hqOCTxB3Dbt3bK/pPozWa3PSE1TJUPNsPzQWrWIThPKF7lE XjobVIqrJWWn2G9YorXgkbYlHaTzszkM425CmzElKalYW6suOOKWGym5WsqOWfyo 66166kxiuOIj+Ixn9+7McIrR6jheiUpSK+yChBWpbWPYcaiM0Hr4xsToqTAlJam5 SjCwhKebzWxkBdWZyHjiW1D3zTn1TDUPfNOfVMcoiI7NbpVys0R6od0akV5oIEvK NIQtSlEKBClnIb/CEVzT3RGqVvSGdqMiy2+h4t4QHAlRshKTkbDdHRtQ98059Uw1 D3zTn1TEtSLEXmHOtC9EHZZyZc0mpS3VNltUoW308wjFivhWP0dt9kXXSN2eqNKm ZeTaWNY1hDa8AJN+N/5xIah75pz6phqHvmnPqmFaxWMQTaZcnoGiVfkNIJmbmaeQ 040UhQebNzdJ2Yuox0ujU2Uo0rOKk0BmYmEAk4lKusA223G0xu6h75pz6phqHvmn PqmNJEzD1o7NTLdJSmuvpdnsarqQnLDu8EARB6e05VYpLbdMZ1r4mUrUMWHm4VC/ OIG0iJrUPfNOfVMNQ98059Uxma5rtlYtMTlynRmh6Y0eecllyakUqedQ3UGw4you sXIUL3uOapWwg5x1KRp9Gp0jyenyi5VoEkNrWpRudpvc+mMmoe+ac+qYah75pz6p hWsV7E2mXJtKtENIKnXp12VkdbKrexNnXNpuLdagfPEPJ6AaUh9vXSCUjGLqL7dg L7cjHcdQ98059Uw1D3zTn1TGJ0qtepKr6MUqfo4abeQlKkqUcaVAgXHn+6LZN8mm 2Gkve+KTmbXGdox6h75pz6phqHvmnPqmOlY2xiGZtM8ueOU7Smq6T0epVuWVMCSm G140rZThQFhRySRfZFpqTE5V6483PtF7R5QBRK3SlYUEjO4IPhXPhb4mtQ98059U w1D3zTn1TGI08RjMr6kuST2g9SVVJtcpSVJlVPLLIL6LhGI4dq77LRedD6D3vpM/ T62hC2ZpYulCzmm3EWIixah75pz6phqHvmnPqmJXSrWcrOpMueTWilSpWnUzUdGG ESsrgCWXVuBWRQkKFlknbfaItc6vSJ6SkEsTTaX04eVEpTZWQxW5vG+y0TGoe+ac +qYah75pz6pjWzHaWd8oSdpzj1WYm0NX1aQMWLZmd3ljannqmimAUkFipBX45eAp w3zFjfdbdEjqHvmnPqmGoe+ac+qY3PMYSLKLp9Ra5XJamiSbTMOtoc11lITmoJ42 4HZFH0d7n+k8hX6bNTNNwMszTbjite2bJCgSbBXVHctQ98059Uw1D3zTn1TGdsZm V3SxxXdMPgMj+1/9tyLNqHvmnPqmK1pmhSJORC0lJ5UMiLf8NyNMqtCEIwwQhCAQ hCAQhCARpKmDMqKGOegZGxti8Z3D7zuyzPio6x51mVQvC2s++mx2fFBsRkTcbc9n UcwbmGW8npZCEj5kgAfWijXWnVTZWspW8hoJauLJSVXvluACb8bX25RsNYlNhuXJ De95QzVfaRxvtvs8cRrLUy/Unn5hxvCSltpKmjYc0KsRi2m9875jcbRK4Jv59jsT /VBWNDSJJalJHvbirrUcyFHf4j93ivbBIOhsTeRUozS7JTtOyNh3lKGypbzBTstq TnfK3hRE0RE0y0oOOtha1ApWponIpSQnJVgQCB19ecBLckxuCYWrDMAWCknJI4W3 jx/dlY4olGrmAEG/NdT4IO49RvuOW65j3gm/n2OxP9UfC3NEEF5gg7tSf6oI1WkF yZfwhKFqSkuNG+FS8wfFkE5+IxsS8wcfJ3gpLg8HF8YePef98QI1TUzLT7cyy62W SC0oatRFrFWJIxbsIFhlYm2wX335V6aaCVvMEbUqS0oEdYIVlBW7CNSnPuPyiS6b uJyJta42g+MggnrvG3EQhCEAhCEAhCEAhCEAjBPfAJn6JXoMZ4wT3wCZ+iV6DAf/ 0eizfw1/6RXpjDGab+Gv/SK9MYYBCEIBCEIDm8l+UU/+9HP4hHQ63U2afPq5QlaW sGNT2QQkAXNyTmbAmwuco55JflFP/vRz+IR0aqNScxPrU9LIdUnmhSmcVsrEXtEh IRbeklLceW0l9RWkJISG1EqCrWIAF8ybcY+TGkcjLMtuuofSlwO4bt2JLawgixsQ STcX3A7I2eRU03/sDOYAP9m2jhs6hHvk8jhSnkiMKcWEcnyGLwrZb7m/G8VWo7pL SmUoUt9YQopBVqlAJxAlN8t9st5vwzjYmnFzCqe3LzLjCZmYCC4hKcWHCo5YgRuG 6PhkKYQAaeyQBYf2XZ90ZcDJfk1pxtplntaEpYJvkoW3W8KA2ZiiiVQlb1eqKEFQ SVlMvZJOy/vXGw8ZERoXTVKS2nSWpKeKkJLSW2VLBUQBcBric+FjwieeqUtMMrZd bcW2sWUksnMeeNcuU1Tq3TLuY17TqlZc4Kyzy5wBy357YDTkpOUqSUqk9Jp58KBI wJYOQ3/itnrHERINUUyqw4upTkwLhOB0NAZkZ81AP3x4Yep8stC2ZdxK0JwJVqlE hPyduzq2ZDgLZ3qq2tohCXMVwU3ZVa4N84DBrE/Mt+dXriLXpJT2SvlLJl0JeLKX HUqwuKBIOEgnK432jH/8V6bKf/b3PaRgck5t5KUuuU5aUrxpCqWsgKve49823zvA SjFXkpmaVKtJTr0oxqbUhxJA672ttHnhVJwylInZlplsOMsLcTfERcJJG+ItmTm5 deJhynNKw4bopa0m172yc2Xj7OS1TnZGYlVz8slDzam1FNPcuARbL3zrgJqEY9cn g52avVDXJ4Odmr1QGSEY9cng52avVDXJ4Odmr1QGSNWXn25h6YbShwanaSBZXOUn KxvtQoRm1yeDnZq9UY0CXacW42zgW4brUlkgq8ZtnAe5V9M1KMzCUqSl1tKwlVrg EXsbb4yxiQ402hKEIUlCRZKUtkADgMo+65PBzs1eqAyQjHrk8HOzV6oa5PBzs1eq AyQjHrk8HOzV6oa5PBzs1eqAyQjHrk8HOzV6oa5PBzs1eqAwTNSlpR4NPKUFEpAs km5VisMtpOA/dHnvxT8LauVt4XPBN8vjZ9Q5qs+qPr0vJvzCH3WVqcQQUkoVkQbg 22XFzbxnjGEUymAECTyISCnVqsQLkC2y1yTbZc325wHpqt0+YBMu/rhqlu8xJOSS AoeMXGW3McRHnv8AU1LBddmUNBIuoKIOHMbxcbxsOw3jIiTkW1laWHMZQUFRSskg 2vmd5sLnabDgIwd6KX77ilVr1hOIrSsk3ABz252z43N9sBsJq0iqYal0zCS86Tq0 WN1WzuOq2YOwgEjIR5FYk9etlxzVqSvBz7Zm9vJnbbbaNxEfW5WTacSttlxCknKw WPEPENgGwAkDbGN2m056Z17sutxZBBC0rUDcg7Dla4vbZmeMA7/0rk3KeWt6n5Zv a97EeMbxtAzOUQ+lDyJiSkH274HHm1pvwLbpETKadTkCyZdwXJUSAu5JNyq/E7zt IyNxEHpKw1LykohlLiW+UpsFlRA97dyGLYNmQygIKEIRhghCEAhCEAhCPilBKSpR ASBck7BAahbMxysptjuEtq3XSLg+RRPmj0hwTwQUg6mwUb/GNrgeTInzcY+NKWiW ZQBhedusgjwbm6j5L280epYBgusFRIQcYUo3JSq5uT48X3RQl0JdlnErFwpxwH65 j0l7VJUl9XOQL4reGOIt6PWI+ShDdPYKzhCWk3JytlHhbKpkJePMUnnNAjYeJ9X8 4DKhClrDrosR4CPk/wCv/sN5OrTUJUzMtKSFIQ8W7EXuEpSBfzRutOBxJNrKBspJ 2gxp0/mvzKRsKis+MrWL+ZI80BsYlS+SyVM/LO1A/S4jr8+8wUsvL1barJHhqB6r 2B47PJHp1xWINN+Gcyfkjif5f6GMaWTKJAZBU38ZBNz4x19X+yH2aQEyasCbasBa UgfJNwPujG47yJlxQsWsJU1wBAvh8WWXm4RtIWlxAUk3BjRUkGnGXVsS4lhQ34cQ A8pSQb9cBlabEq802DdKmgi54p2eUi/1Y2403CvVKSq6n2LOJIGawOHjzHl8UbaV BSQpJBSRcEbDAfYQhECEIQCEIQCEIQCME98AmfolegxnjBPfAJn6JXoMB1eb+Gv/ AEivTGGM038Nf+kV6YwxtshCEAhCEBzAf3pV/wB4PemPPI5XozPZiPQ/vSr/ALwe 9MZYzLMv/9KN5HK9GZ7MQ5HK9GZ7MRnhGGGDkcr0ZnsxDkcr0ZnsxGeEBg5HK9GZ 7MQ5HK9GZ7MRnhAYORyvRmezEORyvRmezEZ4QGDkcr0ZnsxGnISrD4cmVsN4FrUG wUC2G9gbddh/smJOIqkyksaayhcsyVtoSgnVjPIEHx2IiqwLbaVXlstyzZwtoOAg BJIxXy3Dnpz6vFEk3T5ZAJUy0pRzJwC3kG4f7ziKYkmVVmZdaZYUgqUnVlGRwhsH xG9xwyiUblpJ0G0qyFDJSS2m6T1wGTkcr0ZnsxHh2Ql1JGBhlKgbg4BbxHqj3yGU 6Kx2YjE5LSiCEJlGVOHYnVjzk2yH+84DRtLd9ink7f4i2pwjNeLh4t/DPZEg1IS6 Ec9hlSzmo4Ba/VwERveuX795ttFzk+IK1YsDi4cMz19d84kW5aUXdKpRhLifCTgG XWMsx1/6wGTkcr0ZnsxGB2Rl0BZLDZaUOdZAujrEZ+QynRWOzEYVSsu4ottSzAtk perHN8WWZ9H3QGGnMy80xyhTDJCgALIFshnl+tiHkjYekWCkKbl2cacwnALK6j/v KNSnyUqyktGXaLalrLRUgH4xyuerMeXcI3HZWTabK1SrJtuDYuTuAgMUixKuy1uT tEtqU2cSBfI2F+u1o2ORyvRmezEYacwGDNJskEvYiEiwBwJyHVG7AYORyvRmezEO RyvRmezEZ4REYORyvRmezEORyvRmezEZ4QGDkcr0ZnsxDkcr0ZnsxGeEBg5HK9GZ 7MQ5HK9GZ7MRnhAYORyvRmezEaVJlmHKYytxhtSjiuVIBJ5xiUjQo390sf5v4jFV scjlejM9mI+plZdCwtDDSVJ2KCACIzQiIQhCAQhCAQhCARq1BxKJJwK2Ls3lt5xt lxOcbUaVRYEwJdshJu9cBQuLhKiL9VxAbDLahicc/GLtcDYkbgPFn5zGrVCG2FOk 2CkKaP8AmGXlxWA/WjI1LSbrYVyRkHYpJbGR3iNSfkpV4JZEu0Gw43rClAF7rTZN x5z5OMVW+kGYVjUPe0m6E/K/SP8AIeXhbPGkmVlm1Bt2VZN8kuatNldR4H7vQM3I ZTorHZiCPrqVJVrmxdQFlJHxk8PHnl/rGjKPjWulqy1OD3sbj744b+KNhyVlirVt yrGPedWLJHrjQk6ZLa93Ay2FIvbEgEG7jl7+YQVMNNhsHO6lG6lHeY9xqNy0o5cG TZStPhJLabjr8UZOQynRWOzERHpbRCy4zhS4fCB2L8fr9MaWtSqpttAFKlq1qmzt FklJJtu8DquYzuS8mghIk2luHYkNj7+AjSfp7LU6y+phpSktrKkpbGHDdNwB9/Ek eSKJR5srSCk2cTmg9fX1Rgp7gUwpq2FTKy2U/JyBA8iSPH17Y9KlZJLZcMuwEAYi dWLWjDIMhqZmClsN6xKFlCRYJOYt47AXgN+EIRAhCEAhCEAhCEAjBPfAJn6JXoMZ 4wT3wCZ+iV6DAdXm/hr/ANIr0xhjUMvVph1xxVSlk3JWr+ymwuf1+uPnIql+d5T7 Ir+qNttyEafIql+d5T7Ir+qHIql+d5T7Ir+qA3IRp8iqX53lPsiv6owITUHHX226 pLqLKwhZEoQL4QrergoQFDH96Vf94PemMsepiUVJVepMrd1qzM6xSwnDcrSlRyz+ VHmMyzJCEIiEIQgEIQgEIQgP/9PUiMaWqXlpZaBcusJQAdmMDm+k3PUIk4i20rfl JcN5lhlCwAdq7Cwv4gb/AKwjLD1KthmoqbSSQkKFztPNa2xvONYyFpVhcGxX8iN4 /wB5RpS60uVJTiDdKgog8QUtRtqcU4ottGxHhLtknxcT6N/Ahj5UoucnwgTB4+Db 5X+m3yZxnbaDYOZUo7VK2mPOob1WrIJF73vnfjfjHkOKZIS+bp2B3YPEeB69ni2Q Gv8A/P8A/wCl/wDVG243jspJwuJ8FVtnUeI6v9I1P/n/AP8AS/8AqjYJVMEhCilo ZFQ2q6h1dfmgPCH1TKlNI97KDZw7c+CePj8m29tlKUoSEpFgNgjGtkFKdXZCkCyC BkOq3Dq/0j625julQwuJ8JN9nWOI6/8AWIMEu3raZLpBwqDaClVthAFoSznLCl8j ClBISm/xthPi4HeDfeI8S5LslLS6Ta7KS4eCbbPGdnnjMsCXeDgFm1WSsDYDuP8A LzbhFH2X/HTX0o/gTGeMEtzlPuDYt028gCT96TGeIEIQgEIQgEIQgEIQgEaFG/ul j/N/EY340KN/dLH+b+IxRvwhCIEIQgEIQgEIQgEYJjJ2WUdgdzPC6VAfeQPLGeME 5+JT9K3/ABiAxzDnJFF4C6XCEqTe3O2A/wAj5DuMHm9VKoSTiUXmypVtpKxePQSm acUpYxMgFCQdh3KP8vPxjG6pQa1KzdbbrWfyklYsfHkfNFG4pKVpKVC4O0RqqfW0 6Ja91G1nCMkg5C/XuHGMzjhCtW2AXCL57EjifVv85H1LKEtqQRiCvDKs8XjgPTba W04U+Mk7SeMaUj8JmPL/ANRyNgLMuQlxV2zklajs6ifQfPnt1pNaUPzKlqCUi9yT YD3xyA3HGg5Y7Fp8FQ2iMCZlbiywnCHASC5a6cuHX1bs9u/Jz5j5TbXVdKlfzA+/ xb8imW1NhspskbAnK3itsiA20loG2ajmpR2qPXGNfw9n6JfpRH1LimlBDxFibJc+ V1HgfT90YnnAiax2vqmjl8oqIwgeVJ84ijG3zpgyPxGrOHrSb4U+QjzAcY2Jf8dN fSj+BMY1NFhpL3hOIJW4R8YHwh6LfqgR7liC7NEG4Loz/wAiYDYhCEQIQhAIQhAI QhAIwT3wCZ+iV6DGeME98AmfolegwHVEKSlp4qIACBmT+kIwa9n51v6wjIZdiYac TMMNvoCb4HE3F7jd5YhnZigszi5ZdIlMSX22CQyk89YBSLA3AsdpFo22xpk5pupM zKaoS1r3FvNKfukpN8CUgjYAcxx3wYl6giqtPvVNlctjccW2HCLYhYItsUE2Fjlv No9PzujcrreUU6Ra1aygBTQuoi+wA33b7bRxF/Qm9GVAlqRkHrOho6qXK7KJAANu N8uIuRe0BK69n51v6wjSpqkqnKsUkEGbTmD/AILUYZeY0am3GkS0lTni6SE4Gb7i c/qmNinYEzFRZaZaZaamQlCGkBIALTavLmTAU+sflFU/pUf9JEakbdY/KKp/So/6 SI1IzLMkIQiIQhCAQhCAQhCARF05Uw00qWDTRW0opUVukFXA+DstbyWiUjUmm8Lq JhJwlOSlWvYZ2J6hc36iTuFqIguTMpUyyptttCsSgsOkhKThsPB5oBTbZs4ZGJht UwG06tmXwWys8bEfVjTnSXJplVgh1ttYUDnhupFlX4AgG/AG++NxtsONh5g6la81 JtcX34hxvt2HKCveOb+YY7Y/0x5W5MhCitmXCQMyXja31YKnEsACZTq1E2TY3So8 AePUbR7S2p1QW9kAbpb4ePifuH3wRB3mTWPxCSxyfwS6TdOL9W+Hq/llEyhyZKEl DMuUkZEPG1vqxh/+f/8A0v8A6ozuHkuJ0fitq03tbrH8x5du0r//1I3HN/MMdsf6 Y052ZmW0KUhhpT7aSpIS6cuo83YeG/dmI20rXMi7ZLbJ+N8ZXi4eXPbkNseVtoC2 ZdCbJKtYrrwkb+Nyn74yw16amaakGk6plS8ICyXSOcBY5Yd1reSM0w882wrXMsYC CCNcc8v1eF4IdLUw9LtpxruHAL2CQrid3OCj5cuoWdY/gUcagLurI3bkDgDbPqGd 7wH2mJeTIN69JS4oqUQdoBUSAeuxF+uNuEIgQhCAQhCAQhCAQhCARoUb+6WP838R jfjQo390sf5v4jFG/CEIgQhCAQhCAQhCARqVMOmnuFkXWkpXYGxICgTbrsDbrjbh AabDzy2UhpljCkYbB483q8GNWqmcEqHW2WNc2pJQNYTisQSLYeq/kvujaS1q3y2h WBVsTR2jDvSRvAJy4Xy3x9DuunUNLTgW0kuFJO0nmgg7x4X3RRjlnnykpSy0HPCU FvHEevwc/GMtw2RsY5v5hjtj/TGNlpC2iyoZsKwJUMiBYEWPiIB8sfVzCpRP9o5y NiVpGflH8xlt2QBx2ZQglbDBBytrSb9XgxEyXK2pl1brLSkC9hrSA1745tyz8e7z xNtoKiHXLFRHNANwkf73xqyPwmY8v/UcgrOHJogEMsEHfrj/AEx9xzfzDHbH+mPi 08mCnGykNjNSCQB4xwP3eLbHxL6pkf2cWRsLiwRbxJ3+W3lgjy888hs61mXwq5ti 6Ti6rYc/FEfLKnV1VeNlAQhA1aXHTe4vfMJ3BY2/K3kG0oUNyyFvqxLWlJuom6j1 DcPELRr5yr0uVgrWtLgIRndZIVYdWR27gIDMt6ZbQVKZYAH+Kr+mMVJS4JQuOJwa 1ZWlF74U5BI8wEfVtF94IdwqIF122IB+KOs7zwvsuI3YBCEIgQhCAQhCAQhCARgn vgEz9Er0GM8YJ74BM/RK9BgOpupmm5dfJ22HHFJFkuvhsWuDtsT90QrzU67MFpyn 01TqFomCEz6iQrYlWTf6JHkjQ7pD9al9HXF0dOWAcpWgnWIbwjNI9J2gecblEJVN BSiSTTZQknfm7Hotp4063zHOePfjHf8AXPDWecPjkhNurWtylSKlL8ImfczHD8Xs ub22Xz2w5BN3BFKkRYgi0+4LW2f8Pdu4brRIVNUyiSvKYg5rWsRSkKIRjTjIBvc4 cUeqaqZVS5RU6LTZZQXhlkvCMWzLbeOOecN7fh3NGXp8824h1qlU5K2hhSpU+vIZ 2Fy3wJA4CNqTl5iSRUJuoGVZDj2us3MYwlIbQnMkDPmndEkPg6/10+gxzXQ6Yrkx 3P5xVUBVK6n+yOOE6xSbZ34p2WJz8lo7V092na+Y4xx7znPZjPOGesflFU/pUf8A SRGpG3WPyiqf0qP+kiNSOEpJCEIiEIQgEIQgEIQgEfFJCklKgCkixB2GPsICKWUp m1tTDqUFpsBpbpycSom4N9vggHz7xGOSqTTSXGVOJKwrmlS8id/O2fpE9ZAzETMI o00TEpcrdm2FrIt4YsBwHV6fNHjXy7PwecYw/NrcGHyH4vo6o34QEJ3yZNZxpIvy fDzlAJBxXzVs8143kvypUHHpxhaxmBjGFPiF9vX6NkbsIDSVNS7ai41MsG+akawc 7xZ5H0/fGu1PszDzriJhtpKiE41qCVADgD1km/AjrtKwgI5cxLNOsql3EOq5yMCV 4lHFnfjtSBc8c43WGy03ZRus5rVxP+/ujJCIEIQgEIQgP//V1IQhGGCEIQCEIQCN Cjf3Sx/m/iMb8aFG/ulj/N/EYo34QhECEIQCEIQCEIQCEIQGJ9suIGAgOJOJBPH/ AFzHljTamJV4OOPPJaWpeSVrCVt2FrdW8+U8YkYQEUqossTaSt1teNODE2oG9sxf 5O07csx122W5qVCtY5NMFwi2TgskcB69/mA3IRRomYlmiVS83Lji2pwYT4uB/wB2 jSk6g2H3sJSlRvm4sBI56ztvnkRsv5Im4QGkl6UxBbs4y4sbLuAJT4hf79vXH1yY lCrWNzbCHN5xiyhwP+8o3IQEU9UmXXGmQtvEFYl3WMAts52/Oxyzy2bY9Ovy6Vsu odbmHw5mEKBUq4KQANwuR4syd5iThAY2Wy2g4jdajiWeJ9W7yRkhCIEIQgEIQgEI QgEIQgEYJ74BM/RK9BjPGCe+ATP0SvQYDojtLl3nVOLdnMSjc4Z15I8gCrDyRiXL MUeVnZ6XbeeeDBUQ7MLWVhAUQm6ybZk+eJScek5OfMktxPKNWt5LesOIoSUgnwLf GT548tutLkm5lSQkLaS7g1pJAKb28DrjbaDmdJWZBNpyUfbdBKSlBSoYghKrA3Hy wN2d92cZZLSKWnZxMoiXmUPKZD2FaU5Ai4FwSL2t54n5NhU3JMTKWgkPNpcCS9su L28GM3e9fyE9t/8ArAQjaU1Wmyzr2uaDiEulDMwtFiRsukgnbGNdDknEFDipxaDt SqdeIPjBXnE/3vX8hPbf/rDvev5Ce2//AFgOZVj8oqn9Kj/pIjUi9zug7M7Pvzap mabW8oKUlt5GEEJCcrtE7EjfGH3PmenTvbN+xiYTClQi6+58z06d7Zv2MPc+Z6dO 9s37GJhMKVCLr7nzPTp3tm/Yw9z5np072zfsYYMKVCLr7nzPTp3tm/Yw9z5np072 zfsYYMKVCLr7nzPTp3tm/Yw9z5np072zfsYYMKVCLr7nzPTp3tm/Yw9z5np072zf sYYMKVCLr7nzPTp3tm/Yw9z5np072zfsYYMKVCLr7nzPTp3tm/Yw9z5np072zfsY YMKVCLr7nzPTp3tm/Yw9z5np072zfsYYMKVCLr7nzPTp3tm/Yw9z5np072zfsYYM KVCLr7nzPTp3tm/Yw9z5np072zfsYYMKVCLr7nzPTp3tm/Yw9z5np072zfsYYMKV CLr7nzPTp3tm/Yw9z5np072zfsYYMKVCLr7nzPTp3tm/Yw9z5np072zfsYYMKVCL r7nzPTp3tm/Yw9z5np072zfsYYMKVCLr7nzPTp3tm/Yw9z5np072zfsYYMKVGhRv 7pY/zfxGOie58z06d7Zv2MY2O5xKyzKWmp2dCE3sNe2dpv8AMwwYf//W1IRdfc+Z 6dO9s37GHufM9One2b9jGcM4UqEXX3PmenTvbN+xh7nzPTp3tm/YwwYUqEXX3Pme nTvbN+xh7nzPTp3tm/YwwYUqEXX3PmenTvbN+xh7nzPTp3tm/YwwYUqEXX3PmenT vbN+xh7nzPTp3tm/YwwYUqEXX3PmenTvbN+xh7nzPTp3tm/YwwYUqEXX3PmenTvb N+xh7nzPTp3tm/YwwYUqEXX3PmenTvbN+xh7nzPTp3tm/YwwYUqEXX3PmenTvbN+ xh7nzPTp3tm/YwwYUqEXX3PmenTvbN+xh7nzPTp3tm/YwwYUqEXX3PmenTvbN+xh 7nzPTp3tm/YwwYUqEXX3PmenTvbN+xh7nzPTp3tm/YwwYUqEXX3PmenTvbN+xh7n zPTp3tm/YwwYUqEXX3PmenTvbN+xh7nzPTp3tm/YwwYUqEXX3PmenTvbN+xh7nzP Tp3tm/YwwYUqME98AmfolegxfR3PWVKAE9O5m345v2MQs7o7R0tzDAqU666hbTLj QdRdOtUEpJ95GXOvt3GGDCzzsip+cfWucmSVKUNqcgTs2bIwCm2aS0J2awJSEAYk 5ACwGzhGes0KaqM0hxtKmlNLUUuagrIuR4NzYHLbY9Voi2dEqsyvF3znVXUVLBbW MeQGdlX3cfFbbGmlll51UtLNS7bLQbaQEJBxHICw3xk76O/NNeZXrirzGhs1MyKZ dT0ykgPAqDaziDpBUDdRNrXG3eDuz+vaJ1V1SVd8ZwFKytJ1a7p5hTlzrZ3ufuww FpFSXq1LUmXQlO0qxdfX1R9FRJJAVKkg2OS8oiFSz0lRxKzUvOTZUAhRRLrWVixB Jte23jEEqkpW8245K1lZCUhd5N73wheI33EK2EEbAnhaAugqJUkKSqVIIuCAvOI1 Gk779Sm5GSpTs2uVCNatooSkYr2tjcSTsO6K5IUkyGrwS1XOAt//AOF7nYRYAjZb qAHgp24c5vRaRnm6xWp52SmGmJoshouowKVhx35pzG0boDf771f/AMOTPaM+2h33 q/8A4cme0Z9tGq3opNSkvKS9Pnn5VhhlLam0oVZ0g3Uo2WCCchkbgb4lKZTp2RMy ZiZfm9a6VoC021Y+SLqOQ/lAel1BbRCXeTNrNuarFe/DIw74K4y3mXEbPzS26m9a RqLgAwEtyjhSoZXsQLHZ4o0y+CkA0ipE5X/sLgvY7Mk3t1XzgJibrIk5N6ZcDCkN IKiEpXc24RkcqgadcaU5KaxCcSkDHcDjbhkYrVRL01TJmWl6XU9Y6lQSFSbgFzsu Sn7zCaQtyfmZhEjVCla1OJTyBwc4pwbbbLAZcc+FgmmNIVTEul9EqnVqQF3OVgQD nzuBj6dILJWosshKFYFErFkqyyPOyOY88Rkro/MzNDblZlDrQUwlCm1NE54Ei55p zBGWcepjRiZmQ9rHgC4pWEpllghJCk2PHJauGZv1EJNFcccBLcs2oJUUnCQbEbR4 W2D1dUw8ppbLQUFFOarXIFza6uEYJOjTMsl3GQtTjhXdLC02FgALWOwADds43Jw1 TR96ql9Cytppbij+KUSoWFt3EbDfyGxAbKtI0oShSm2EpcSVoJWBiSBckc/MWzjK K08pIUmUSQRcEHb/AM0Rn4MTONtxMwoLSVqNmXLKKiVbOGJRPHIWIIud+VpLsrKM y6cSg02lAJbXnYW4QGVysOtvLaMsglKsOW82vlzoxOaRBrDrGmUY0lScSwLgC5I5 2wDONSo6OOVOd161zDOrccKMCDzgtGEnwTY5mx2xrnRJ7k8syJhzDLshke9LGIAW AITYWvn5BYjaQl0Vt1xCVolUKQoXSpJuCOI50e3as807q+TNqVn4N93jV1xhYpkw zLttKU44UICStSF3VYbTltj07JTDk8pYacCOdZRbVnci26A+Lry2ykOS7aCq+EKU Bewubc7hH1FcccSFIlm1ApCgUkG4Ow+FsjTqej8xUWgyV4GilQWCwsk32WNhaxz3 7Bwj7J6PrlWphC7vcocUtzEyq3O2gC3g3vl174DZTX1KUUpYaJABIChlfZ8bfuj3 37dtfkqLXte++9reFxiEVoWpamCZh4Bhba0YWjtSEDO6Tce9p8RvtytIfg+oyUtL KClahTa0rLSr4kkG+zabG/jMBsory3QC3LtrBvYpUDexsfjbjGyupOoWpBaZuk2N sXriDkNElyM8icD7y3Es6kp1SgkpskD4twbITfPM+aJV6WmFPOKEu6QVEjmHjAZe +jvzTXmV64d9HfmmvMr1xr8kmeju/UMOSTPR3fqGA2O+jvzTXmV64d9HfmmvMr1x r8kmeju/UMOSTPR3fqGA2O+jvzTXmV64d9HfmmvMr1xr8kmeju/UMOSTPR3fqGA2 O+jvzTXmV64d9HfmmvMr1xr8kmeju/UMOSTPR3fqGA2O+jvzTXmV64d9HfmmvMr1 xr8kmeju/UMOSTPR3fqGA2O+jvzTXmV64d9HfmmvMr1xr8kmeju/UMOSTPR3fqGA 2O+jvzTXmV64d9HfmmvMr1xr8kmeju/UMOSTPR3fqGA2O+jvzTXmV64d9HfmmvMr 1xr8kmeju/UMOSTPR3fqGA2O+jvzTXmV64d9HfmmvMr1xr8kmeju/UMOSTPR3fqG A//X6b30d+aa8yvXDvo78015leuNfkkz0d36hhySZ6O79QwGx30d+aa8yvXDvo78 015leuNfkkz0d36hhySZ6O79QwGx30d+aa8yvXDvo78015leuNfkkz0d36hhySZ6 O79QwGx30d+aa8yvXDvo78015leuNfkkz0d36hhySZ6O79QwGx30d+aa8yvXDvo7 8015leuNfkkz0d36hhySZ6O79QwGx30d+aa8yvXDvo78015leuNfkkz0d36hhySZ 6O79QwGx30d+aa8yvXDvo78015leuNfkkz0d36hhySZ6O79QwGx30d+aa8yvXHly sFptTjiWEISLlSiQB5bxh5JM9Hd+oYwTdLmpltIS06haFYkktki9iMxlfbxgN41d YNihgHLjvyG+PCK2HHFNo5MpaDZSUkkjxi8V9vQ9xrUBCpvC0tCrKQTfCvGD1HYm /wAm435e5jRaafedXz8KySG1y5UkXWFHK+02IyttO8kkLAaq4kXLbIF7Z39cfG6w XUY20sLSSRiSSRlkd8Qsvoy4wypstPOHlCXwtbalKxJIO0k5m2drZqUbZxsUyizF NkkywRMOhNgFKSo5AADbc7AN/mFgAlhVAXFNByULiAkrQColNxcXG7KPqqnh8Jcq Mic8ewbTFTq1LTMzjyxLVdLxcSrWNyrpCSlCU2TlbakG42kDbHluQSiTRLchqxQh SSP7C4MsISpNrbFWJPWomAtqp9TjRwOy6cSeatAVcX3jdFbn5NiXDAdnH3i48ChF 8itALgKuaMve/REa3R1NocAargWsJBdEq9iNgbdW22wDJIGe2MiaZMctlxLSVSKd biUXpVxOEBhxAJURmbqSN27rJD//2Q== ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=tutori12.jpg Content-Type: image/jpeg; name=tutori12.jpg Content-Location: http://zippy-egoboo.sourceforge.net/images/tutori12.jpg Content-Transfer-Encoding: Base64 /9j/4AAQSkZJRgABAQEAYABgAAD//gAcU29mdHdhcmU6IE1pY3Jvc29mdCBPZmZp Y2X/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0aHBwgJC4nICIs IxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIy MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAAR CAGwAkADASIAAhEBAxEB/8QAHAABAAIDAQEBAAAAAAAAAAAAAAQGAwUHAggB/8QA WBAAAQMCAwQEBgwJCgUEAgMBAQIDBAARBRIhBhMxQRQiUWEyVHGBkZMHFRcjQlNz kqGx0dMWMzQ1UnKzwdIkN0NWYoKisuHwVXR1lMI2ROLxY6MlRYOE/8QAGgEBAAMB AQEAAAAAAAAAAAAAAAECAwQFBv/EADQRAAICAQMCAgkCBgMBAAAAAAABAhEDEiEx BEETUQUVIjJSYXGBkcHwFEKhsdHxBiPhM//dAAQAKP/aAAwDAQACEQMRAD8A1T77 7Um27Ksq+AWoJUFX7+zKNOBNWGMzFVEG9dAWLBSiet4QF7DThc1YpEaI2oq6FHIQ kG+6SdTceasrMaC8kqTDZABtq0KArbUaED77JFsuttdcn7lVjS1FS7GzO5gVgOi+ gF9dRViU3DQlxRiRzZRSAG09/H0VmYiw3mQ50NgXv/Rp7aArbjEBWXdyCEhGpUNS ety8yRYdt69FiACk73gLFN7g99/s7K3hRCQUhcJkZjl0aHEcfNyrMzHgvAlMNoWt 4TQH+/8AWgKsG46mmOslKilRWb65rqsOOl9OVZ3Y+HqcIbfCU51ag8E3FuPcVHzd 9b5bUJt1aVRI+VPINpvy7fL9FeUiAo26C3cqygbpNAVV1LaXFBCyoC1jbjUzcwVk DehAKjqDfQ5APrUfNVkajQXgSmIyLW4tp7L14cjw2lrzxGCkAEWaF9b/AGUBoA1h +U3c4g21OnVVr6culYnGYiGnih3OsCyATwN09nHQq9FWNDcFbuQQ2eIA97Tx1+yv ciNEZbCkwmFHXTdp7Cf3UBTKVblDD0u5OhNeEUn3tPEVK6BD8UY9WKAo9KvHQIfi jHqxToEPxRj1YoCj0q8dAh+KMerFOgQ/FGPVigKPSrx0CH4ox6sU6BD8UY9WKAo9 KvHQIfijHqxToEPxRj1YoCj0q8dAh+KMerFOgQ/FGPVigKPSrx0CH4ox6sU6BD8U Y9WKAo9KvHQIfijHqxToEPxRj1YoCj0q8dAh+KMerFOgQ/FGPVigKPSrx0CH4ox6 sU6BD8UY9WKAo9KvHQIfijHqxToEPxRj1YoCj0q8dAh+KMerFOgQ/FGPVigKPSrx 0CH4ox6sU6BD8UY9WKAo9KvHQIfijHqxToEPxRj1YoCj0q8dAh+KMerFOgQ/FGPV igKPSrx0CH4ox6sU6BD8UY9WKAo9KvHQIfijHqxToEPxRj1YoCj0q8dAh+KMerFO gQ/FGPVigKPSrx0CH4ox6sU6BD8UY9WKAo9KvHQIfijHqxToEPxRj1YoCj0q8dAh +KMerFOgQ/FGPVigKPSrx0CH4ox6sU6BD8UY9WKAo9KvHQIfijHqxToEPxRj1YoC j0q8dAh+KMerFOgQ/FGPVigKPSrx0CH4ox6sU6BD8UY9WKAo9KvHQIfijHqxToEP xRj1YoCj0q8dAh+KMerFOgQ/FGPVigKPSrx0CH4ox6sU6BD8UY9WKAq+CORWcVbc mqYSwlDhUX8uQHIq182nG3nqQdpsGliK+wjD2yh167LrbKCu0d0puB8HNl48wKsH QIfijHqxToEPxRj1YoCmYXiSXZcBM/EsMkoViTd8jTLfvYQsrukISQjh4V/B48K9 4ljCXUzGg7hQYLraYpjhgOqu6gEKym/C+W3wb5rGrh0CH4ox6sU6BD8UY9WKAlvq hw2wuVK3QsCSUgJFxcalQ7azbuOloOXdcBVltoi311jxLD0yXWx0sNOMlNlIOqVB GU8QRzIr04EojJQHEqVnJ6t+FhQESFimFYinNELjoCELNnLWChdPFPZyrFCxGA/A gPSJQYemMocS0QnUkAkJuoE2KgPOK/IWGw8OChEYDWYAKsSb2JIvfyn/AGKiRdnG 38PwZUx1CH4TDYydU2UMhIJyngUDgRzoDZmVhzIluTJyIcaNu8z74CU9e9rm+mot 6KiubQ7KhF29q8JUq40VISB363NaD2R464+wGPv521JWuJltrqHOYI765RjmJwH8 EKWOjXfAyIShOZFl34DwNABpa9zxrrwdP4ii6e7rbtx/kq3R12VtAyqU70XavZMR rjdh55Sl8Be9iBxv5rVi/CBX9btj/Wr/AIq55OxX2PpyI7bOGvxlbzeSF5LJKg2E 2TlGYIunNbjnWfggVDdk7BnBkR248pTrYdWhSuo6SptkWWoAgkLS6UgdUA66k12r 0bF/F+EV1n//0Nr+ECv63bH+tX/FT8IFf1u2P9av+KuWJxjZxWK464YzLcN7ES/E SmGgq3W8JCACkhKcvEDKf1uFZJEjYN1MshuUN5JdUwEIyFptSW8t7cSFBzTwdQbC 9q9n1ZHvf4M9Z0/8IFf1u2P9av8Aip+ECv63bH+tX/FXCcb9q/bNftNveh5E5d7x Byi/0/7tWurVeh4NXqZGtn0OcfJtfa3Y/Th74v8Aip+ECv63bH+tX/FXzxSp9TQ+ JjxGfQ/4QK/rdsf61f8AFT8IFf1u2P8AWr/ir54pT1ND4mPEZ9D/AIQK/rdsf61f 8VPwgV/W7Y/1q/4q+eKU9TQ+JjxGfQ/4QK/rdsf61f8AFT8IFf1u2P8AWr/ir54p T1ND4mPEZ9D/AIQK/rdsf61f8VPwgV/W7Y/1q/4q+eKU9TQ+JjxGfQ/4QK/rdsf6 1f8AFT8IFf1u2P8AWr/ir54pT1ND4mPEZ9D/AIQK/rdsf61f8VPwgV/W7Y/1q/4q +eKU9TQ+JjxGfQ/4QK/rdsf61f8AFT8IFf1u2P8AWr/ir54pT1ND4mPEZ9D/AIQK /rdsf61f8VPwgV/W7Y/1q/4q+eKU9TQ+JjxGfQ/4QK/rdsf61f8AFT8IFf1u2P8A Wr/ir54pT1ND4mPEZ9D/AIQK/rdsf61f8VPwgV/W7Y/1q/4q+eKU9TQ+JjxGfQ/4 QK/rdsf61f8AFT8IFf1u2P8AWr/ir54rf7ET42F7Z4ZOlvBmOy6VLcN+qMp7KrP0 RCMXLU9gps7R+ECv63bH+tX/ABU/CBX9btj/AFq/4qwe6dhEwIEjEwyG5LagC4pe ZIVfNw04cKq+IbWYU/hLDDWMz3F545kJlzXn0rUl5tRUkLWoCwSs8q8qOK5JaX+/ sXst/wCECv63bH+tX/FVDx/2U9p8BxuThjjOCSCyU2dYbdKFBSQoEErB4Ecq320e 3EObDxxtvaUPxZMR5tiIFuXCikAHVIvfXqk2HfeyeU7b/wDqyV8kx+xRVJwqN019 f9Eos/u17SeJYV6pz7ynu17SeJYV6pz7yub0rIk6R7te0niWFeqc+8p7te0niWFe qc+8rm9KA6R7te0niWFeqc+8p7te0niWFeqc+8rm9KA6R7te0niWFeqc+8p7te0n iWFeqc+8rm9KA6R7te0niWFeqc+8p7te0niWFeqc+8rm9KA6R7te0niWFeqc+8p7 te0niWFeqc+8rm9KA6R7te0niWFeqc+8p7te0niWFeqc+8rm9KA6R7te0niWFeqc +8p7te0niWFeqc+8rm9KA6R7te0niWFeqc+8p7te0niWFeqc+8rm9KA6R7te0niW Feqc+8p7te0niWFeqc+8rm9KA6R7te0niWFeqc+8p7te0niWFeqc+8rm9KA6R7te 0niWFeqc+8p7te0niWFeqc+8rm9KA6R7te0niWFeqc+8p7te0niWFeqc+8rm9KA6 R7te0niWFeqc+8p7te0niWFeqc+8rm9KA6R7te0niWFeqc+8p7te0niWFeqc+8rm 9KA6R7te0niWFeqc+8p7te0niWFeqc+8rm9KA+wMWVJXiEKKxNfipkT3UOLZy5iA 0tVusCOKRyrP7SSv6w4r/wDo+6r3JYDk1L4SkrjSXXEZlWAJGTt7FmsvTJHYx88f bQFZdmrjZhIxfHAvItxKW0tKshNtVHci1yQLi6SToogG3tqZ0hDKmcX2gIcW0nrt sIyhxVkkhTYNiLq0voO3St4AkEkRYVypSybJ1UoWJ48SNCaAJBSRFhAp4WCdOtm7 f0gD5daA/VwXYcJe8xCXMzuJt0jJ1bBXDKlPG/O/Cqs/PxaI8HBEfktrddG7QOCE khPwbi+hvc3tpxq4l1b0ZW+S2QlVwEqv8FXGx7qhTJeFYcWkz50OMtxAWlLqim4s DpdWtsw9NAa9yQ+rB1yW2VIkGOXEtEXIXluE25m+laibiuKRorIiw35LmXMpam1a nrCxs2LAEJ5A2Og51vvbzZz/AIzhvrf/AJU9vNnP+M4b63/5UB4lrdaircZSVKQQ opAuVJBBUAO0i4HfatR7b4ozIXHVg77qwlCgsKsgqVa6QbW6tzrfl6N17ebOf8Zw 31v/AMqe3mzn/GcN9b/8qA8xXlyIyHXGFsqVchtfhAX0v2G1jblwrQDGsTZjBHQn ZElxta0BbakEFKG9LBOozLUL6aJ0uas0p9ptbzTSElbbWcqsoWJzDmf7NUTazaPE sPxRpqDJLTRYCiktpOuZQvqD2CqzmoK2WjFydI3zOMz1qQk4Q8kZElSllQIuoA8E anW+nLsOlbaI8uREaecaLS1pBLar3Sew3Arkn4b7RGcpoYj1QOG5b7P1asuysnaz aKU8pvFI4ZjrbLiXG0glKidBZHYk1ms0W6SLPE0XylSMZYzxnY2GWZmLR704s3Sl V+J4/Ua59G2jxHZ3aaVC2lkGYw00AExW06LOVQN7JNrEjz1pKajyVUG+D//Rv9K4 7N212lRJWprEgllS1FCSw3cJvoPB7KuuyGOzcV2YlSpj5dkoklCV5EpsmyDawFuZ rOGRSdIu4NFtpVL9ucXaxR/ey0qjahCAhNwdO7y862h2ka9r5SAHulqaIYXlTZC7 GxOvC9uRrSitFgpXO4+L7TploU/iTS2BfMkNoudP1e2tqztenC1l/F9+/HUMiUso TcK4g8RpYHnWc5uMHPS3XZck6d6st9KjYri8KFDQUtPB2QwVsqABCSRpe58nbVV9 vcS8Z/wJ+ysej6tdVDxIxaXzrf8ADZaeNxdWXOlUrEMcxRyIwmBKDT4Pvqltpsod 2hrfzNp8OXBkIiMSW5KmlBlakiyV26pPWOl7cjXUV0m2pVfwTaRpjDgjGA9Il5iS 40lIFuXMfVUlnafD0vul5mQponqAJFxr5aLdEUbelVTaTatOHwlsRt8iY62Sy5kS UpN+dz+41VMCxzbLH8YGGxcXYQ8UFeZ1lATYDuQT9FZyyJPT3LLG6s6tSo81ErD8 IgB5xKpmRKZDiOC1hIzEacL35CtTGx3pI3yS4GkmyklIuf8Ad60orRvqVzDaLbLF 4WNyREmKbiJy5G90gkXSL8R2351qWNuNpZUtlhrEgkuuBAzMN21Nh8GsnminRfw3 VnZaVDwnC8diSmo+MzY0ha15rtCwydngjW4NRWsQdb9kPE8LfWVQmY6VttJSOqoh s3vx+EefOruVVfcrpZtqVxjHds9q42I7qJiqW2y6tIBYbOl9OKTV62FxHGJ8WZ7c S0SXULTkUhCUgAg6aAdlIyUuA4tcltr5s9kv+cPF/wBdv9mmvpOvmz2S/wCcPF/1 2/2aasVKnSlKAUpSgFKUoBSlKAUpSgFKUoBSlKAUpSgFKUoBSlKAUpSgFKUoBSlK AUpSgFKUoBSlKA+x8SlNxESFuh0hTy0gNNKcN7pPBIJ5Vp/bmL8VO/7B/wDgrfvK UhUkpUUneL1Bt8JNRN+98a5840BTLPomKebm4jkLjpSgwpFkBaiofA1sTex0IATo KmRZTjM9Dz0vEnWkt5SgwXrKNzY23fG2XW/EH9I1kYxPaVDDDb6V71TjeddisBJs V8MvDha1+tpfKSfUXGdo3JqUPRMjRU2CSViwJOax11tbjYdX+0KA3+GzWpcaRu0P pykX3rC2+KF8MwF/NWTIo7XQ1hJyDDVgqtoCej2H0H0VmZcWuM7nWpVjpc3+Ausc 38en5Jv/ACJoDZykuLiPJZJS6W1BBSbEG2lr1XCxtQFN7l5DbKQrqKSFqsQbHMVm 69fBJKfB6x61Rmosd9zGJUtM95MVaMrUaS4ghO7STZKVpBOpPaaxyImFzdnfbPDl 4klpb7aWnVT3/fEF1KSpIz+CQTa9rjXsoDeQGsa6eyue8VNpaUlwNpQltSzlsQNV AWB5+ETxFq269W1AdhqsPQcHZxhrC1R8YMh4Zmyma+UqQPCXm3lgEmwN9bqTocwv OehswShhjeZAm/vjqnDxPNRJ+mgIUz844h8kPrXXOfZThyW9rIj7LLq2kQ0ZihBy 3zr4keauhOflEv8A5dH1rrQ7XbcNBSsLw1xl52QyChK21glRJ0voOVeb1s+oWbHH Eri71f0rf80u5vi002zlUHD3sRxY5t4wFJvcoJtYeaui7IzPwWRLTk6V0gIF75Mu XN5b+F9FVbDJ20OJ4+rCGoMZUgIKigGxtYHiVW51d5Wy2Mobw4xoedTgHTAp1HvZ 6t8uo/tdvCu2EYx3rghtsk4jtQqfhUiGmKWVupyh4O3KPoH11RJU9yB72uKuYtJs XVHVVxfsPkro0/Z/BcMcCpcuS3HSnM4vQkC/cmuf49jsKJi77WEvB+EnLu3HUKCl dUE30HO/KpytLe9yI29jWJ2hW4rKcEVxsNb/APjV12fwx/EsAkTsjkItv7vo+7PX 0T1uXb2cqp+EY3jWITR0aJGXu3E93E6cVd1dcfx6ZBguImtMtYmSFNMgEpUi41JB I/S58q87rsvVw0Ppo2rV/n6PbzfY0iob6igR4DmGY9KlOvKeC0lG6ULZdQb8T2dn OpO1O04W3CSzhQBQFhRQvj4PGyaltokYzi8hbzYClArIbNtbgczVHk7STWpLrTbT B3aynVJ5Hy16WtqC1bMyS32Nnhu2DsDEGpK8FW8lF7tlwgG4I/RPbVYxlUrafH5j 4begtOLLqWxdQTwFhw7a2zW0cxbVi2xvb6Jym311FxHa6XEjpLbccvZ7KSpCrDQ9 9UjNN03ZZrbY0uJTMTmS4icstKWLN+EohQB491dHwDZ9c7YJyaqcpMkOlIYKLrIz AX434d1UuFtbjGI4jEhRI0Rx6Q6hpKcpF1KIAFyq3E11TB4knCmULnthraJBJREz BTZSdLkgkeDc+FypJPS9Ct09uEQn5n//0rrgMFEDA4ZdZS8st2OZFiPrqFhOykXD YMqO5jDMhT3BakAFGlv0jUmTtJJRGaQwhlc4flDSkqsjyG/7zUXCtncIxRpxbUmS oIVY2IH1przvRs+pyRb6mNNN1+X2pcbU+/J0ZNK91nn8EI3/ABpr1Y/iqGvZ5lDi kjEmzYkXyDX/ABVPxPZaHGYIiuyFyLjqLUm1vQK8/gm23GZdfLyN4kHRaTra/ZXp mRU1pS4QXAFEcMwvRpKWHN40A2vhmQLH01cJWz+AQobsuRNloYaGZatDYeQJvVad wfFsTeMnZqKmbhTn4h9xaUKXbRVwopOigocBwqkpJEpWZ4LLmIrWh2apsIFwVm9/ pqbEwJ0Ya9P3iwWVH3jdnr6Dv7+zlWJLOzqWG47s+QnE2khMxkJOVtwCykg5bEBV xoT5a3EXbFDuFPuuqZTNSohpsNryqFhx+nnXnekc3VQhB9LG7e/7p/d9jTHGNvWc 9xjBTiE955bhYK8vULd7WAHaOyoC9mMxaKZmQt8w1x4d/dVl2nx2ArDVzm3wccWt IcjZFbsJ4XGn6IB8LnVbanbQOhlaYMYtLsSq/wAE8/CrqgoyS1r2u9b0+5Vt9mXf Z3H3cCgLjvNrmrU6XA6t0ggEAW1B7PpqZDablY/I2hVIS2qW1u+jnXJbKL5r6+B2 c6rdbRpjBzhrS3ZbyZhUd42B1QLm3wey3OujQqS8its0WM7JlMtsMyekdKcUCpDN 91cjXQnt7uFWrZTZNzY8S4K56p29yPB1TWS18wy2zH9G/HnWmwTaOTgkt5DyGENP rSEqUkqJSCddD31eBisfEpbgiuBxptCetlIOYlVxr3AV5jydSushBRrFT3/zttvx vuXajobb3MlfNnsl/wA4eL/rt/s019J182eyX/OHi/67f7NNemYFTpSlAKUpQClK UApSlAKUpQClKUApSlAKUpYnzUApSlAKUpQClKUApSlAKUpQClKUApSlAKUpQH2R iESLLTIRLisyW0vLUEPJzJvdIvbzmtV7TYL/AMDw3/txUnHnJedqNCUtL8qY42Ch SU8ElZuVJUPgdla5GDbSFaQuS8lJOpEhk2HqKAiX2fRIeae2fw9vdkm+4GiAcpWb 20vbhfj3G2OBJ2axGV0drZ6MF7xTZzQrBCgLkK/RNwof3T3V6j4TikxTr0NxxaEv qG8WthKitJKc1twdeOt69PYRiWGxOkPuuM5FJbZDSmDqshNr7kZRw9FAWPD4UKHG kdDgxouYjNuGwnNZC7X+n01mlNrW8ChClWaavYXt1BUTCYeJxI0n2xcWvMU5MziF 2shd/BQm3LjfzVlxWfDhBPS5bEfOhnLvXAjNZsXtfjxFAeYeGi2JImsh1iYtJLZS rVIQlJB07vRWadAS9hzsWI0louSEPquldireJWo8OJsfPWhl45hq4T6Y+LwUvFtQ bPSUCyrac+2tPHxmS044Xsbw126yU2kNhJAQBY63F1AHThmX/ZAA6GpLK5bcpTF3 20KbQvKq6UqKSocOZQn0VGmpW66FpbWQE2PVPae6qph2Nspcf6fjWGrT1d3u3UJH O5BzXN9OIFjfiLVMfx3CCw4BisEkpNgJCOzy0BmUtLjslaFBSFRkFKkm4I6+ori2 1Zebxlh5heRxDIyq5g5lV17Dfzcj/p7P1KrkO1YBxpi6re8DT+8qqZHUS8OSzbFY lEwdMfHcRacekKStC3WwCs3JA4kDgBVq202imhjA3cJkvRUzUqVbQEghBTfjwzVy bC5/Q5YCxvGwk9UqsKuO0i5kuHs9L6A+01Hb3iOqSl1NkHQ24ad/GsnPVF7miVMu TWFYnO2Ym4diMpuRib5KWX1KJShNhYE2vxCuR41y/FsEdwfEncPmlp2Q1bOpskpN wCLXAPAjlXR3doF7SbE4nibUVUN9nM0hhDmZSrBJuDYH4VuHKqlJ2mDOyEKK7hm+ nIeJcUtfvpF1kXGW9rEfRTJFSpJ/cRdbkZDaMOm4d0RIZ3zid5l+FYjj6TXScebQ 7tbDQtIUkx9Qf79cZwGBiWJ4qJCI8tTTD6FrIbUpLaSq+p5DQ+iuyTHY2MbYQhCl tPILBSXGVhYBAWbaHj9taYnbZE1siI3h70nEnmMNUhh5IJKlEgFOmmgPMiuTYlgs vDpb65DrS87iz1CTwOvEDtrvj8WLhjYdlTmYwJybx0hFzxtcnu+iuM7NPTE7Synm sOfxRhExCllCStKE5ydTYgAi/oplp0iImOJieAo2WcgLw9w40pd25WQZUpzA2vmv 4II4c6rOIRC5daspBVzrqwaTi3slRHlYYITKmyC2W7pFm1a8AK1e2WxuHxJb+IHa CMjfP5ejZEp3dwT+n3dnOsXjk3a7bF00lRSti8Cly8YivxnGUOMzGihSlEEHMCCN K7oiC+08HcRWh+aP6YEnTkOArkWFTkO7Y4AmPlShuawlW7Vov3xOptXa8Xeacmqb 3iELKR1cwvW+Np3RSSoo+IyhFxWSo5usq3VrfpZk4Y6h+M6GorZDj7aDqsDU/RVO 2keMea5lSXLuEaHurp63RiGB4izJYEFLjK0F1zggFJBVqBw41oypijuJxprpkYFD ZOWzmhuPJesO0uGYziMCIxhU1uO40euVqIBFraWBqmQOkYFiQjwnHcVhhJIlMk7s qPLTMLjy1eoe0WGBhvp0+HCVkFw/ISk5rajUjUVW1OO5PDK7im1mCYdFXFxSHJkN PJuUoQkgjsN1CsWBTnYobx+C4pjZhwKQxAH4xCr5ScvDwwo+Fz81S8QThmMYFNjx pMR6QtGVtLZStZPcAb1o9i97D2jRgclpeVlpRKXAQNRm8A8ONUb9pXwWXGxvsPwa H7Yy8Ulx23Wpyi82PhDMc2vK+vaa1EKHHOPw45aTulkZkcjxqbiG3z2BT5DLuzji mUOqabcW6UJWEkgEdS3Co+1zJhYk2G12O4CgpIy26yqspx3rsQottJ9z/9PJtPhu Hp2jlMJioCRksLaeAmtVmLXvaDlQnqpA5AV+LcWtZWtalKPFRNzX6pxtxIyLSooH Xym+Xy9nOuZy1J1serHFHHJXvZkbfsnr3JvWdKgtIUOBqAypD5GRaVC9rpN6loUE HdkjTmTV8U334MuoxR/k55+xXNrX5DMzCgy6UBTiswHPVFdO2XYUmPIfJGVawgDn dIuf8wqquIZWUl1LaiPBzAH0VZ9lirLKGuW6Ldl9f9K2OFrYsNfNnsl/zh4v+u3+ zTX0nXzZ7Jf84eL/AK7f7NNCpU6UpQClKUApSlAKUpQClKUApSlAKUrpfsT7HwMb cmYrirDciNEsltpxdkqXobqHMcO7tvQFc2W2ExbahaXGmixD5yHAbK1tZPabg+g9 ldUjbC7N4RhDra4jU5SkWdU64bAC5LmYA8O7ha1rg1cJshbEeSCh1uHHYUpKmUAA JSCSkJ4XF0gDh1R21SMImvuyHXMeIntr1abUBla42Vu/Aza9/l0rJu2Sk2rRSto/ Y3MeGMS2flCbFKC4tgqGdAvbqnQOagiwF+Ghrn9d2w7GxKk423IcZXIad3bS46VN KSk+DcgJzIFlEBV9eVtapO1+EKlYXIxV1tk4gw4lb7rKAhLrSjlzECwzBakjQfC4 nlZS7MU3uc/pSlXIFKUoBSlKAUpSgFKUoBSlKAUpSgPsOchSsdwspSSE4g8VEDgN y4LnzkemvzA8AdwqfJkLcbcD4OVCQfeOupWRu/BGoNv0r8soTJksrdeeyuJSA84d UA8xzKh3VH6Mrxhv5if46AgR8IXiezr7CVKjyUznXWHgVJU2c5GZJFiLpKk3HJR7 anY9ERHwCPFiMBDLL0dDbbadEpStNgB2AD6K/ejK8Yb+Yn+OnRleMN/MT/HQElUZ 9uXPkOBgNPFAb3abKOVtdys2uTc6a2sBoNbpKstyAknIyLlIP9H31+MtFuM7dxK7 nkALdRfYo1gxOGxLyl9UkBCGrBiStri2OOUi/CgIs+bIjxFOMNNrdzJSlO6SeKgO Gnb2jyitOramU3uUqgNlR0XcJSUndlQzCxCddDckDKvU5bnYLwrDkIUsnEyEi5y4 i+T5gDc1AC8B6OXnHsSbSE5jfEnlAC9hqlRBuQeBPA9hsBmwraORiLrLa8P3O9bU 5chF0DMQApJAN7AX7Mye2tu9IWlhwgIBCSR72ns8laWGnAcQedaiypzjjROZIxN6 41tfwtR9o7RUp3CcPSytR9sTZJNjiT2v+KgMEBanIIWtRUtUBkqUo3JNlamuR7WN tdNS6Sd4lkZfnGuuQFBUEKCQgGAyQlN7DRWgvrXINp32xj8aOtJOdlOnLwlVnl90 vje5qGWFusJcCbk99dl2bZk4ts2lraNAQxFiNpw8tkAqSUa3y35JRxtVH2EgRsR2 wTAfZQ5H3K1btXC9ga6Hld2XE9OKKD8WRmEBtjrblCb6G9raKTwvwrLCnersazrg rcFMtmA5hmGIC1PqJShRFyogDifJXpmHstGdMbad92PjCB/KGkZ1BN9U6pBHglJ0 POq7+ESmMVYejrebSix0AvfXvqPigkYhiDuNPOZ0SLJGY9e4AGvL4PbSco17Pb92 Ip3uWbYLH8Cw+Vi8SXLLbctbbTI3ayVi6xyGnhDj21vMSwpWzOOMNbMNlUgtbxCX VA3UcwV4Vh4Ir1sZ7HjMNp+ZirEOTnDbrBSVEotcniBrqPRUnHsZi4dtJFxF9t1T DLFlJQAVG5UNLm3EjnWmONQ9rYrJ3LY/drsK2hx7YvD0piJcxLfpcfQFoSB1Vg8T bmOdQthdn8R2bbxJM+NuFSw2EAuJXmIzX8Em3hCrHL2yw+FgMXFHGZRjPqCUISlO YEgnUZrcjzrPikglqHNSVBhKS8tPwinQ28tqsoxctSe5FuqKpi8h6Bj4fbsHEIFr i/EEfvqsCfgOL49LZ2tkqahgFaC0hd97cADqgngVV0CPh7eP4s3iyUIMCxQpp3RR IBHAXHEjnXMNrYkTENpcQwvDGEsSWHs61r0SUgWIBFzxI5VOROtiImjwBsRds8Py aMe2LRZJ1ujeCx9FdR2hnSjtJaNlUvdiwI7j21y/Z5h6VtThaUrT71NaQrMePXHC ukY3LZw3bZtEpClhLYJCBfik9tqph7lplb2gkOoCFv2S6pZzac7Vatu8exyJNiYL EDX/APJNlnIUi6io5LA3sONaHF+jz3i6GvelKulKhqKweylOks45hTzTykyG2ypp Y4pUFXB9NXye6VjybXY0Yrhu0SMAxxpLEUNKdKQUqVc6jVJNaTE0RcY2hxOG4oqZ jSXQ3luDbOQL+atvsVtXAXHQ5jbMmZjN1AysqTdHIXuPqqvY5iURvFZb8Fpxlbsh xSjYAkFRPbWNpRW+xfuW/AcK3GFTZGFoK8VbUDFSpQsVW5309JqDs45tAv2S3VYs y2ieWTvUpKbDqJtwJHC1WjajD5UCKpzBHEQyGyTlJF1X48DUaC8zg+ykfaHE0F/F FKKHZTYutXXKRxt8EAeatJxSquEVTLFiezMDG2WxPQ4Sk5+ou3WPGq1t1+dG/wDl h/mVW4xMYvjuDwHsCmiItaEurLqikqSpIIGgOtarb4pVizZQLDoyf8yqs632Jh70 fqUOe+uPFLjds1wNRWoiznm3lhJT7+oZ9O//AFNbLFvyE/rCo+DMNOtSluIClNpB STyOv2VyRTcqR19U/ao3TMJmE0oMgjXNqb614Wu5zK51AwzFC4joz6nFvOL6qjaw Fh/rUt0FLhSTwq2SSq48DBPTF3z+h+l1TikBXI6Vdtl/xMj9YfUaowNlA99XfZNw OxpKk3tnA18lWwSu75OfMtiw182eyX/OHi/67f7NNfSdfNnsl/zh4v8Art/s010n Mf/U+f6UpQClKUApSlAKUpQClKUApSlAK73sS8NmsDg4SI5cnOrC3UqACVKWAUt5 r8cqgokiwF9Dy5FsdhaMW2niMvKyxmjv31/ooRqfpsPPXa9m4jkvCXcRdMyA9Mdk KQ2MxSM4CULyEjXKcqfSTwrObfCJVdzxisyTDwOO05nbQ8lUnKOqrdqJVlUPKToe zhVUi4pv5e7KMqTfKefnrfbQsvTTIDQCg0lKFOEWGqlcePYoA87XFgRVdiYa7Hf3 q1IISDoknst2VzSbs9HHcYR08dye2WW33loaQkvEFSgmxJA59tQpUoSVSMOWkpbe QWicxF7jnblwqRWF7DlPvpfQ7uzYcrm4/wBio1SbspiunGKOTOIU04ptYspJKSO8 V5qz7eYI9gm0q0PJCektpkAAadbj9INViu1O1ZwyVNoUpSpIFKUoBSlKAUpSgFKU oBSlKA+yJ76Y6ZClNvLu6sWZZW6fCTySCbd9UmVEkJU27DGIJc6S466Pa59BWhaw cuYN3Fk3F9SL6Vb8cktxcPxBS5LUZai6hpbrgQM5Itqapy8XddS5lxuC0lanigdK azIBSd3zOtzY8RoPLQEh9qWtYcQ7ialbxK1pOHyUBYCAk2IR1L9a9hzHZXktYlqr puKqc3RSFHDpAGcrJzZQi3gHLbla/HWkvGVPwD0fG8ObkJeXlvIQkKQEqSL6nibK 04XHZXg43IWHbY1hiNOp7+0dcqr214ZrWvrY660BvtmWpTUaf0l6U5mUjL0iO41Y BtY0zpFzYC5Hn467DFROWpCYZCAW2ypTkRboNkDhZSe/trXbNT5M1ufvpcOQhIas I7iVZVFDmbgeBsONtc3IA1vJKstyAknIyLlIP9H30BoTHxpSSlT8cgixBwx3X/8A ZUP2inG5UplRUBmK4D6iqxuCSXdSOROoGnCt1OmPxsPkvstNOOttKWhCkABSgCQC QD9VaeNtPLflraOFqSm6SgqQkdVSkpBOnHrXsOAB40B6i4RiMHN0ZUdsK4gYa9b0 bzTl6B2VIXGxtaFIMhiyhY2w137ysuG405iC1joobShCVZylJBKr6DTiLWPYdNbV NekLSw4QEAhJI97T2eSgNYxHMRtyOc92obaLqQUk2zi9jXI9o2ZEnGWI8Zhx51bQ CUNpKlKN1aADjXWIC1OQQtaipaoDJUpRuSbK1NcykzJMLbrC3mMvUSlVyL63VVJq 1ReHJdoUR2R7FMHA3W3G56HFKXFKTvkjerVqjiNCDw4EVlY2OgTIcd5nElOS4DaV OR28qlJWADkUBqDdJFuPGtvs5iOF4li6VKfKscUhRcbCVBNhoOVvBtzqThvtPFk7 QvYS6tU1K1KmBQVZLgKzpcAcc3C9Q4x4/exe2UDGE4rtLtFEfxfC5GGQw2GnpC2l JQ2kFRzFSgAOPOo8XCW29p5cPB3VYky20Cl1gbzMDlJPVvwJtUDHfZFxibBfw+S8 xuX27LAZsbX7fNWz2QedZwCLI2Rs/tKoLTKac0SljOdRnsm9w3wN9fLWMaclJFt6 aZtx7J+MNqTEcwNCC2d2jNnBXbThbjwra4Pic3FdrYT+KQlYe4lCkBDiSm6cqiD1 u8keatDi0nZ92Zhy0SVmWhy8oZV2Su6b8rcb8KtOIvtTMWZxmOrPh7De6cdsRlVr pY6nwk8BzrRTUXcpquF9WVa2pIsjmIsMyFpdeZbaGiXFrABPlqkSZcubjUIiGvI3 IFlJSSCCoa/RWSXNjG7uLubvC1K94cSk3K+WgueGbiK3Dj+GxZWFpYdPv60hFwrX VNuXfW9q6KG9Yiq3PTFBQcSbZLeb99fPu2WWVtxizTqg0EvE377D7a7a/Ox9O1bU Rlps4QpF1qOXNfKT23425Vwvbxt1O2eKrSnrGQb691Y5XaLxW5ekRcIjYvgMiLi8 eRulMrWEuoISQoGxsdK2ePzmZW16ZCXWi3uwMyVgp8E865pgDW82gwlpIvGclMpk HmAVgG3mvXQtpcMiRcRWmAFFkISQVHnz41OGWq2RJUYTDTiMp3Ks5Qbgo1vUT2UG 14nimHlaFIYS0pLjoGiElWpJ4Cw1rZwGJGGRW5UhG7ZfTZCrg38wqq+yHieMR0pj vpbSl2OsEWB0Oh4Gpc4Tjadr5EJNM23sbPQ4G0DeHRpjL7QbWveBwHXs0re4t7HO Bu4hJxDENoOhiW8t0bxSEpuolVgSdeNc02DwbaNptGO4bDSqPdbQdU4i1+YylV/o rruNLwKXgOFp2mfW04lCSQ2FfjMozDqg1V7p2SlwbXF0p2gZMJ5W5Dqcl06n6a0C 8Cw/Z6OG4eIplz2zYxMyd4AdblI14EGt1OjzWIri4bYOIBN2EkixPnNvTWjw4QV4 uXcTWpG1JSekMpvlCbdWxHV8DKdDV5OpILgmY7DwfH8Hw9nEMYjwVspCikuoBCso BSQTpatZthMizsQQ7EksyGwwElbTgWAcytLjnqKx7a4XhMeJFkOKcS484SrUkXIu eVaTB8Fn+078hUf3hDhzqzp00HK96zyZIwl7TSvbnv2/8Lw7PyIL0QS2t2tRQkm+ a1ajEOkPbuOI6yiPdCVhJOYaC/0V0b8Hm5GyTMqK0tctazcZwBbMRz8lVV1tbLq2 nBZaFFKh2EVnOLiqOuMY53qsr0KO+iY0pTLgAVqSk1Yke/e8nQJ1v/vy15TbMM3D nX4pZadUpvgdNapH2d3wMmPTHSvqYiLEjsq5bGfkMn5UfVVTW2lwXa1I1V3VbNjP yGT8qPqq2KNTObK7gWavmz2S/wCcPF/12/2aa+k6+bPZL/nDxf8AXb/ZprrOUqdK UoBSlKAUpSgFKUoD/9X5/pSlAKUpQFo9j+YzH2qbiyQsx8RZcgryaK98Fk2PI5st dTexyQ1s7h0eQ6ESWkqblhAuUrbWQnNbgRlHnsew1wZtxbTqHG1FK0EKSRyI4V26 OpjE4LeKRFIImRxMWjioOZsjyb9iVZeP6WlZZU6tG2DT4i1A426qEmMrEP5PxCC5 oahKnxU3u8nTs1rWysLcS9aOgqQRfUjQ9la8gpJB4jQ1yts7pZZQ200b3p0E/wBJ /hVWROIxFGweHnBFV2s8aKuU5kToOaiNKiysc0rqKRoNtsRbmYgwwyQpLKLk5bG5 /wBAKq9SJzu/nvuXuCs2Pdy+io9d0FUUjgyTc5OTFKUqxQUpSgFKUoBSlKAUpSgF KUoD7Nfy55ClICrOuEA3/ST2VEDgU4EBhrUX1Uq/EDt7VCs2IMLkJkIRLei2eWSt lKFKIunTrAj/AOq0j0dMdaEO7QYkkuAge8MHTS9+poLkcdOFAbRDyXEpUmMnKoAg 3PAgkfC/sn0V+F8JSklho3Tm6pVp6ba1q1hptLpXtPOSGdHLoj9Xu8D+19Nfi22W 2d4raWehsIz3LTAAAOnwO0+mgN/HXvIrp3JbGbTQ69VfaawYnAbmqTvXnW0oba/F vuN3JbH6BF+HOvzDWwiLJy4k/MG8sd4lsBCgldwMgGvbfsr1ibz7WUMQJMslDRO4 ydWzY45lDt+igNZ7TYfr/LpOhsf5fI7bfpdulDg2HgEmdJsAT+XyOXH4XKtRKwV+ UtSzguLJWVqV4TNrK1KDZwXTmJPEcTrSDg8qE5c4PiryNy40UOFk3CyCQSXbkdXT vUo3N6A3AwOESQJkokGx/l0jT/FX4rBIG6KzMlKRlvpOkEEfOrUKwaUt5txzCMXW QlIXdbXvhC8xv77YhXAgjgE9lqzYfCn4bGdaRg2IqCmkI1DIAypy3/Gnu8gA7yQJ kZTSmFKjpKGTCaLaVcQmy7A+amO7OQkzEYumLEDcZsXbDIubE8NO+vEBJRBCDYlM BkHKQRwVwI0NVbE8efxra/D4SoyUB5CUFSCSRqqvP6vDmn1GKeOVJXffmtq/O/Y2 xtKLTJGJTGnWFKwtn2vmkj+Us2Qu3MZk2NY9lJi8CbxvpylzHcRAssquUnr3JJ43 z/RX5tIWRDXgDryGw0pKsylAK162o89c7W2vDpDwKFbtayG1rFgsA8R28RXVkai7 SsK2qZvV4K2wekSEMvJb1KVIBuOzWrBse2MSxV2LhYGHuIYKy42Mt05k3HV7yD5q 56SuVNbQEm6tAEi9XvZDBp+Fu+2jEKU8XmlNZdyrLbMNbgf2apib1VFUiZcWzc4t s63gsiM7ISw+XVlRs3qbEE3v23q0sYph69npMtGHITGQ4ErYyJso9XW1rcx6K8YT Cg4W4t2fPbiOSClTaJC0t5iL3Ava9rj0isG0Ukr2shutALIj2sk35rrHrvR2Pq9N utLXH+1+ewhkcCnY9ibThUsskxS572wbZUaHgOA5+mprjMgP4alUhRU8pIZVmPvR JTYjs4jh2VK2ukOw8FYlbolS3wkpUCLdVR/dTDUxm5cB+LIRITvELkFCgQyLg9Yj hz49ldkEoPQnwkVdtWeHHcSRtS1gxxGQX1ozB7eqsOqT235VVsZlxGMclxZcREmQ 2uy3lpCis9tzrXTTtStW2DGEsstOQnEEmUlVwDlJtcacQB56ovsmYBHSlzEoMpUu W/LAcjN2UUJKVXNhrxAHnqJOVOvMlJXuazCpMSTicSPHiIZcdfQhDgSBlUVAA6dl W99BwXHUJxA9NQhN1JVqFXBtx7DWtlx3cVxDAWcQbXCXZpptK0lJWCQLgHjXnayM 9hrr2CsNOPBSUrCspzcb8B5Kjw9cZQnw9vIhtJpo6Kx0KdhkZ1UJosqF0NqQkhHk FcqxdxpyG9KnNCWGGlKs6As2AuQL1bPY7QtovIcQpCwyAUqFiNa557IG0OMSsZw2 VNwZyKthOZKVoWnMAq/MVydF0MOii4xduT/X7+f3LTm57s2ex+L+3LaIOHByCwcy g0lWVAI4mydL1d3NjZc5lvpE5t1NsyUuAqt6aq2yuMsP4GnFnHWETt4pvom8F8vb bjU7HMdcxiJHYLKEhk3ugk30tXc3Sd7jHDXJLgyYrIxHDHmg5iMhxShcEOq0+mtQ ZyjMVLKlmSoWL2brnS3hceArVy3ZTC0hqKtwEakJJtXpUtyNhyZS28rxNi2rS2tY +JJvyOlwwwVcs2rspeIJCJK1vJRqkOqzAeS9dBh4lAewGVKbgIbjtqIWyEpso2HL hzHorjbmPuuAAsIFu81OjTlOYRIkFABQoi1+4fbXF1vSQ61RjJ1p3v8AT/3sUi4x 3W19v/SzYjjLq33FRFvRoptkYQspSnTWwGnG589ahTSnll1S7lZzEnU61oEY46hV wyg+c1tUyYzkcOmQ0HVJzZM4vcjhXXDToUFwtuf1LRlGDdS+9foSejH9IV+dGJ+E PRWjcxSQyrK7GyKIvZVwa9onzHEBbcJSkngUpJBqNUfhNPFfx/0Ns0d2VpOubSrh slHLOHPKKgczxHoA+2qm1iUdgId3zO8RZWQrHEa2q7bPbRubS4auW8y2ytt4t5EK vpZJvr5T6KXKGWEErTve+Pt8zlySjKLaVG2r5s9kv+cPF/12/wBmmvpOvmz2S/5w 8X/Xb/ZprrOYqdKUoBSlKAUpSgFKUoBSlKAUpSgMsaM/MktRozS3n3VBDbaBdSie AArruHxzsVgDTE2ct2QypQdDSgUMFzKpTKCPCWciSTfKm1+Nr1/2OUGBg20OOti0 qMylmO4E3UgrzZiDyNrajlev3FES5u6KiN22jK23qAL6kgniSSST3+QVnJ26JSJr e1cN1Ti3WnmlKWpQGiwASSBfTkewcK9K2lw0iyt4R8neqsqMoKILagfJXgtDtNV8 OB1R6rKlR//W5+vFcGaIVeW4oG+XKNaxS9q35DDjMSKlkKSUhajci44gaVqCwCRw PlFS2MNdctZFgeavsrFY4I38bJwtipLQptZQoWI415qybR4SYkRmURqV5FE+Qkae Y1W62MBSlKAUpSgFKUoBSlKAUpSgFKUoD7IxAygmR0Rll1wvLuHnt2kC6db5T3aW qvzsNxPEUoTIhYeUpJ6oxEi9+V91cea301v8SlNxESFuh0hTy0gNNKcN7pPBIJ5V XcSxBiZAcYbbmhSik9aA9Y2UCQfezxtbgePA0BEVsxLWHc8SIpTufOo4mbnPov8A orai47r6W0r07s1JdRlOHwR70WrjEzfIUhJH4vmL/OJ461gDi9+yvfT2220JQG0Q 3wEpzIKgLNgG4SRwFs2lrCo75nv5SZ88ZSi2SFISdE2VruzYq7bG16AtmA4e7h0C U0uNFYQpwKSGH95c5FDXqJ4AJFzcnmalYrPhwgnpctiPnQzl3rgRms2L2vx4iseE y0SYLyUmQpTeUKW9HW1mORevWSL8OXCpslWW5ASTkZFykH+j76A0JxzBypN8Vg5d b/ypI5G3A9tq8KxrCgklOOQirrWu8gAa6c9eX09wrw5tFJZey9EbfCn1NWaQlJas ogZr6EqAuBpe4HMGoje18xSUKVhGhQq4u2DmBSOfg8TYHU3R+lQGyGN4MFqvjUEp 04yEdir+a9vNXh/HcILDgGKwSSk2AkI7PLXmdtBIhTHmhFbfCQMqUJQDy1Uomw4k AEC5sATc2nsz3X8MS+UtocUyFqSEJ6pKb24d9Aa3Dfzcj/p7P1KqhRXgz7ImDrV4 Iyk28qqv8BanIIWtRUtUBkqUo3JNlamtJs9iuEtY7DwqVhDMidIcu1LW2glsHQC5 F+IPDtqslaLRJHshYLh/tK9tG2lzpDzqEFRVpYdXh/drneHhGNoeE65bhgBvJoQD e9+3wRVu9kKY9hWMTd+64/hqVNhMLOd2CUJ1CT1eNzw51zadjKcScbThaF4eEEh3 dqy7y9rXy8bWPHtrNxSk5PY0t1RZoWHwHkdLgBzetqsnOdL/AOzXSsLextWxsFrC tx7YJcUXN5bLkzL4d+qa5xsQ2pvafDozyt6yt+62zqlQtzB0PCuiL2jj4Jt1iEYR VGMhlIQy2QlCSUoNwOA5+mmOUZK+OwkmjbYjs8McTEdxRN3oozI3a7DMbX+lIrUz RudqImf4k8P71TvwoRPVZll1rKdetxv5PJWqmSQdoYzqwVANWsf71bpJFLJW1GBY jj2Bx2YKWyQ8HOurLplUP31VdhsqDjLL9921kS/bjYZwbfTU3aLCdoG44xKJtBJj xn3QG2G3nE5AQdNDblXjY/Z+Spcx7pYypKFPJ199HWJB7efHtrHS3kUqL37NWfiW 5bu2TCMCydBKDbfeFmyG9Z9pEIbipRGv7bh0dIzeBaxvbz5axtzEwvZVhxm0lLW6 UciDZP4tfKro1hLMrEnpTrTK0uAkJWgG3Crx9q0Ve1GohYRic2Zhs3aINGRGU2qI WFWGUEHrW7wK1m2chxraovJIzhpNtO414wfFJeIypUsypG5w6RYtKcJzJSb2HICw tW/WuHjqDLMNsKV1buICjp31aKSWwbsh7Ey2xMlOySbrbHgjneueeyCraDpUZO0H R9+WVBnc2ta/Pz10bAYQVjM9pvKhKALACw41pfZRwVzFMTw9xDyUBDKgQocetVck W1sI1e5UdkYkKThSWEBfttnUdT1Mn21t92qI6tLvEHKba6itjs7se/F2fTiCZLQX vFIzJSQr01m9kKGI2z2EKj5Wn1H311sZVLOQXJI1OuutZ6dMdb5N45dtHY1O/R2n 0VHkxBNSQoXQTfjat1iOzT2HYLLxNchtaIyMxQAbqqrwcUEwJyJWgEE6mqzm+Jo3 hDGv/m9/mfhwiKCQQrT+1UkQ0t4TIYYHhEnU89K2CEJKEkpBJHG1XuPsohrBJMNY jqkOqJQ9u9U6Dnx5H01xdZ1eLoVGWR+9x+r+1kXHL7KVUca9qZXYn51ZW8HltqS6 pKMqSFHrcqt8/Dfaya5DcUhxbdrqA43AP76hKZWq4z9U8u6urHCM4LJHdNWjOXht uKdV5mnlS8JmOhx4ulQTl0FtP9mvDkuRDiociFIhFWVvMLqvre/nBrZKw5hKSdyz p/YFEIZCA2tpCmxwQUiwPkqzck/a2JWDVG4Oyro99kJzfDVr5zXVNjIzcOPLZaBC M6V6m+pBH7hVHZ2ddcmNlLzaQpwWFjprXTsNwlzCH32XHUuFaUKukW5qFVxzjDIs cvefH25OeabVo2NfNnsl/wA4eL/rt/s019J182eyX/OHi/67f7NNdZiVOlKUApSl AKUpQClKUApSlAKUpQHW8ChS4vsWQ0MOKS5iE3VpCLl1KrixPL8WNfIKryMRxCEp SH0JlMhRBv4SeVr/AP3V6G0zeD7F4U5Fir3UWK250kJF0uFkICNdbFSgokdwqVhO zEV7DsJiSoLiELSkqLnVWp4he8B5psQn0C4rC5ariy6aS3KGnGsKWLqDzZ5gp4Vl E/CHOqJhv/aSQPpFatRPXSttJdS+poJt2f61fE+xYXYrK+mMIcUwh5aFMZcpUL5Q QdbdulT4ku8SWoruVcyMKQkudKbITyTxPkqMnEps5wNYZG3YWcqVZcy1eQf/AHVt Y9iaS7iCm+lRA00oJU4MxPlCbWPHtq54Ng2HYBhzi4zILpStKpC+spSTYDXl5BU6 5P3VRDcV3s4TjcN1piQJrjxlNLyKDuhQoX0sfIaq9dU9kdoN7XiU0N2w+01JWlOi ikIST5zr6a5a6jdurbzJVlURmTextzF6nHxuRI80pStCopSlAf/X+f6UpQClKUAp SlAKUpQH2ZIaaW6+pwK6rqzopXaBwCh21G3cTsc9K/46y4gZATI6M2ytZdXcPOlA AunmEqPZyrVZsV8Xw3/vHPuaAyt4jgrqwhuUlSigOWDivBJIB8PtSoeY9lZ0u4at zIl3Mv8ARDiieF/0+zWq0nZgoczphQAchRbpztrFOUn8Tx/fUxjC5keaZbcXD95l KUgzHLIBOY2957ST5yOGlAWVlLSYzu6Chrrcn9BfaTWuxOKqc4gOPOISlCLBp1xv gkDXKoXqTh5lmNI6U3GRqMu4eU5fqLvfMhNvpo94Y/UT/lFAaf2kb8Zl/wDeP/eU 9pG/GZf/AHj/AN5W0pQGr9pG/GZf/eP/AHlDgjRBBkSiDxBlv/eVtKUBBRHEdt5C bZUx0oSADokZrcSaybUYO3JZcxEuqStlnKEAaGxJ/fXp7/3HyQ/8qhTX8Txya27h zyTgYSG5TawkKUq5JtpfgU8DXkekMXUT6nBLBtV2/l7O33N8LjpkpHNMT2aZxOS4 8uQ4grtoANLAD91eYGy7MCQ08mS4otrSoApGtjevzbXGHMGxqXEhulpLZRlTlCrX QCdTftrRYZjuNYnJSyxLBJWlPWbQOJsOVek3Dd0Vp8HSMTxBeJ7QRcXWhKHI6AgN g6GxUf8AyryzNUzj8nFggFx9sNls8B4P8NBsTtg3Pa3qo3R/hgLTr9Fe8ZwqTgMN EqcEhpbgbGRWY3IJ/castLWpqg74M87E14y9FbcbS2EKy3Sb8bfZVwa2daawV/DQ +soeWFldhceD/DXNMKxWNMk5miohlaSu6bc/9K6k3jsJ3DXcQSpe4aVkUcut9OXn FfO/8gn1P/V4F1fbztUb4FHfUU6TsIrFZjsKQ4+zFbOdt8JBzkaW+k+itVGwZ/Ze SVLbWUrWCguC2bKe7yirTG2rAxeQqQ+swSk7pIbFwbi3f21X8TxSTibo37u8Q2pW 76oFgfIO4V1dD6wl1F9Qlppefl2258/6FZ+Go1EtOD4lOxJKGVQgmIsnM+DwI1+s AVpprErBMblT+jqUy6S2lStAb2P7qx4Fjr2HSGmnXiIQKitAQCbkHna/G1bWRj2F Yg8pqfvHYgOZCcpFlcBwseBNbqXX/wAdTS8Ovn5/T3vlxRX/AK9HzPCtupKkpHQm eqLeEa1qXDtNtC0Hhud6kpOTW2VJPPyVV46cQGKhT60mFvwSkWvu83DhfhVpiI9r MYa2hAy4AwCl0DVeYpKdBx8JSedd2eU3ikse0qdPydbP6IpFK1ZaZWzrUrDYsJT6 0pj8FAC5rkWM7PNYxJYfcfW2WRYBIBvreu1NTBicJmZhyjuXRmTmFjbz1zbaExnJ 8Q4IktxgPfwu9zr/AGr8q8f0HDqI4pvNLUm3VedvV2XLNc2ltJbGLDsIg4ds6Cia VyQ4feiOR51jrBMmMwI5ffJCAQNBetd+E+G/pOfMr3HB9nRjfmXeNsxKdw+Q8826 2+j8W1YdetK/HdivKZfQUOJtdJ4jS9SsL2m2jTs3iaMRnBeLKt0JaWm7J8tk29IN a1iRiMtlL+LOh2cq+9WAkA20GiQBwtXndA+u8Sa6mtPar+XG3HPzs0yaKWkvGz0a U+0BIYU0yGkltf6f+xU3GsPhJ2XxCLNmGPEcQd6+R4A01+iqnsptHisSfLbxuVnw 9KcsNCG03SAdL2APg24k1Bak7S4hsZiT20EpEiGkqS8EpQklFkm3VAPE15PWYPSG fO45ZqME415Pyrbd/qaQlCMbStlbj7LYXExlWIYZii5scpyocyiytAD6CCK2qmEI QVKWQlIuT2CtRExzBoMVEaMHEMovlTlJtc34k9prN+EWGP8AvJLhDnVtkOt9K+lh hSik92lyZxzTj7roJxvB0qB9sWtO+s34RYR4+z6awfgngniX/wC1f21ocR2PeVPd MFhtMbTIC4b8Bfj33q6jp4M55JzdyOm7G7W4BHdktPYpHQt5TaW0knrHrcPSKvE5 xBkBoKGdKAop7ASbfUfRXzaMBl4bicHeJQlbjyd2Qq+oI+0V3mGjEUYjJ9s1pW+W m8pTbwbr7B23rx5dDGPpNdTq3ae3fZJbfqX8RvFpaNhXzZ7Jf84eL/rt/s019J18 2eyX/OHi/wCu3+zTXsmBU6UpQClKUApSlAKUpQClKUApSlAdSwSZKd9jItsokTW0 pcbeaFylnKoLCzfhYI0PK/dVt2Y2mg4xijbzSxEaBU/IjlSlqCzYlXbxB4aW9A5f sRtl+DnTYE1CncLntKbdSkAlCiCAoX4jWxH2CsbjbsN5ubCdsfCQtPAj/fKs9PcW eYCX1SWpchxS98ta1AiwCtbns419CYlI6BtCiM6vMwpAQ2lAuUpSkcefGuCQ9o3o TzbgwuAvdg2CmiQbixuCSk+irAfZQnOShJkwQ47cXO9skW00Fu7tqqTTtomVNcnW V4xGwOaiTPc3cZbJQpeUqO8uLCw14A1AlrW1s+0vfEXsM9vCSCVC405WvwqkyPZW w/EI27nYKVqCkq0CTcg35nTmNO2qnj21uM7UOlDzqmovBDCNBbv7atu2VpG6272o wrEsTEjD0OSJKWA05nsWk2FtLcSLdtjcdmvLCSoknidascttjD4DgdXZ5xBCEDib 6X7hVbq0Y0TYpSlWApSlAKUpQClKUApSlAKUpQH/0OjYlKREQ+taHV5nlpAabKze 6TwA7qo8aCY/REpfxBLTCkKUy3AcS2spy/BvpfLfnrrV1xDfrxGNFioaL8uY60FO qISAEKXrYE/AI89YsVgYjCw55vOyJyml7otdZKVW6vhAX17dKArE9BlvrfZVNiur QlJcbgOZ9CDoSdBoRYW4630rCzHeZdcV03FVtrdLm7MR5IAN7jqqB4m/lrYtjaJo pWVsvpzEFDiEoVY5Neqoi49858/IKzoTjT0J5LrrUeQXW8i2kAhKLpzjUm5tm9Io DLspGciwZTa5Ut5KUtISJDKmwmzbg6uYn/dr3raveGP1E/5RUXBl4opM1OINMJaA bLSmrjMooczg6nQGwHDnUp7wx+on/KKAx0pSgFKUoCO9/wC4+SH/AJVrNmHk9EVG MhKFOPGyCu19ByrZvf8AuPkh/wCVaPZvZqBiTreKvvSEyY7uRCEKSEkAA6gi/wAI 86b9i0a7nLvZTb3W1mJICgohTWo+TTVq9h2BBXCxaTJgx5C2W2HEZ2kqUDZZ0uND oK1nsmbOTU7RYhPXGeGHKU0EyNLE7tI+sEVYvY8af2YwyS/IbLSJrLK2FPcHAAo3 Fv1h6awXv182aPiy/YPtAzjUZUp0mCpDhbDElYC1AAG4HZrbzGtNtDjUEzXIkqOi SyhSVJC8qkXy8QDpfU/TVTxtRx7Go+KSuo+w2G0pa0SQCTre5+EedZlbOzcViIWi M8pkqzJUi2trj7a29qt9yu1kjB8GjS1yXmOjRktkLKMoG8Gptpx4fTWeS85LkpiM pchsOJupk9VKiLm5A0PAeiqcxjkhjF40ZKGjlfS2q4NxZQHbXQtsHkx8eYdWoJSm OLk/rKqIuM1wHaNDikNWHREPJUJClLCS20LqGhNz6Ppr1gMgPLdak4c4neFKUrdb 0Re4vqPJW02TjGXj0h9QUGVsKKVp4HrJq0Y62642xHaQVJcCkK7QDYVand3sNqOZ YrLOD7aNtpjOTY6W7lpkXSq6Ty4acfNVw2YwxuZNViL8dAYfZJTFdb1bNxyOnI+m q05iM3ZrbdhhhlshCCob4EnVCuwit8drpodVIDcYuL8IZVWH01WC3dMM5rLlyxi7 60Kf3TL6rtpUbEBXC3kq3YHi5XFRImRnlYYFEOR3tW1HlcHq8bHyis2FYZBk4Fju KJfcL0dLj1gRlzBJVY6XtfvrSP4zjM3YeSwuE0MGWsbyUlJukhaSBfNbwgBw51zy itDhLdNP92aJW7R1jD8RiLwyO5DaQhpSeq01YBA8grmryHmor0gMOrS0grOVJ5C9 bDYV1TEMbgBY3Q1PlqVjmKbRYLhctvCcNakQ3I61SXXUElsZTe1lDlrwNZdB0OPo 4PQ27/f6/cjJNze5Sk4zHmDdyYKkt8ffgMt/PX7vcH8UifNRUbDuk7YgYa811lXX ljiyur5b1rZ+y0Np9caG5IdksrKHmypJKCDY8u2u2OTa+SjjuWX23jfpo+eKyonp cSFIQpSTwINxVew3YYSIMmXKRLbaYPWWkpAA79KnNpn4TAQiDH3uHoNm33Bcqubn UEc7jhyqfEXdDSzbiZHsMz7STzBWLir/ABsawWVs7LfEWKIiVEORzkyr0HEcDxHo rii9j8UxB5yWmDJO/UXera3W107ta2CcGewfZedFmtOMFZK7LtexAF/orz+u6KHW qKna0u+/7/waQk4cG8xM4HKnOvw8PhIbVbKy22jSwAOgFQF+1jBSVwY7Z4gltI/d VTwzLhjyZ0c5tCkFeqddOVqsMbC3ttWX1qacV0FNx0fTwr8b3/Q+uu3FKMIrGlwU lF8mx9t436aPnivSMTZdVlbss2vZKgaqkLZB6TMaZWzJCVqsSCL/AFVZBsbN2dQJ 8CLJdW570d9YpsdeVtbpFXU7V0RpfmWLBcSwRqRbEIsSW4pSN0XQhRaN9bX4cuHZ V7kvMuzCGihSktpzLSQbi6rDzWPprhTWwuMuSuk+1sqwWHFEWsNb11DZZshMpyxy qKUg+S/21wfwUJdWuqTaa7favsXlJqGksNfNnsl/zh4v+u3+zTX0nXzZ7Jf84eL/ AK7f7NNegYFTpSlAKUpQClKUApSlAKUpQClKUArcYPi4jfyaUomMRpe5yc/RxrT0 oC6KZhEj+UtpJSFAL6uhFwde41++1YcBLa0LH9lV6rUHF3YTDjJYYkIUmyN8FHdG 97psR38bjU6X1qf7eYa4Ul3BiDYX3UjLrbUi6T5eNUbkuxNI2CsJWD4FeZsljBmQ BlclK8FF75Rrqa1U7GUFa04cZTTRUbbx3W3eBpetQSVEkkknUk1K3IpI9vyHZLxd eWVrPM1jpSrAUpSgFKUoBSlKAUpSgFKUoBSlKA+y5Cy1L3yAkONyHChRSCUki1xf gbEjyE1hkSn5Sgp9zORwNhWSb+Mc+Xc/dVcWNoGQ6Wlxn7uqKA6m2VBUqwuCOCQj jqbnXSgJOMsw5OH9GnOhtl1xHOxJSQuw+bWhchARZSGdpHg66sFslawlpPDKADw4 cLcOVzW6jpxRzFMJQ9u9+MRXl6PdBWyGHbgXJyqKcwBuLEjUca6ZAQ+3h0ZEpWaQ lpAdVe912Fz6aAoWBFAw+S2mcqWQ5mzrOoBSuwNeiy0SSWkEniSkVbce/Jm/Kr/I aqtAY9wz8U380U3DPxTfzRWSlAf/0b3uGfim/mim4Z+Kb+aKyUoDC62hEd3IhKbo N7C3KsWxqmmsGeedByokKJt2ZU1nf/J3f1D9VRdpMMCkrksywwUNfkyBbObnXQ9/ Zyrj6jrodPlx45/z3v8ASv72aQg5JtdiqbXy8RxbaKXBdeDmAdRTbBSlJCghOtwM 3hZudSI0fEMVw5LLakqjYayEoSbDIi1gO06I59lY8KndCxXOuP0p0JILJOvDjwNT JGKOvIlpagrZDgUFZCere/HTlXYlW5FlMaxtlG0kLfLUcN036AnU8b9/ZwNT8Y23 xOLNcY2bmqj4akjctrZQoi4urVQJ8K/OtKxs2nfISnEA4snRIRcn6asMwR1bORcD W20zIjOlxb5AC1A5jYp4jwxz5VztZWjROKKTAbmuY3HeeUlSlyUqJ01JVc10/wBk x0MPbwm1o6P2hqDsaWsMdlITHRiBeU2MwA95tm14Hjfu4VecawRnFsCkwnZLbZcK f5QpAVksoG3Hu7edcnUdfj6JR8XmT+fHd7Xx5dy2jX7vYrOwk0ymmm4yjvRHJVcc sw/0r9wzG8Yemy4+ISg48XAiFZCQEquRrYduXjetR0JWEyFw4z5c3PU3rYy5h5ia 3beNmLu3HMLI3dlZlG17c75a9KLU0pxexlxsV3HWZs3a1OGFSVbQOtgtLNgjKEk+ TwQrlVi2ahYbJlqwjEWS5icZoqkWUoJuCBoQQOYqt44r8IdohiEZ3cSCgIS22c69 Ab2IseF6z7OyTs1jL8x9ZkOraLSkLVkUCSk3JN/0azuSlsti1KuTfQcClYc3NaCU Jwh1ajMbCrlbWuYA8R1b8CK18Y4ZM2pY2WhtqGzEhJU5EUTdSwkrvnvnHWSk6K5V t8W2yTLwyRDOHiMZDC2wsvcMwIzWyi/Gq3s9hC3HmUdIUlJKv5Xk0TodL383HnTK 4wjqeyW7+i5ESyYVh0aBjk+FAa3cZmyW0FRNh5SSa2LiXJ+yGOoQQVGI6kX01LZr ZxYzEOCyhUhtSgLF42Gf6a5m8mVIw+S0268hC21JUtN7JuLXNc3Q9fi6yMnj7fX5 12719u4njcHuZNisIMNlBiNpbxy6vfc107vsser9FU/aPFRAxiaIS1N4j0lxMxeW 4UoKOa19PCvwArawNnprbALE+Q5qffEIV6Lg1XpmxaHZr7juOpS4txSlJW3qCTqD 1+NdKTqqobcnVw5GxyK7D2cBRDd6klDlxmPLU3PDsqI/Fi4fBGDy2+sybqQkkjU5 hr56g4+p3EXGn2G14ahpJCt3cA68SRaozhVIwFuGXCpQVfpV7lWpP+nHlV43e6+5 V1WxYcGfejrWHlfyUJAYSALhPLv4dtan2UFNCDKMcEJEQce3MajNBxphtBWshKQM 2uulX1nAY3tHKhuy2pAdJu+pAOUWGnE9nbzrj6/0hj6OMXP+Z/7fHb+pbHjc+D50 whbmJRm8OYN5ABVZWgtcnjXUdhcJxeDHndEU22laG+k6g5gArtHeeFQto8CiMuvQ WJbLSkFJEhtABOgNtD39tbrY6TI2XiSwph2ciU23ZZukAJCteBvfN9FdMGsmnJHd NX9voRwmmbKPGiLTeE2Uy7+9KJNgfObVkXKnRfecYdC4yfBSgDRfEcADwvWmlTlS sQalNNloNpCciFXubnX6a2TWMOlpKFYct62tySb/AEVuVNxgGIpnxMTCFEhtsAXT a1wr7KhbM/m5z5Y/UKhYJhqpkl5xckwwlaVZCn8ZcnTiP9mrfLQ22tKG0oTpchIA rz5ekMf8WukXNb/La/vsWeN6NZHr5s9kv+cPF/12/wBmmvpOvmz2S/5w8X/Xb/Zp ruMip0pSgFKUoBSlKAUpSgFKUoBSlKAUpSgFKUoBSlKAUpSgFKUoBSlKAUpSgFKU oBSlKAUpSgPsmb+Mc+Xc/dUGQ+3FjuSHiQ22kqUQkqIA46DU1Om/jHPl3P3VDcbQ 60ttxIUhaSlQPMHjQENWI3lYcIchCFvSixn3QWpCi2shISSMqiQE6kWzG9qs8bCs WlxWZLW0ALbyEuJvCANiLj4VV+Ph8ROIxHloShlqSuQ6BcFSi2tFwRqFXUDflbTW rczjcBhltlpJQ22kJSkA2AAsBQEGVBmwox6ZiAl5yctmd3lshV+Zve49Faat/iOI Mz4w3V+oTe/ehX2VoKAUpSgFKUoDG/8Ak7v6h+qtH7aQMRbVPmSkNYw11I8ZBslx I1BINzxKuY4VvH/yd39Q/VWk2f2dg4nhzk1xgKnNulDTpWoBIABGgNuZ5VnLHGUl Ot1x9+S8XyjVYG/Ca28cxKbIDMlTRStF7JHVAGnHgBzq2RZMRasTIfBZeJK134JO bUeY15TshhSR0uVESucdFupdXY8hpcDhblVfkyG8IbxNpxKi24FpaCNcoFxrfyjt rRKrsl/Io+NysO2b2qhS9nJQnNMtJczPHMN5mUCDlCdLW9NaLF9oJmLY5IxaS0yh x8JBDaSE6JCdLkngntrXEqcFgdeAvX47GfEdKlLQUE6AcefdXFae3Y1/uf/Srew2 0k/Zl+WiMywpE9TYcLySbAFXg2I/SPG/Kr1tTjz0bDXokcMraWlKipQJN8w7+4VQ dhsTwB16S1jEKTIcCmkxy2bBB6172UP7Pbwq5bVIix3hvmlKY3SSpKSbnrHv8lc8 MSmqyb00/o1wbyl3iQ8HkTghMlLCSFo42NuPl7qvHve0kTohVdOTdO7nQpChY8b6 6GtFssw3iAQ00nKwGSpCVki2oHLy1+49jbGy6mPapLsdbxVviAF5im1vCJtxPpro k0lbM0m3saNrD8K2L9lSEVy3G2GWlKK5CgbZm1jWwHbVhxvZ7ZWaVbQTsWkNMTXL pcS4kIJIOguknkfRVJckNY3tS1j+PpVLwtKd28ynqOKskhNsthoopPEcK/ccViOM xkwsOfQ1gbbgciRXgMzYAIFyASeJ4qPGudJbqr7o0bd2brEIKJsN1/GyuIIzSuiF Byh1sC4Ub3vwHC1bTZFa8QwNGEMJDmEPOKK5CfDBHWsDw4gDhWu2gwfHpODIckTY y2GYZCkjQlATqBZPZW/9jRlmPsc2pKLAPOc786vFJTqt/Mh242SY+HoxaY9grpWI +H/ilNkBZv8ApE6egCtHhDs5EKTBejhEKV73IdscyEEWUQb2FgSeBqatvHn9osRO ATWIjma7heSDmTyGqVVqsIdxJ7ZrGH35CFlppZBCQLWQT2VaEIY04xVLn87sq7Zv nMRwvYzZPPh8xDjCXrBcg5tVHXwQK5FiSNmsUxKVOfxRSXZLy3lhCwEhSiSbXSdN anTMfjvYEYOKoekR94FFCEga8tQQap+LYIqG23NRuxFkqKmEBRKkpOoBvzsRzNU0 qaTi9iW3F00dLxHbnDsTw9+E9NipbeTlUUXBA7r1Dw3E8NcgtYTDlodCLqTr1jqS e7nVAwnCEvtuT5AQuHGV782FEKUO7/7FTnsSwiG3vcDivxZoNg4vrDLzFioj6Knw nd6mRr+RdpG02GIAiuzWEqYOQjW4I01rYwtq2UbPy2mHo64SlHeukG6TYX5+TlXG Xt5IfcedUFOOKK1Hhck3NWnCEW2FxNPa4r/KioyYI5dp7r9V3Cm1wjdrOD43ILbc 4rdV1srahy8oqxp9kGNBw9rCVSYYTFaEbrBWayRl11tfSuOwpMnDpAkRXA26ARms DofKK3YwlraRCXcPQlqW2M0xx9RAcWrmkC/MK5DiKs4Nu7ZCltwXCNtRhMUWRPYO t+terNhe176YyHoYjOtKBCVFKiDrrz7RXKhsg9hx6XiCmHYjXWdQ2tWZQ7tB9dYH doJUVws4O6qNAT+KaWhKim+p1NzxueNPDl8TJ1/I6LM21hTZbO8lxQ604cqU38K4 0Poq6YVijmLPPvvhtLqUoRlbBAt1iDqT2n0V84xkqXiLTiiCpToJPfeu+7K/jJnk b/8AKoeGDmsjW64+RGp6aLJXzZ7Jf84eL/rt/s019J182eyX/OHi/wCu3+zTWpQq dKUoBSlKAUpSgFKUoBSlKAUpSgFKUoBSlKAUpSgFKUoBSlKAUpSgFKUoBSlKAUpS gFKUoD7DmtoXNfK0JV74riL86j7hn4pv5oqVL/LX/lFfXWGgMe4Z+Kb+aKbhn4pv 5orJSgJERtCIz2RCU3IvYW+Auo9SGlpbiPKVe2YDQE8UrHKoe+T2OerV9lAZKVj3 yexz1avspvk9jnq1fZQGSlY98nsc9Wr7Kb5PY56tX2UAf/J3f1D9VaDBQsYS8pDi k2cOg8grePOhTLiQlwkpIHvavsrWwIj+GQHGJiN04pRWBcK0sByv2Go1xUlFvd8F knyIWBvty/bxzE3C24Cnoykmw+De+buvw51tS5DRBmF7cKWWyUJWRdRsdBeoqMXw uZHTg4kkzE9ZTYQoWF78bW4Ec6pG2iFwZOHvZdG1rWjNrexSdbVWUlCLaLpW6ZW1 4ml59MF/DBDU8LZ16FI7bFI7Kr2NNKjzHGkqK2UkZXBolXV5fT6K2e1u0M3aianE H2mEhpgMktApFgongSTfrVq4GJR5zScJxNwMwWAXW3GknOV34Hjp1lcuQrJVPdl3 cdi2bA48iA7JSnBkyy4WhmB8C2bXwT2/RVn26l9LCnVMbizKE5Sf7Z14DtqB7Gjb GB+2rmJLUw29ujGPhZwM/HKDbinjbjWT2QcVYxSA9JacCkJaQgkJI13l+flrbHFx RSTskbDx1TZW7EksgRyrMNfhJ04jtqftRg6cZwuS+ZQjrw5l1aUFOYvnLew1FvB7 +NV/YTEojBQXXcv8nI8En4Q7qtUyE9KwTFsQlIyKhxnHowQRZZCVK63E26qeziat JKSplU6KPsds1IxWdGddfdZZUpYKVNEp0Se8Cv3aDZ9KMSkRUYuG925xAty7M1X7 2P8AExiOxyVTSltxTywQ2DawIt21yDbTfHbPFUsICmw+cpPEiwrJqMYqi6bs7hNc TJ2DxFtoBxxGGuIBScxUd0fprQ+x447E2TQ1IbW2vfLOVy6Tx7DUoJl7N4RGXhjS Xi5GS8vfm9lBPAWI0qNFxmZjNhMaZblrJGRoECw15k/XWle0mV7H/9PbO4E9tHjU xDGIrhbtWYqQkqzX0tooVKkOley2MNojFtS4rqQEjUkoPdWgn7R4jsvMdchMR3HH VZFh8EgAa6WUKuEua3Gs0FDpCwd0gg2UrkPTUbNuuTTekcflbIPp2KOOLkubzf7r opZN+PG9/wB1RmMuBRGZDqhO36ANwrTdaX7/ACcBXRdpsSxqPgai5EjpRvE63v8A +VcvfjuPvuPKTZTiiogEWuTeojFRVIh23ZudocOakxy9Gkob3aDdlsD3w37j+6qa phSFFKklJHIi1buM07FktvtpupBuAo6VsJEJGKoMhJUcQcPWaSQEgDTS/cBzqxVp lS3R7PoqxbWpLWJNts3Q2pgEoRoCcyuQrG/g0qMkF5opBNh10n6q2m0MNyXirKW0 lSi0ABcDme2gplN3R7PorcYNhrjgefVKVGDWVYSRbe8TbiOzv41tWsGw9toJnPvt SR4aEkEDs4A8rVHxBTkoNMBILMa6GlDQqToAT32A7KBJkhe0IxhBw5Ubo6ZHULpc zZe+1h9dV7EcNMGWtlKy62m1nQiwVcX7/wDYqX0JfYfSK2kXJIhow+cS1GautC0e EVXOh46anlQUytRWz0tnT+kTy767psr4czyN/wDlXJzhL0WUypSCEKWCglQNxcV1 nZYflZ/U/wDKgqkWKvnH2SIz7vsg4spthxac6NUoJH4tNfR1c8xL8/Yp/wAwP2aK MhnCuhS/FXvVmnQpfir3qzXbqVFkWcR6FL8Ve9WadCl+KverNdupSxZxHoUvxV71 Zp0KX4q96s126lLFnEehS/FXvVmnQpfir3qzXbqUsWcR6FL8Ve9WadCl+KverNdu pSxZxHoUvxV71Zp0KX4q96s126lLFnEehS/FXvVmnQpfir3qzXbqUsWcR6FL8Ve9 WadCl+KverNdupSxZxHoUvxV71Zp0KX4q96s126lLFnEehS/FXvVmnQpfir3qzXb qUsWcR6FL8Ve9WadCl+KverNdupSxZxHoUvxV71Zp0KX4q96s126lLFnEehS/FXv VmnQpfir3qzXbqUsWcR6FL8Ve9WadCl+KverNdupSxZxHoUvxV71Zp0KX4q96s12 6lLFnEehS/FXvVmhhSgCTGeAHPdmu3VgnfkEn5JX1Glizq8v8tf+UV9dYazS/wAt f+UV9dYakkUpSgMyfyJ35RH1Ko2tSGFlCik5k6g25GifyJ35RH1KqM9DjymCX0LX kULBLq0DUH9Ei/DnQGHEcQmx0xxHcczuPJSo7pbgCeJvlOmg0PC9vKNa5tNi6WCt vCJS1hKSEZ1i9zrrk5fXwuNa9yWsLiyQy5DklOQLLiJDqgm6gkAgLzXJOmmtj2Go 5mbNhxtF3iXAops5JIITxN72todeGh7KAnDGsV6ahow3t0UjOvOrqneFBsbdYWso cNLmtm/IfDDhDzgISbEKPZWiWrBWnih2O+hJDmVwyHilW78O1l30seIF7aXrOzEw yVhyJbUV4Ica3iQ5IeBsRfUZ6AlYUSrB4SlEkmO2STz6orYY+0j2olPZRvEN9VXM a1AwxWfCYarBN2EGyRYDqjhWViT+EmCSVkdGFy1xz8gb8u2vK6/o83UdRhnjdKNt v8bfejfFNRjJPuUFtSmphltnLIIsXBxta1JqjiQQJh3wRfLm5X4/UKmIRPwvaZ2M nB5MuG2nqyw2oNrJSDpoRoSRx5VsXtrI2HxZLL+FspceQpKAtwJIIBGgKdTqK9X2 aZTcpeIYHHewyRHiMtNOrTZKjcAGqzH2JxBtWZx6ITa2i1fw1LUxLmRlpkKfgoOi nXAQEDtN7VhYwWMkZRtW0sgclj+OsYtSXFFmqfJ2GLiGzBgMxPapzpG6S3nyC2e1 r+FwvXv8CW3dnpMGS1FckuOBSVkqyhIKTbh3HlWi2bwaTOadXLS9CEdKC0p1o+/8 dU3t2DhfwhUraPad3CcBksqjLK1ZVhZdKSOsB2d1cfpDF1WVQfTSqmr/ADzytl3X ctBxjeoiYXBwvZ/Fn2Z0NLiG0FuzQuL3B5kd9babtBCfwPE4LTTyVyoy2W7pGVJK SBfXhqK0WANt46hD0mWiGhxveBx0hQJuBa5Iv/pW4xfBzg2FSG0L6UiWwtJfDdgw AnwuJ/SvxHCvRinoSluzLvsazZSW3gWCJhSgpbgcUq7QuLHy2qq45gsjEsalzY62 koeczALJBt32Bq54AzCibHqzT48h8OGySU5j1h3k1zfaBUtGMSnbPNsKc6itQk6c jwrOdKC2LK2zpacZQuPGZf3q0ttpQoWFiALHnUiOuHPfTGwxksTF33bixYJsLnUE 8gRwqUJwdgQuh4Z0uzCQtTIzWNhxsDrWNzCkSGFYnKlpwkp6pbdTly8r3JHG/ZWk 1Jwag6dbELnck4psf7Y4fGQpEZUtBJecWT1j6K1GHYrGQ+h3E23JCkLSpJABsAfK Krfsh4q9IwnD4EKYsCM4r+VMuk74W7vtNbbZqI1tDBlSTKRG6ObZTZWbS/G4tXm+ jIdRiUo9RK226/L7789l24NMjT902m1eL4bjWEKiQozrThWlQLiQBpx4E1R/aZzt a9J+yt/tNBzbPqgJe3TW8Svp4HVv+jx/fXP8R2enRGWnI06TLCz/AEaFaDt0Jr03 KjNFh9pnO1r0n7K9tYXIZXnbW2lXaCfsqt4fs/OlMOuyp8iGEH+lQoXHbqRUtmMM Cc6ajE/bAjq7gKte/PieHkpr7guOD7Oy8addbccYWG0hQ3ij+4VY9qtlEnNPgtx2 UssjiSFXudRp3iuRYtj0zEGm0R234hSokqbcPW7tAKsO3O0MqXtZDmtIebZajJSq Ol0lKzmWddLcxy5V5PUR6uXVwyY5+wudvpzvvfbyNY6dLTW5/9TRuYU+6srcW2pR 4kk/ZXn2mc7WvSfsrWvYqrHW+hKScPBObfld7W5cuPlrVzsGlx930PEH52a+fcpJ ycLXsTx19FR4i5RpuWb2mc7WvSfsp7TOdrXpP2VUo+F4o4+hD7kyO0TZTq0KCUjt NyK27Lf4PLMtGIe2RWN1uQq2W+ubirstw508Qbl22f2akYs6ouqYWiOpBssngb8N O6r4vD2IMpRjtIbaWhPVT2gm5+kVwqRj0ubiEBbLb8UMugrShw++ajQ2A7PprssD FjjE2Q/ui0lLbaAjPm5rN+A7forzZQ6mXXRyKV40n9tlzvvv8ti7cVja7mxrnmJf n7FP+YH7NFdDrnmJfn7FP+YH7NFekznZgpSlVKilKUApSlAKUpQClKUApSlAKUpQ ClRX5qW1hlpO9fN7IBsNONzytcX56jSosadLDrnSEtONBe7KmQRkUALix4i546cO GoFSDaUryhaXEBaFBSTzFeqgClKUApSlAKUpQClKUApSlAKUpQCsE78gk/JK+o1n rBO/IJPySvqNAdXl/lr/AMor66w1ml/lr/yivrrDVy4pSlAZ20lUVxIFyXUAehVR pMeatsIjSY7IvdRWAu/ZbrC3E1Mi/i//APdv/wAqoG2OK4zDx/AIsZCmcNkTmEuy G1arJcF2z+iLfO8xFa4sTyy0ppcvf5K/9EN0bx7Cnnpbgdk4c7IyJzkwkqOW5sCc 3cdKDBnwSQ7ABN7noA5ix+FzHGpMb8+z/kmf/Oo+OyMRY6L7XpcOZZC8jee/CwOh sOOunlrFulZeEdUtKDuDyJBcLz0FwuABeeCDmtwvdWtSEYXiYjhtE6I20UkJSIwS AOGgz1sKr/sgTJWH7EyJUN5xmQ3uihbZsQd+kfTwtzvWmODyTUF3dFG6Ru22EYdB YaW6jI2lDSSVi6jokaA86qTeK4ns5jMbCJYQzEkWddBAUbG4uCL/AKNbFiTiEvZ3 DH8VipjTFyGC40Dw64sSORPG3K9q3GOQYOJqK+g7yXu8jclVgEak2435nkeNef1m XPhzQhjjqi27a7cVvxXJtiUWm2zRqxrGp2OOQMLS27AACmiUgE9UE8SDxvWrxjZn EsQS7KkRSVxQtwlLiQAeJ568K2sfAsThuh6PLYbcta6VKvb5tZeh484l5tcxIQ4C ld16LBvfgK7aXBWznmHM4rtDs7LxB5lK8IaWWpLySlJTYJJ0vmPhDgOda6Phmy6X 1JaedLgTqDn4eiulxNl5cHCX8MiyIrUF9RU6wkqyrJABJ6vYB6K1R2JLMhRbgsqN rbxChY+mx+iqOMkqu/qTqTZb/bzDHIcJhiTmUlsIAyK42AHEVVfZGwuaMClS32bR 20NpUsKTp74LaXvxIqVHwOe0+0osAJQoHRaeAPlq54kqFiOGuxpkNUphdszBA69i COJA0IB48q4+t6rNh0rDjcre9eXfut/Lt5loRjK7dHO9mHcEZ2fgqxZ9bTBaskpC j1r6cAeV6uTTnSWDCxs7uPLTuoeTitKhY8L20KeNuNV9/ZhUp1TLEVuNCSbtNOKF k93Vv2mrFhUJxog4q63JLOXo1rnd248QOxPorbNmyQwvJGFuuO/7REUrqyEvBNlM HV0R115tQ62UlauPeBVF2jdwN2S7HU+voyHboOVV+Hk7zXTcagxMSiulpDYlqCQl 1YItYjs7r1SZWyDzjis8Jt/W+YLGvfqRWfR5s2bAnkhpl3T/AE+X1JlpUtnZNhYo /slIw+JLUlhiaW1punOVIuBfS9tDW5xvFtnsSadanS1dCWE5ylCwdCCOV+IFaOTg eJ4m7GVNZzmOAhpTi0ndjzHhU2Ns2WpCVzm2ZcYXzsIJurTTjYaGx48q6sknGEml dLjz+RVVaKLt3BMLDoUjDUE4c64RHcUdVJt2HX0is2za8WwlfRlNpREfdTvySknL wNrHsvXUJkHBpeHRY0jBi+wz+LYIT73/AIregmqy1s7PcQpSg22RwSpeqvJa49Nc HQZs2dN54ODXHa1/X7mk9MfddkidhMvHMMMSCzvsNKwoKzBJzDjxINV+Ps9tO4+7 EhQUrEc5LF1sWANhxVVnh4fjkaOG2ZzbCLk5Mx/cDQRcfiOrdYlgrcPXLa7E+kCv RlFPvRmpUUnBIuKbVsu9DZTIioUEPKCkoIvr8Ig1GxTAWIUtzDwhYnN2Kmyu9gQD x4cCOdXDBsFxTCErZw9sQm3VArssWJ7Ta9eZmz+IO4g5LcbRIkKsFPBY62gHO3IW 81Z+HtTdllPcoXtHJ+IPzx9tWzGtjJ6ozsx6GoKbRa4dTa1+y/fVkwHB0tvunFIi SgpGS5B1v3GrTJkRnY623GlOoULFsAdb0kV5HW9R1WDKoYMTlHu6v8U18+TWGmSu To4phOysrEJwYEZSrpJsHEjh563D2ymL4QkmFDsFAlzM6g2tw595q1u4TLRiK5mG KbhoUAEtlVlJFgDwBGp141+PYfjjqbLxBteYG4zH+GvWxQTxp7pv8r5GMp7lMh4b jOLtEdGSuKVZHCFpB7e2/MV+YtsRKgYc3LTEWlC3MgUXkm+h5X7qtTGEYtDZUiO6 hKSc2VK+J84rO5huNTYaGZM1vdJVmDTiicp110B7T6av4aqmxr8jlT0ZOHzIjckF tb7gS0L3zG47OHEV1zA4EjDnZLMpvduFKFAZgdOsOXkNQoGz0TpGfGMH6YptSTHW Ck7s31Oqh/Z9FWuStp2RvEJOYoCSrtAJsPNc+muCOXNHq1hjB6O8n9Nq/tui0qcL b3MVc8xL8/Yp/wAwP2aK6HXPMS/P2Kf8wP2aK9FnOz//1YlKUqhQUpSgFKUoBSlK AUpSgFKV+KUEpKlEBIFyTwFAeXHUNAZjqdEpGpPkFQ3X3XXksJulatd0lWqU/pLU OA7ANT28bReqhuVLf3geUvTrqTlTkCrEAjgL38h50wqFuI7YkLfLkhIdKi8u+cjV J11IFvQeypBso0ZMdsAkKctYrCQnzADgO76zc1hhoZkRHwUBSHHnkrBHhELUk/VX p1htGVCS8XF+CN+v0nXh/p21rsIjhuOpLzrykqkvpSreqGodWLGx52vftv3XEkxC VsSN1fKsj3t0kkOgDwVf2gOfEgX7RUtt4KVu1pyOfonn5DzH+zatfieHiTHMZlx5 Dy0qUhZeWchSNCNeOYp+msSN3MwZT2Z5LoYDqTvlGxKbhQBPG/bzBoDdUrFHcLrC VKsF6hQHDMDY284NZaggUpSgFKUoBSlKAUpSgFKUoBWCd+QSfklfUaz1gnfkEn5J X1GgOry/y1/5RX11hrNL/LX/AJRX11hq5cUpSgM6EuLhupaKg5vE5VIAJBsrUAgj StWrBJyxZeJYgoXBsWWTqDcH8V21t4/5M95R/kXVZVtPGZSnpDLqFZgF5UqUGwbW KjbTS577aE3FwNrDwl6K888tyVIcdCQpTqEiwTe1sqQOZqXuHvinPmmtOxjjMl1h tuNJBddLSt4gILagkqIIJvoAOH6QteorG1kF4qzNPtpQ2hxalJ8EKJHlNurw/THY bAWLcPfFOfNNQ5eFTJSwelzGkC2VtDTRSCDcHrIJ468aiQMbYxCQthth9K0KWlZU jqpUhWUpKuF+Ggvx8tScNwtvFJWJrkSJY3UoNoS1IUhITuW1cAe1R9NAeDgcpxbZ fnYg8htxLgQptsAlJuL5WwePfWx3D3xTnzTWvmRcFgOuIlTMSa3eqiqU54Jy2Vxu RmUE6a3vpoSMCVbOrlCOJ+KhalBKCXXwFkqUmye3VJ14ajWgNvuHvinPmmm4e+Kc +aa8sbP4fJYQ81LxBTaxdKulOC47dTwrN0VmDHDaApwJNgp1alK1KuJvry9FAY9w 98U58003D3xTnzTUXEMQTBhqfERDhC0ICQV6lSgnlc8+QNQztNAQuQhcdQVHCy7Z KiAE6EjXUX0Ftb8rUBttw98U58003D3xTnzTWKNMalR0PJjZAoeC4FJUk8CCL8b1 GdkrOMsx0pShox1rIHMhSQOPlPpoCduHvinPmmm4e+Kc+aax0oDJuHvinPmmm4e+ Kc+aax0oDJuHvinPmmm4e+Kc+aaiS5BjR94lAWorShKSbAlSgkXOulzWNM9K0wVp aWUSxdKjbq9QqF9eNhyoCfuHvinPmmm4e+Kc+aax0oDJuHvinPmmm4e+Kc+aax0o DJuHvinPmmm4e+Kc+aax0oDJuHvinPmmm4e+Kc+aax1jkPpjRnZCwShpBWoJ42Av pQEjcPfFOfNNNw98U5801rFYxCROchrWtDyFoRq2bErF02IFtezjoeWtYvwjwqyS ZRAUFFN2li+UAnl2EekUBuNw98U58003D3xTnzTWoXjkZttLq2n0skLJcUiwTkJB Fib36pOUAnur0jHcOckdHQ+pT2bLuw0vNfyW5W17OdAbXcPfFOfNNNw98U5801q0 41EdgdNjbyQxcDM2m3nuqwAHM8qxq2iwtvRySUG6hZTavgkg20sRcEXGhtpegNxu HvinPmmucYiQcdxMg3BfFiPk0VdG8YhOzRDbWtT+YJUgtlJRdBWL3AtoPpFUeV+d p/yqf2aKhkM8UpSqlRSlKAUpSgFKUoD/1olKUqhQVHlELysXsF6rvyQOPp0Hn7qk VAT/ACuU78Wk5Fd4HwfOb37gNNaAhSQJKHRY/wAskJYQDwLdklfpSlXosRxray/x HV/G3967c3L/AF7r1rmVpXiXXPvcUOrPO61uKCbd9kqFv7VbNpCirfOCzhFgn9Ad n2+TuqQeYvXbLqvxizZf9kjTL5Ab/SedRcPQlxua2oXSZLgt6KlH3mTm4Nu2Cu5X L0jTzDtqDFUoNy0INluS1oSRy4XPmFz5qAkQVqWt1TputRshX6aBoCOXEk+ccrVB 3ZRDnR0/jI61pbH6SHBmCf8AFYd6Rx57VbA3aA1ZCmx72eQ0tbyVrJLgTibS7ZRI yNrB5LQ4kgecKUfIPJQkntOJ6RmT4D6b68ljQg99raf2TUqoUpCmiXGxcE5gOxY+ oEaHy95NS0LS42lxBulQBB7QaEHqlKVAFKUoBSlKAUpSgFKUoBWCd+QSfklfUaz1 gnfkEn5JX1GgOry/y1/5RX11hrNL/LX/AJRX11hq5cUpSgMyH2mIjqnVhIKgB39V Y/fWrSvDkFJS20kpJKbNWsTqSNO4eipD8SNKy9IjtPZb5d4gKt5L1h9qcN/4fE9S n7KA8pXhyCkobaSUgBNmrWA1AGnea9b2BdJyt3SQQd3wIFgeHZXNRCie2eLDorNk z3QBuxoL8Ky9BieKserFRZFnREOYe0pKm0NIKU5UlLdrDXQacNT6ak4fiMSAZSkq KzIe3qr3FjkSiw07ED01zLoMTxVj1Yp0GJ4qx6sUsWdUexfDpCVpejNOBYAWFpzZ gDcA3GtiSRWIzsHKgo4fGKhax3Q5EkfB7VKP949tcw6DE8VY9WKdBieKserFLFnV msbhMNhtllDaASQlAsLk3OgHaag4jiSpWURZTcccVZ2S5fja2otxNc36DE8VY9WK dBieKserFLFl4LktQscUjkXvrDP8VYy04V5zOhlVycxga66H4XefTVL6DE8VY9WK dBieKserFLFl4QqU2hKEYnHShIslKYRAA7B1q9x+pOEqTOQ8pLZbSEMFAAJBPM9g qidBieKserFOgxPFWPVilizpPTo/xn+E06dH+M/wmuUJhxY8p9RjM7sHMpOQaJI8 L0hXm7gKwY1Dj9GcUiM1eO2ZPVQL5kkFI89laUsWde6dH+M/wmnTo/xn+E1y5MOI wUgxmCyogJVkHVvwHk7KyOxojaRaIwpajlSnIBc+jz+alizpbkqG62ptwpWhQsUq QSD5rV+mZFJBKwSDcdU6fRXKzhkQSGmlMNKKmnCpQQASbp17u7srO1FjZi05FY3g 1B3Ysodo/f2ei6xZ07p0f4z/AAmnTo/xn+E1zJyNFSQhENhTh4JyAecm2grWmBET jbJLTalkZT1BlJyqJFuVrpt5eZ1pYs6/06P8Z/hNOnR/jP8ACa5Q1Div4otfRmcj SCkDILG5tfy3SoeYdtTugxPFWPVilizpPTo/xn+E06dH+M/wmubdBieKserFOgxP FWPVilizpPTo/wAZ/hNfhmRVJKVLBBFiCk6/RXN+gxPFWPVinQYnirHqxSxZf93h G73fRo2S4OXcC2l7aW7z6TQM4OBYRYwGv9AOeh5VQOgxPFWPVinQYnirHqxSxZfn WMHeY3LkZgt5FICd1ayVXuBppe54V+7nB8wV0WNmFrHcC4tw5VQOgxPFWPVinQYn irHqxSxZ0HLhW5LO4Y3RNyjc9X0WrEmNgqUlIiRiCtSzmZv1lG5Oo7aofQYnirHq xToMTxVj1YpYsv8AucHuk9FjXSQQdwNCBYHh2VSpX52n/Kp/ZoqL0GJ4qx6sVGwR CUYQyEpCR1tALfCNQ2Q2bClKVBApSlAKUpQClKUApSlARp8gxID76RdSEEgd/LzV ji54sZDKYj5yjUko1PzqkSW1OxHm0+EtCkjykVHYkJahryjMG0BbY4ZkEXSP/Ht0 vzqQa/CSpUibI6O8u8pzKLo6tiUn4XaFek1tukO+Jv8ApR/FWvwuOplMltK7vMPl JJ4KBSlVj5bg35Ht1vtG3A6jMARrYg8QeyhJgccW62UKhv2PYpFx3jrca1OCyXXn ZK1R3FlLiiMpT8I8dT/Z08prcq/lKyj+hSbL/tns8nb5LdtQYSTun5SASUyniEji pIUUqHpTceQUB//X1vSHfE3/AEo/irUY4rK3HlrZdaLMlpepR1usBbwuNiQPL5xu 1OoS1vL3SbWI1vfhby1q8TjqluRY7hsp5ZvzCEpSVec5gj/YqpUnqeWpJSqE8UkW IJRY/wCKsGFrVkfYUFWZdKUlRBNiAqxsTqL29FZhIU6wyWxlceRmF9QkW1J7bXH0 V+QG0oihaf6Uly54kHhfvta/fQglUpSoApSlAKUpQClKUApSlAKwTvyCT8kr6jWe sE78gk/JK+o0B1eX+Wv/ACivrrDWaX+Wv/KK+usNXLilKUApSlAcwH50xf8A6g99 dZaxD86Yv/1B766y1VlWKUpUEClKUApSlAKUpQClKUBgc6kxpfJwFs25nwh9AV6a ix0JU5JYWDul3baVfigCxT5iVebttUuWkmOpSQSpBCwBxNje3ntbz1rXJdoTbSEO h7MguLLKyELKgSeGpub24fQDIJWGOBzBY5ey6MhLl/BuBZXm0NfsfOh/M9myqBSy VcUp7D3nj5AAdRc1+PPnlSYjTaSFyHHFKVHcylJVmKhY3Kbk+cp5Xrc9NU41Z1xK bkJUlURzRR5ceNCSQ64oY1Fb+CqO8o+UKb+01lkdYpSj8de6T2eXuqvuS8RGMRSh IJDDoSXIywSkqbvcXvfQfRe1+rso8lViEuHecXM0JzPfv1/07NKAnRrZDm/G/wBJ fjf7OytXJWrpbjrSsrgdSlpXG5XZBNu7IqsMzEpjTjcmOkLZGjiuiuAqHK2uo1P7 uNjghylPdMW+hwr1VFKWFjNcFYNtdQSR87jyA38NCU70oHUzZEdoSkBNvSFempNY ozamozaV+HluvvUdSfTestQQKUpQClKUApSlAKUpQClKUAqBg35pY/vf5jU+oGDf mlj+9/mNSCfSlKgClKUApSlAKUpQClKUArVOC0eIEglTKilVuJQg6n0pT9VbWtaH RFnSC6h3dp/E5W1Kvm6ygLDXUVIPcMgYniKQdFKbd8t0BN/J1RXuQFrdUI9wpIG9 sbZh+jfkq3PlfyVXvbOREnyVpaWEqaShH8nWrKlK3LAnTW6rDzaXraQ5ctthtuRl bWU3umK4Rc8Re+pv6ePkEm2aKFNJLdgi1gALWtyty8lQ8KO7wpC3OqVKW4onmVKK ifPf6aivTZDayuMd6smziExHANOZN9CNO8jyaQsKnTVw2lyylKGrtptEc6uUkXWL 6HS/d3UBuY6Sl8BxJAUCtlJ+B2jy6+gkDgScalpONuOKPVjxgm/HVxWo8vUTp3jt rBKlSXEBLDiVOj3xJMRywtw58Dw8hNa2FOlK6TMkt7lZdzhpcdfWypANj3BJt3kn soDbMpWmE8hfVfccLWUH8Wkk5QP1Uqvp38OW0AAAAFgOVa2M4ZGIqIbcS2kbxWdB SQ4RltrxGUfT5K2VCBSlKgClKUB//9CJSlKoUFKUoBSlKAVgnfkEn5JX1Gs9YJ35 BJ+SV9RoDq8v8tf+UV9dYazS/wAtf+UV9dYauXFKUoBSlKA5gPzpi/8A1B766y1i H50xf/qD311lqrKsUpSoIFKUoBSlKAUpSgFKVDxJ1xuLZpWRazYrtcoSASTbnoPS RQHp+Sc+5aJK+eUXPm5ec6D6KiykIZSwqSRu21KWW03ItlNyeaiSR5b8KkMRHo6M jTjAHMlpRJ8pK7mtTMTKm4s0C8gx4zZdWUNkFV1WBtmvYFJI1F7G17CpJNjE3l3H SjNLeN13PVaSPBQT3A8BzJOgNZzGUhwSAd48PCvpcdg7P9gnnX6huQlADbscItoE sm3+av0plAEl9gAc9yf4qEGIqadxOO+leqY7nO1gVI1I/u/XXpxhM6xWCloeDbRS vP8Ao93PnpodSW5CsdLnvamyxmI3Z163HLfXyX77XrcJ6StIUiRHUk8CGiQf8VCQ slCFNyRnaItvBpYf2rcPKNPJWsLZYkAJKeuoJIvYLJN0nTnfUEf2hwAFbXJL+PY9 Sf4q1cuG64shLrYaNm3crZAOY2Fhm0INjcW896A2caRvCppd0uo4gixI7f8Af1EV IrSgypOHCW44wmTHSScrRBSoDUeFwPZ39tbZhzfR23bWzpCrX4XFCDJSlKgClKUA pSlAKUpQClKUAqBg35pY/vf5jU+oGDfmlj+9/mNSCfSlKgClKUApSlAKUpQClKUB 5ccQ02VrVZI4moW8ccSuSTu20pKgq1yE2+DyJ79RyF+NYyh2bPcJWjdsn3tC0FST xBURca3ChrfQAjiaw4wub0YRGpDQckKS0VJaN0JUbE+Fxte3bY1JIipbzt5xZqOb WAKi8/8ADV2qtwv25uytiptySLO3bbP9GDqfKeXm9NRYEV2OwltDjKVoSEKCmiSL cr5uFS8kv49j1J/ioD8b/k2VpVt1wQoC1u4/bz8trxILhQJiUDM4qU5lT6NT3f74 2qQ90hLZDjrCgrq5dwTm7rZta1uEoktLlBS2UFUhYBLZVbh1b5v9+agNm3FMYEx1 C6iVLSrwVE8+7/elRXgytbrakkNSeo6lX9Gs6JNj28LjS4FuJNTckv49j1J/iqJi EZ2RGU26tlZWChIDRBJPIHN6fJQg9IDxjsvpKjdAUCNVJBF7H9IfT5SalR5CJCTb RadFJ7D/AL/2CCK1mCrmmClh2Q0XGlLbzFo9cIWUXHW7vq7ayzWZLeWS2toyEqAS ENkFfak9bUWv5LX040BtKV+IUlaErSbpULg9or9qAKUpQClKUApSlAKUpQCsE78g k/JK+o1nrBO/IJPySvqNAf/R6LL/AC1/5RX11hrNL/LX/lFfXWGgFKUoBSlKA5gP zpi//UHvrrLWIfnTF/8AqD311lqrKsUpSoIFKUoBSlKAUpSgFRwkPS3MwCkIRu7H hc6qB82WpBIAJJsBzqI0tSY6Cke/PqKwFcgdbnyCw9AoDy0pbzCY91EoGR5fkNre U8e4HvFeYQC8QnvAdUKQwnyJTf0XWR6aysIEeQtq5IcSHAVakkaK/wDH0nzYcJUP a3pCyAXVLdWo6DUn6LWqQSARGXlUbMqN0k8EHs8h5ejsr9AMghShZocAfhd57q/F NdLHvqSGTwbI8LvP7h6ewemVKSrcuG60i4UfhJ7fL2/60BG//v8A/wD5f/KpKm1N qLjWt9VN8ld47D9H1jwlKTiTq7dYMoAPcSr7BWRxwhQbbALihcX4JHafs5+kgDxv 98d2ybK+GojwO63b/wDfcfyS2G4DiW0/i0ZkDjqNR5dQK/RGDYCmTZ34SlC+f9bt 8vLyaVkbdDlwQUrT4STxH2jvoDWue9LskgpVJSkm/ElQWD6CR6KnxuqXmv0HCR35 ut9ZI81a5pCVyY8VQ6pbVccArd3bUfKc6PMO6pbK1JlJDh65Tu1k8ynVJHlBUfNb lQkm0pSoIFKUoBSlKAUpSgFKUoBUDBvzSx/e/wAxqfUDBvzSx/e/zGpBPpSlQBSl KAUpSgFKUoBWN9wtMLWBdQHVHaeQ9NZKjvqCn20KICEAurJ4C2gv5zf+7QGHSG+y hN1FTOS3NRSRb/MomsRbKsWiNqN1toW+tX9o9UW7rKV/s1lWkrfjyXAUgOWSCLZU lJGveSR9FfkH32bOkdrgZA52QPtUdPtqQSnW1X3rX40DhyUOw/by9IPkyUqslsZ3 D8C9iny9g/3rX6p1S1FtniPCWeCftPd6e/wGOjkuNAqKjd0HivTj5eHmFuQsBkba yq3iyFukWKrWsOwdgqHh6EuImpULgyl/urYIUlaErSbpULg9oqDhn/vP+aX+6gJA e3PUfV+qs/C/17ufEcwP1pKlK3zgsoiyUn4Kezy6a/6VjW2mbcK/EJPV/tKHPzHh 3i/IGsrbigrdueHyPJQ+2gIMRsl+e2k5XGpOdBPMKQk+jUjzdoqQhwSZSNLbpOZS TyUbgeiyvSKxte945JTydYbWPKCoE+jLX6yS2lU2/UeOdY/s8Eq8yQL/AOlqAzw9 I+7+LUUAcwAdPot6az1gb6kx9HJQS5r2+CfoSPTWeoApSlAKUpQClKUApSlAKwTv yCT8kr6jWesE78gk/JK+o0B1eX+Wv/KK+usNZpf5a/8AKK+usNXLilKUApSlAcwH 50xf/qD311lrEPzpi/8A1B766y1VlWf/0olKUqhQUpSgFKUoBSlKAi4g4ERFJIJ3 hDdhxNzY277XrK02UlS12Li+NuAHIDyXqNiLAkGIkpSpSXsyQsXF8iuP1Vkaiw3W wtMVkX5FsXB5g1IMGNL3MBb4FykFFhzC+r6LlJ81ZozKiwylzwG0pCUkWuQPCI+o cuJ14a7HIkZUB1tuMyMuVS1BABT1ha3ff6BrxqeiLGSsNuxWMx8FQbFlfRoe7/Ww km1jdb3iRY5VpN0qtexrx0GJ4qx6sVjcjQ2wP5IypR0SkNjWoIMaJN5rwye/ZEIy X53WePZbW/ZyvpUtpvdgknMtRupVuP8ApWtThbHT3XNyzvQ0j+jGXirS3ZoNeNS2 40Ry4MNlK0+EktpuO/yVJJLrG40HLEEpWnwVDiPtHdXjoMTxVj1Yrw5GhNJuqMxq bAbsXJ7BUEEBpxScbS25ZtTalJCb6KS4Aokf3kf4reWXiALKmpaRo2tIc/Vva/mB PpNa2RBbOJpdXGbCDuQG0oFkHObE+a4PLUDvqZisWMnDnktx2UrcSpKVBsXGhJI7 7A276kk2lKUqCBSlKAUpSgFKUoBSlKAVAwb80sf3v8xqfUDBvzSx/e/zGpBPpSlQ BSlKAUpSgFKUoBUFkGVJecI96SvJr8LLpbyA5j6Oy1Tq1WHRIyY7bbkdpSlIDiVF AJUDYm/eCfQRUgl4iotwHXUpzFoB3Le2bKc1r8r2qPhqFqw5lCVFLRTmUu1ivMbm 3Zx48+XbUbH4sYYU+hMVkEoK1kIAIQnVRFufLz1M6LGj6OxmVN8nN0Or+t9vptzE k5KEoSEoSEpHAAWAr9rB0GJ4qx6sU6DE8VY9WKggK/kylOD8SdVj9E81fb6e2oGF kv4chtJ1UVF5fM68L9pHoHmqQYkZ8lLcZpLY4uBtOvcn7fR2iDhEGM1hjLiYra0G +dOQEixIuPMOHo14ySbwAAAAWA5V5cbS4nKrygjiD21hTDhqSFJjMFJFwQgWNfi4 sJtBUqMwAP8A8Y+yoINdNW4nEobar711tyPcaBQVlOYeQJVpy+vdAAAACwHKtFiE JJk4ctEZptRkEJbyJ196cNleW3mrZtxYTrYWmKzY9rYuO499SSYj/JZsZs+ArM22 TyBF7ebKLdx7qn1rJEZjetrZZbQGXkddCQCVFQFvJYm/lHYa2dCBSlKgClKUApSl AKUpQCsE78gk/JK+o1nrBO/IJPySvqNAdXl/lr/yivrrDUQx8WkOuOKxKMm5K1fy U2Fz+v31+dCxL/i8T/tFfxVcuTKVD6FiX/F4n/aK/ip0LEv+LxP+0V/FQEylQ+hY l/xeJ/2iv4qwITiDjr7beKR1FlYQsiIQL5QrmrsUKAoY/OmL/wDUHvrrLXqREVCx fEmVu71Zk7xSwnLcrSlR01/SrzVWVYpSlQQKUpQClKUApSlAf//T1sj8dF+VP+RV Y5DghqL9rocISpI/S4JPn0B8x0ANZJOio6z4KXRfzgpH0qFfgSJLqlKALSCUJBGh PBRP0j09oqpQiYm2W8GfCjdaiFLPaSofRyHcBWxWhLiClQuDWunpWrDZMcm620hS So6qQCDfy6Eea/Op3SElltxAKt4AUJ5m9AY1PqjlLbhK1LNmzwKj2HsrK22UkrWc zh4ns7h3V+JYBCi7ZalCx7AOwV+JUWFBCyS2TZCzxHcf3Hnw48QPxH5e98kj6117 caDliCUrT4KhxH2jurwj8ve+SR9a6/VOqcUUMEaGynDqE93efq+ggeOkqC9yUXkW vlB0I/SvyH0+XS+RtrKrOtWdwi2bgAOwDlToze7y2JN82Ym6s3bftr8S4pCg28Rc +CvgFd3ce7ny5gAQ5rYffWzeyl7jKRyIWpV/NlJ81fjrhlRpLhFt0wpBA5LI6w81 hr3mvUhaW8SS4s2SkJJPYAl2vC0rYiSUuaF9pbhF72XY3F/Ja36poSbSlKVBApSl AKUpQClKUApSlAKgYN+aWP73+Y1PqBg35pY/vf5jUgn0pSoApSlAKUpQClKUAqG0 2pUYqR+MQ84pPf1zcecafTyqZUBHvjPRx/Suu5v1As39NwPPflUg8qWJGGSpY4PM qKO5ABt9ZPntyqVB/II3ySfqFR5nvLElHwHW1qT3Ky6jz8fLessVxDWGx1LVYbpI 8psNB2mhJ6UkxUlbdt0Bct6AAdx5efTyV+IUJgvf3i9ikixUew9g7uPb2V7S2p1Q W8LAG6W73t3ntP0D6a/XGiVbxtWVz6FdxH7+NCDKAAAALAcqgYNphbKTxF7jsuSR 9BB89Sm3gtWRQyOgXKD9Y7R3/VUPDnEtRCVHiUADmTu0aCgJDqhEu7/RKV1kgXsT zH7x5+N7+20lxQec48UJvcJHb3n/AOhzJ/W21FW8c8PkOSR9teSDHJUkXaPED4Pe O6gI87rT8MSOIfUs+QNLF/Soemsjy1RnrIsTIVZIPALtx8lhfzdprHKIOK4cQbg7 zX+7WVDaZSS8vwVps3bkniD3E6HzDmKAPNhuOyykkkuItfiqygok99gTUqoZcUpy Klz8ah0hflyK18h41MqAKUpQClKUApSlAKUpQCsE78gk/JK+o1nrBO/IJPySvqNA dUQpKWniogAIGpP9oVg37PxrfzhWQx2JDTiZDDb6Am+RxNxe45eetM7IwFmYuMvC ImZL7bBIZSeusApFgbgWPEi1XLmNMOU3iTMlOKEtb9xbzSn7pKTfIlII4AHUdvOj EfEEYq0+9ibK42dxxbYcItmFgi3BQTYWOnM2r0/N2bi73pGHQWt2soAU0LqIvwAN +XO3Edov6EvZlQJagwHrOho7qOV2USAAbdt9O0XIvagNrv2fjW/nCoWGqSqZixSQ QZadQf8A8LVYY8jZqW40iNCw54ukhORm/InX5pqRh2RMjEWWmWmWmpIShDSAkAFp tXn1JoCn4x/6ixP5VH7JFRKl4x/6ixP5VH7JFRKqyrFKUqCBSlKAUpSgFKUoCJia XlQHNwkqcSUqAHEgKBIHfYG3fX5HeecYTuWWMgAAG+Omn6vZaplQwzu3yhJyKtdp duXNB7h5tDpwqQYcSTLXCeUGmEqQ2qx3p4W1Hg8/s7KxYS+85EaIbaU5uwOs4Umw 00GXh/s61LcdLrzMZxORZVnPYoJsbpPly6cbX7jWKO0hMuTDWOpmD7WtiArja3Cx v6aEkrPL+IY9cf4a8rVJKFBbEcpI1BeNrfNr9LjkcEvHO0P6QDVPlA+segcaIPSg lZFmTqkH4fYT3d1CDVpcmdMds22Iu7RdQeIIF1WN7Xy8df3a1s0KkhCQhiOEgaAP G1vm16HVnrv8NpOXvyk3/wAw9NC2tklTIzIOpbv/AJb8PJw8nMSf/9TW55fxDHrj /DXhxUgtq3jMfJbW7xsB82vQlpduI43qgbKsbBJ7FHke7j3V5dRu2y88d84nVKfB Tm5ADXW9tTeqlDThyTMxIMobbcQnKorLpspKc4Ivl6wuq326mp2IqkONtxy00HHV ZUFLpJHJR8HgATXmId1LeV+MWptCEcs1lLuo+U3PktUuK3mdXJUcyiMqVWtccyO6 /DuF+ZJEkulKVBApSlAKUpQClKUApSlAKgYN+aWP73+Y1PqBg35pY/vf5jUgn0pS oApSlAKUpQClKUArWMKeYnSGd0gqUrMha3CApJJIAsDwJVx148q2dYJTO9QFBAWp HBJ+EOY+gecCpBjeTLdaKQ0wlXFKt6eqeR8GtTgUh4YdFS421maQGElbhSLp6unV 4m19dTy0rZSH1NQHVBalNqbO7d4EG2gPffgfT3+UoRFxNTGVO4louE20C0gAi3em 2n9k0JJWeX8Qx64/w0zy/iGPXH+Gm6cZ1ZVmR8Ws39B5fT5q8CYHXSw0LPgXUlem Qdvf5vSKEGOS4/lSlTDRWTdAQ+Qq/aOr3/TUDBlS0IIdaYU4oJCV7wgWyJOUdXja 1+3jysNy20G7m6lLVxUo6n/fZULDEJdhKChdObIRzCkAIPoUk6916EkrPL+IY9cf 4a/C5KAJLLAA574/w15VJ6MpLT11LVo2UjVfdbkfo8nAew0t0hT5sniG0nTznn9X l40ING+uRIxqGw203ucq1K98OUgjgDl0BseVjY2reZ5fxDHrj/DUBob9iZP5rXdu /wCg0eqPISFH+9UxTu+ZLuZTcYJzFWoUocbi2oH0+TmJIpW8/i0ezbYDeYuqQ5mF gCAOA1ur662lYYzRbRmUkJWr4I+COSfMPpv21moQKUpUAUpSgFKUoBSlKAVgnfkE n5JX1Gs9YJ35BJ+SV9RoDqbqZTcdfR22HHFJFkuvhsWuDxsT9FaV5qa7ILTmH4ap 1C0SCEz1EhXBKtG/7JHmqB7JD+NR9nXF4OnTIOkrQTvEN5RqkfWeIHpEzBCVSgpR JJw2ISTz1droljrHGdre9u+1c/W9i170fjkCW6ta3MKgqUvwiZ7mo7PxfC5vbhfX jToEu4IwqCLEEWnuC1uH9Hy5dnK1bDE1SUQrxMwc3rWYpSFEIzpzkA3ucuavWGqk qwuIqaLSyygvDTReUZuGnG9Y3vRfT7Oogx8PnNuIdawrDkraGVKlT16DWwuW+wkD sFSoceRCRiEvEDFZDj2+s3IzhKQ2hOpIGvVPKtkPydf66fqNc12OkY5I9j+YrFAV Rdz/ACRxwneKTbW/anhYnXzWraOPVjlO1tW3d3fBS96M+Mf+osT+VR+yRUSpeMf+ osT+VR+yRUSsGQxSlKggUpSgFKUoBSlKAVjfbLrZCTZY1QrsP+/orJSgNcmRGede VIcQ0oWQELXlUm2pPbxJFxxsKiy5rUeTFkb9DoQvIpSFAqKFaG4HYbHs0PDSt3Sp BBTLjPKC3ZDCUA3SjeDj2n7OXHssU/FSorYmMIUTcpzgpUe8cvKPPep1KA1SsUjC a0VKGYNrBCVAi5KeCuHI8bVm6Sy9+PmMJT8W26Lec8T9HnqfSgISn4ibLYkx0KSL Zd4AlQ7CP38voqLKxNlYGRxIUjkCD1zoO4gXJ8wrb0oDUtZTJaajuJWXGcrim15g 2lNrAHlxI7Tx5VtUpCUhKQAkCwA4Cv2lQBSlKAUpSgP/1YlKUqhQUpSgFKUoBUDB vzSx/e/zGp9QMG/NLH97/MakE+lKVAFKUoBSlKAUpSgFKUoDXy7MZUKsGXXUqurg khWY37AQD5/KKi4i803EzRn2VllQdaQFi6SOQ11BFxbjrpytuqVINenEY8lIySUN NkXKlKCVeQA8PL/9jIXsPLQb37ASDcWcAIPaDfj31MpQEDprTH/umXm+9xIWP3H6 D5ah4ZOb6KtCXW27yH1Z3TawLqiLA6m4I7tefCt3SgIaXoCUqBksqK/CUpwEq/39 FRJ+JIYguttyErcWMjTiDmKSo2ubfo3v5BW3pQGujuxEtNIMhhDTSQG2g4mwA4X7 x2cB36Gv2KoPncoIUywu+ZOqVa3SAe4Wv3gVsKUApSlQBSlKAUpSgFKUoBSlKAVg nfkEn5JX1Gs9YJ35BJ+SV9RoDojuFx3nVOLdmZlG5yzXkjzAKsPNWJcZjB4s2dHb eeeDBUQ7IWsrCAohN1k21J9NbSY9DhzzCW4npG7W8lveHMUJKQT4FvhJ9NeW3Wlw m5KkhIW0l3JvSSAU3t4HfVy5o5O0rMBNpkR9t0EpKUFKhmCEqsDcfpgctb8taywt oo02YmIiPJQ8pkPZVpToCLgXBIva3prfw2FS4TElLQSHm0uBJe4XF7eDWb2vX+gn 13/xoDSNpTiuGxnXt80HEJdKGZC0WJHC6SCeNY14HCcQUOKmLQeKVTXiD5QV61v/ AGvX+gn13/xp7Xr/AEE+u/8AjQHMsY/9RYn8qj9kiolXubsOzNnvy1SZTa3lBSkt vIyghITpdongkc6w+58z49N9c39zUURRSqVdfc+Z8em+ub+5p7nzPj031zf3NRRF FKpV19z5nx6b65v7mnufM+PTfXN/c0oUUqlXX3PmfHpvrm/uae58z49N9c39zShR SqVdfc+Z8em+ub+5p7nzPj031zf3NKFFKpV19z5nx6b65v7mnufM+PTfXN/c0oUU qlXX3PmfHpvrm/uae58z49N9c39zShRSqVdfc+Z8em+ub+5p7nzPj031zf3NKFFK pV19z5nx6b65v7mnufM+PTfXN/c0oUUqlXX3PmfHpvrm/uae58z49N9c39zShRSq Vdfc+Z8em+ub+5p7nzPj031zf3NKFFKpV19z5nx6b65v7mnufM+PTfXN/c0oUUql XX3PmfHpvrm/uae58z49N9c39zShRSqVdfc+Z8em+ub+5p7nzPj031zf3NKFFKpV 19z5nx6b65v7mnufM+PTfXN/c0oUUqlXX3PmfHpvrm/uae58z49N9c39zShRSqgY N+aWP73+Y10T3PmfHpvrm/uaxsexxFjMpaamzQhN7Dftnib/ABNKFH//1olKuvuf M+PTfXN/c09z5nx6b65v7mq0VopVKuvufM+PTfXN/c09z5nx6b65v7mlCilUq6+5 8z49N9c39zT3PmfHpvrm/uaUKKVSrr7nzPj031zf3NPc+Z8em+ub+5pQopVKuvuf M+PTfXN/c09z5nx6b65v7mlCilUq6+58z49N9c39zT3PmfHpvrm/uaUKKVSrr7nz Pj031zf3NPc+Z8em+ub+5pQopVKuvufM+PTfXN/c09z5nx6b65v7mlCilUq6+58z 49N9c39zT3PmfHpvrm/uaUKKVSrr7nzPj031zf3NPc+Z8em+ub+5pQopVKuvufM+ PTfXN/c09z5nx6b65v7mlCilUq6+58z49N9c39zT3PmfHpvrm/uaUKKVSrr7nzPj 031zf3NPc+Z8em+ub+5pQopVKuvufM+PTfXN/c09z5nx6b65v7mlCilUq6+58z49 N9c39zT3PmfHpvrm/uaUKKVWCd+QSfklfUavo9j1lSgBOm6m345v7mtLN2dwdLch gYlNddQtplxoOouneqCUk+8jTrX48jShRZ5sFT8x9a5kklSlDinQE8OHCsAw2zSW hNlZEpCAMydABYDh2VnxnApWIykONpU0ppailzcFZFyPBubA6cbHutWrZ2SxZleb 2zmquoqWC2sZ9ANbKvy7fJbjVixZY81UaM1HbZaDbSAhIOY6AWHOsnto78U16Ffb VXkbGypMFMdT0lJAeBUG1nMHSCoG6ibWuOPMHlr+vbJ4q6pKvbGYClZWk7td09Qp 061tb3P0ZaAtIxJe7UtSY6Ep4lWbv7+6v0YiSSAqKSDY6L0rUKjPQsHEWVHmSyoB CiiOtZWLEEm17ce2tErCUrebcci4yshKQu8N73wheY35EK4EEcAnstQF0GIlSQpK opBFwQF61rUbTvv4lLgwsKdlrihG9W0UJSM17WzuJJ4HlVcgYSYG7yRsXOQt/wDs XutlFgCOFu4AeCnjl13ey0Gc3jGNTnYUhpiUWQ0XUZFKy579U6jiOVAT/bfF/wCr kn1jP31PbfF/6uSfWM/fVFb2UlRI8SPh85+KwwyltTaUKs6QbqUbLBBOg0NwOdbT DMOmwTJMiS/L3rpWgLTbdj9EXUdB+6gPS8QW0Ql3ozazbqqzXv2aGntgrtjehda2 fKW3ib1oOIuADIS3EcKVDS9iBY8PJUMvgpAOEYkTpf8AkLgvY8NE3t3X1oDcS8ZE OG9JcDCkNIKiEpXc27KyOYoGnXGlORN4hOZSBnuB227NDVaxEvSsMkxo+F4nvHUq CQqG4Bc8Lkp+k0lIW5PkyEQcUKVrU4lPQHB1inJxtwsBp269lgNw3tJvIiZXR0JZ KErzLOUAEA63V317dx9TCFLdYabSkAqUtQAF9BfrVroWCTl4Qw0vex1hpCShTSjq EpGthcWIPAg/RRzZRam1BtxbbhbbbDiWlpICM1joBrZXkuOFtKA2aMcccBLcZtQS opOUg2I4jwuNfr+Nrjl3eMNJS0bLWTZI85V31Ew7AHcOZcbSpawpeYEtr0GUJA4d iR3dgA0rJLwmVKcklC3GgtZKbtKIVwsTYXHDSxB+igMh2gslaiyyEoVkUSsWSrTQ 9bQ6j01+t48t3Pu47a8iihWVQOVQ4g9bjWnGxriYymUvry2KUksK0Sc41sOPvq+z 4OmhvsYOCPwmnG87i0qcKkgoX1RpoLg9l/KToOFASncacZccQqO31FZSb2F7X5q7 KxHaIJSlSmmQlSCtJKxYpAuSOtwtzqFi2zK8XkqcWt9kJW7lyoPWC0ZCfB04nsNR 39j3pG5K5LuZohQIbcF1AkjXja6jzva1iDckDcjGnlJCkxEkEXBB4/4q9u4s807u +jNqVr4N+XlV31hj4U9HjNM3WvdoCMym13Nha50r07CkOTlLDTgR1rKLatbkW5UB +nGnkpKlREgAXJJ4f4q/EY444kKRGbUCkKBSQbg8D4XCvErCXZUR6OrMkOtqQSG1 6XFuyo8PZ9cVqQhd3ukOKW5mZVbrcQBbwb307+dASU4+pSilLDRIAJAUNL8Phc+V e/bt21+iote17872t4XbWkVsWpamCZDwDC21oytHikIGt0m497T5DfjpbYfg+owo 0ZQUrcKbWlZaVfMkg34cTY38poCSjHlugFuO2sG9ilQN7Gx+FyNSV4k6hakFpm6T Y2zfbWjgbJLgzkTA+8txLO5Kd0oJKbJA+DcGyE311PoravRpCnnFCO6QVEjqHtoD L7aO/FNehX209tHfimvQr7aj9Ek+Lu/MNOiSfF3fmGgJHto78U16FfbT20d+Ka9C vtqP0ST4u78w06JJ8Xd+YaAke2jvxTXoV9tPbR34pr0K+2o/RJPi7vzDToknxd35 hoCR7aO/FNehX209tHfimvQr7aj9Ek+Lu/MNOiSfF3fmGgJHto78U16FfbT20d+K a9CvtqP0ST4u78w06JJ8Xd+YaAke2jvxTXoV9tPbR34pr0K+2o/RJPi7vzDToknx d35hoCR7aO/FNehX209tHfimvQr7aj9Ek+Lu/MNOiSfF3fmGgJHto78U16FfbT20 d+Ka9CvtqP0ST4u78w06JJ8Xd+YaAke2jvxTXoV9tPbR34pr0K+2o/RJPi7vzDTo knxd35hoD//X6b7aO/FNehX209tHfimvQr7aj9Ek+Lu/MNOiSfF3fmGgJHto78U1 6FfbT20d+Ka9CvtqP0ST4u78w06JJ8Xd+YaAke2jvxTXoV9tPbR34pr0K+2o/RJP i7vzDToknxd35hoCR7aO/FNehX209tHfimvQr7aj9Ek+Lu/MNOiSfF3fmGgJHto7 8U16FfbT20d+Ka9CvtqP0ST4u78w06JJ8Xd+YaAke2jvxTXoV9tPbR34pr0K+2o/ RJPi7vzDToknxd35hoCR7aO/FNehX209tHfimvQr7aj9Ek+Lu/MNOiSfF3fmGgJH to78U16FfbXlzGC02pxxLCEJFypRIA896w9Ek+Lu/MNYJeFypLaQlp1C0KzJJbJF 7EajS/HtoCccXWDYoYB07eeg514RjYccU2joyloNlJSSSPKL1X29j3GtwEKl5Wlo VZSCb5V5we48E3/RuOenuRstKfedX18qySG1xypIusKOl+JsRpbieZJIFgOKuJFy 2yBe2t/tr8bxguoztpYWkkjMkkjTQ860sfZlxhlTZaecPSEvha21KVmSQeJJ1Ntb W1Uo21qRhmCyMNhJjBEh0JsApSVHQAAcbngBz9AsABthigLimg5ELiAkrQColNxc XHLSv1WJ5fCXFGhOufgOJqp4thaZMx5YjYul4uJVvG4rpCSlCU2TpbikG44kDjXl uAlENEboOLFCFJI/kLg0yhKk2twVYk96iaAtqp6nGjkdjpzJ6q0BVxfmOVVufDYj hgOzH3i48ChF9CtALgKuqNPe/qrWt4OptDgDWOBawkF0RXsxsDbu424AaJA141kT hkjpscRoWJFO9zKL0VxOUBhxAJURqbqSOXLvJA//2Q== ------------k13hhMHZSZvV30HfFHdb1w Content-Disposition: inline; filename=tutori13.jpg Content-Type: image/jpeg; name=tutori13.jpg Content-Location: http://zippy-egoboo.sourceforge.net/images/tutori13.jpg Content-Transfer-Encoding: Base64 /9j/4AAQSkZJRgABAQEAYABgAAD//gAcU29mdHdhcmU6IE1pY3Jvc29mdCBPZmZp Y2X/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0aHBwgJC4nICIs IxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIy MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAAR CAGwAkADASIAAhEBAxEB/8QAHAABAAIDAQEBAAAAAAAAAAAAAAUGAwQHCAIB/8QA XxAAAQIEAQQIEAsEBgcIAwEAAAECAwQFEQYSFiExBxMUQVFWldMVIjZSU1RVYXWR kpOx0dLhGCMyNXFzgZShsrNCYnTiJCVlcqLBMzRDY2SE8BcmN0SCo6TCCEWD4//E ABoBAQACAwEAAAAAAAAAAAAAAAACAwEEBQb/xAA+EQEAAQMBBQQGBwcDBQAAAAAA AQIDEQQFEhMhMRVBUVIiMmGBkaEGFHGSotHhIzNygsHS8BZCsUNjssLx/90ABAAo /9oADAMBAAIRAxEAPwDki9D3S8lLQ5aGj3svHiufd2VddPe0b2j/ADWz4ck8DPpU n0Xio2ebHYkZr4j0a+Gs1BRyqqKllSFtv0o5V1tQ6JVqXRKfEjOZh2lOhQYLYjl3 DDW6ucrUS90tpTgXf+3dp1IwxU4MSLAw/T2thxFhqkSShot0RN63fN3T6i3amavS zPt9s/8AxmuZriIxHJyeBJYKq1NgOWZfSZlkZ+2LdXba1NztRMlzlyLq+M5Fyltk uvotbH0AwgrHpnHFhuViq1zmNdkKm6FsqNvfRBgpdF0rGRU1WOovksNS73rHodIV NudCSDDlIW2MsrtLr60VG3TQi6URL3NdkTCDkhK7DcpD2yE6KmVJwL5KLkqtkW66 b6r6lXVpNztOnuz8lW45ZOUzDjHTkrAqLcqXl3x4UfKyljPVG5MJVTpVtZyorUve JZfk6NylSWFJqnym75iXlIj5aK165cRz1ipbJcqo5Ual9FshLa+nQ6MkTCLmQ3ph uTRj4m1tV0lBRHLZFXSq6LZSXVfeSVOpWGak16w8OyMPJ02iSUJFVMpzb6EXfauu y94zO1KZjHP4m44xWKTh+Xo0KYkqskWf2mC6JAbZW5SsZltReFHK7Te2jQmnRsvp 2F6hNRndEIVMgw5SWVqQsuIixHSyvirZyqq2jI2Hkov7d9TVv1KZk8OSc/MQo1Ap KwoVkyWysJHoqrDRFVXWSyrE73yV1mGA7CsZ2SuGJPLdHWCxiSUFFVb2TXbXr717 LvXz2pTjv+RuOY1OlYXl1pctLVPLWLOxWTcdrstYUJWQchVt0qoirFW6JfWm8ZKn JYVgUSB0PjsmZqHMMSJEdGcx0ViRJhInS6URMhJZUsl+mXWqKidep9IwxUob3wcP 05qNyb5UpC32o5NV95TTmZDD8pU1lomH6SsPLRvSykNXI3IVyuXg08NtCX0pe2O1 KcR1+JuOfVanYLdJwY1OjSsKbhxXK+C+O90OJfaEbDXp72s6M7LR1kVioqpdLU6v MkIdcnGUxWrJNiWhZLlclu8q6dd99fpXWdzk5fC026A1MOSLVjKiNV0nBRFvlabX VbXY78OE2anRqDT2yzm4apsbbY21q1spDv8AIcqW0cKIn23M29qUUdYmfeTQ85A7 w2Zwe3pImHZFYzYLIkRGScGyZSJoS9lXSv4cBmh5pxHRLYbk1ayIjFduOBZFVFVN N7W6V2nV6S3tijyyxw5cBB6OWjYcfRFqUHD9MVqy23sa6Uh6snKRFsi/gR+04blY 25Z3DcgkyjlRciRhImpF03VUTQvXKm+qpqR2xR5ZOHLgIO/Wwqj4UJ2GZJY8Z1mQ 2SkF17vyU06tOvXq4dF8O6MIrNQIbcOSSsi3RHJJQlW97J9CaF12XVwjtijyycOX Bwekp/D9AlJXbWYcpsV22Q2ZDZSEirlPRui6Im+QrouFobIG2YZkEiOWCkVFlIKI 3bGZSWVbJoVURftHbFHlk4cuDg9MQcN4cjQYcVtBpqNe1HIjpOGi2VN/Qfea2Hu4 NL+5w/UO2KPLJw5eZAem81sPdwaX9zh+oZrYe7g0v7nD9Q7Yo8snDl5kB6bzWw93 Bpf3OH6hmth7uDS/ucP1DtijyycOXmQHpvNbD3cGl/c4fqGa2Hu4NL+5w/UO2KPL Jw5eZAem81sPdwaX9zh+oZrYe7g0v7nD9Q7Yo8snDl5kB6bzWw93Bpf3OH6hmth7 uDS/ucP1DtijyycOXmQHpvNbD3cGl/c4fqGa2Hu4NL+5w/UO2KPLJw5eZAem81sP dwaX9zh+oZrYe7g0v7nD9Q7Yo8snDl5kB6bzWw93Bpf3OH6hmth7uDS/ucP1Dtij yycOXmQHpvNbD3cGl/c4fqGa2Hu4NL+5w/UO2KPLJw5eZAem81sPdwaX9zh+oZrY e7g0v7nD9Q7Yo8snDl5kB6bzWw93Bpf3OH6hmth7uDS/ucP1DtijyycOXmQHpvNb D3cGl/c4fqGa2Hu4NL+5w/UO2KPLJw5eZAem81sPdwaX9zh+oZrYe7g0v7nD9Q7Y o8snDl5kB6bzWw93Bpf3OH6hmth7uDS/ucP1DtijyycOXmQHpvNbD3cGl/c4fqGa 2Hu4NL+5w/UO2KPLJw5eZAem81sPdwaX9zh+oZrYe7g0v7nD9Q7Yo8snDl5kB6bz Ww93Bpf3OH6hmth7uDS/ucP1DtijyycOXmQHpvNbD3cGl/c4fqGa2Hu4NL+5w/UO 2KPLJw5eZAem81sPdwaX9zh+oZrYe7g0v7nD9Q7Yo8snDl5kB6bzWw93Bpf3OH6h mth7uDS/ucP1DtijyycOXmQHpvNbD3cGl/c4fqGa2Hu4NL+5w/UO2KPLJw5eZAem 81sPdwaX9zh+oZrYe7g0v7nD9Q7Yo8snDl5kB6bzWw93Bpf3OH6hmth7uDS/ucP1 DtijyycOXDdjpsg/HMglTZKvk8iOr2zbWuh3SC9W3R2j5VrX37HUlnMIzaSseBSa HDVkWNeDFlJdivtLxVbdET5OVk699ELBmth7uDS/ucP1DNbD3cGl/c4fqOfqtZF+ uKomY5f53pU04c/SFS16GbsWgx2vrUoirClJeF8VldOio2G1Uh6USzr6lutjJila X0DraQ5PD7IaQ/6G+Vl5Zsa+W291ZpTRfJyf2b5VlL5mth7uDS/ucP1DNbD3cGl/ c4fqKab2MelPKf8AO9nCWs90faYcN0R9r2aqJosi76p1yGVJWaVyIss9EVdaubo/ E/JVrotTibU9WrtStSI1L5K5DE+jWRuHsN1mm4kqs7Nz8OJKTUbbIMNkRznNbb5K 3TTvaVVV0LvuulFNNM0zMzjHzZmW4r1TK6XpW5OU5XtaiZS2RLqqa1Mu5I2WkSJL KxWtVEe5WrZNapoW+myeJDG+n9E6fUpXJbeLARsNztCNf01lvbRZVRSHwpTK5Izd UfPSqyVOc20vKrGSIqKiL010VbrbWt9OjXbRVNWJiFtFrfpqqzEY8Z6/YlYUeFHR VhRGPRFsuSt7H2qqjmta1XK5VSyKiakVd9U4CGbR3sqzo0G0KEr0i7YxbOvvstvp oRdJPSzcqel+luiOW+jeyXEbdVVUTvRhrWa66onfjGHy6UjvZd0m5zdDtLmKmjSi 6/tPh72MmHQFiM21utqO0+ImHNiQLtYx0SE7RZFS7PHbpe8mkqlepT5+oZcOXl1V qubtr4zmrpXSitRvTJoTQqpfUZqqmIzEN2zat117tdWI8eX9Zh//0L7EiMhMyoj2 sbdEu5bJdVsn4qfRrwpOFDp8OSem2wmQkhLtiXykRLaTHJQZiVc+A9+2y7UvCiOd d6J1ruG28vj4Vjmc9Fs0UTTOKucfOPz9jYjR4MvCSLGishQ1RFRz3I1NKXTWfaKj mo5qoqKl0VN806lT2VKRgwX2R0NsN7bpdEcjbaU39/Qp80mWjy0s5kZVRMrpGKt8 lLJfh3720rotfTckqfT56lxmZb5qTexWKmUsRqorVtdPoXpfwPqcnKdCcktOzMqx YjbpCjRGplJ9C60NVFmloyS24ZhIu59r+Uz5WSidf3+HeXTqvgq8CoOm4jpSThzE OJChtVH5OhWuet0VXJZUykstl/ACVlY8rHg2lIsGJChrkfEuRUbZE0aNWhU0G22X iuiQ4aQ1V8RqvYnC1NakLQYMzCl5lZmFNQ3PjZTUmojHvVEYxt1ViqipdF7/AAkZ VZKsTE/Ox5dtTakWG2VhpBqSQ2w2qumMxP2XJwb9iNWeUU9Z/wA932zyYqzFO9Hd j/nHT/MdZ5LTEyoblarVV6fspr1onpVDHBgQoUSPkQYcJyNfFi5OTdVRUvfJ39Ig S25khS7I0aYSGxrEixVVz32ezSq76rZVMj4MGWmqirIboSPgxnuy7dM5cnSneUW5 mqiKp6/D5TzhPHUPxzGvSz2o5LotlS+lFui+MiZ6kRpqaixYMZkHLazp8m7kc17X cF0SzdSLbTqRUuv5Dp1SZM7as90jphYjod1yUZdFRqaN7pvpul9SISRZmVhkaZSX gy6xIrojoUNizcsx8RyOVmhj4qO+UiomjSbsylTk4Do81RJqBBbbKiRZmVa1LrZL qsW2tSj1fC05VX5ErhuYiT0d0xDhz6xIjGQ0fGiWV14iNRtlaqqjVVU1abKXzZDo lWqGEZGBJPiTsWW2tszChxFR8dt2I9U6ZFVVaj0XSi2etl4QxSq1KegpGlKNMzEJ VtlwpmVe2/0pFM25K3xdnvPS3OmXC9IWHhOTloNJhyTYU2+K+Smo8RMpFa5L5Tli O1qip9GixOTlPqUSbWdlZ6DDmUa2E1r3qrFhoiP0oiJ0yvTJVU0ZC6rgV7clb4uz 3npbnRuSt8XZ7z0tzpuTWGaq5J/c9VhqswyCxqviuRFsiK9yol8lyubdLX0Ocm+b USgTMd0RroktBgxchGJBjLlSTUXp0hLk/tpr+Ta9tKIBE7krfF2e89Lc6NyVvi7P eeludJmJSarMNbFm52VjTEOK18JGuVjGfKV17oqu6ZyIiJkrZjVRzVPyLSKn0Sjz 8CalIczFgLaMr1VWxLRUazJybKxMqFp0XWHdW3UCH3JW+Ls956W50bkrfF2e89Lc 6Sq03EcaIro1Wl0XczoV2PsuU5G3clmJaype+ldFkyb3T7fCxU2fasOflHQLRXWi Oarb5TchHWho5elumhUsqKt10NAh9yVvi7PeeludG5K3xdnvPS3OknM0eu7miysl VJeFLvSLDdlPynqzamQ4a5St0O6VyrbfU+3U7EEvAgOk6nLJGaxjI2X022I1Lqul PlK90TToumTdUW9widyVvi7PeeludG5K3xdnvPS3Om6yTxbMwoEWLUIMGIx8V6Q4 kWGrm3ykZdWwslbIunh0aEVMpd9kviVIq5dUlMhVVLpk9Kitte216bO6ZEumqyq6 90CD3JW+Ls956W50bkrfF2e89Lc6TLZDEUBdrl6tL7Q2M/a2PVFVkH/ZtvkKqqmm 91uqInTXVVNF9Jxc5Jm1Zkk21Ib25S3tFbk9NoYnS9L8lPtvdVA1NyVvi7Peelud G5K3xdnvPS3OktFpVenJNGTVWgbfCiwo0F7HWTKasNVvZqaOliaFvlbZptZD8h0z Ekum0wa1B2lFjKjnK1XOVbqy92Lvql9OpbImi6hFbkrfF2e89Lc6NyVvi7Peelud JVJXE8nBk2wZ+Vjw5djWxISKiLGVETRlOboTeVb3siusqqjUzLBxIs09EqMHaGIj UVXMasXpWdMnxbsm7stVvfXZETQ4CE3JW+Ls956W50bkrfF2e89Lc6XKm7rhS7m1 CZhRo2Wqo5lkRG2Syak0pvrvrdURqKjG7m2M69vjAoO5K3xdnvPS3Ojclb4uz3np bnS/bYzr2+MbYzr2+MCg7krfF2e89Lc6NyVvi7PeeludL9tjOvb4xtjOvb4wKDuS t8XZ7z0tzo3JW+Ls956W50v22M69vjG2M69vjAoO5K3xdnvPS3Ojclb4uz3npbnS /bYzr2+MbYzr2+MCg7krfF2e89Lc6NyVvi7PeeludL9tjOvb4xtjOvb4wKDuSt8X Z7z0tzo3JW+Ls956W50v22M69vjG2M69vjAoO5K3xdnvPS3Ojclb4uz3npbnS/bY zr2+MbYzr2+MCg7krfF2e89Lc6NyVvi7PeeludL9tjOvb4xtjOvb4wKDuSt8XZ7z 0tzo3JW+Ls956W50v22M69vjG2M69vjAoO5K3xdnvPS3Ojclb4uz3npbnS/bYzr2 +MbYzr2+MCg7krfF2e89Lc6NyVvi7PeeludL9tjOvb4xtjOvb4wKDuSt8XZ7z0tz o3JW+Ls956W50v22M69vjG2M69vjAoO5K3xdnvPS3Ojclb4uz3npbnS/bYzr2+Mb Yzr2+MCg7krfF2e89Lc6NyVvi7PeeludL9tjOvb4xtjOvb4wOfRYVXgMy4tAnWN4 Vjy1v1TDBmYr5rc8aSjS71hOior4kJyKjXNavyHu33t1lvxPGhtocVipMP2xUYiS 0J8R6d+zEVU+kodHlo0CahMXopGbBkYzYkzPS0SGrnOiwVRLua1L6FsibyASE1NQ pR9omXZXNaxGsc9VVWI5dDUVeHxH4s5Ko9WrMwcpFVLbYl9C2XxKJmWSbflK6JDV j2uY5ipfQzJXh3rkbGw1IxoEWEqxUy1aqLlfJyWq1v2Ii279tIEkk5KqiKkzBVFa jk+MTSnD9GhfEfrZuXeqNbHhq5bdLlJfSl00fQqEc/DkjFjpGirFiPRkRt3KmnLv lLq0a72TQi6bXufsPDtPhq3pXqjWIxqK75KI5HaN/wCVdftXeAkpWXmqtU4crIzk tBYsusfbIkBYyOTKaiWs9vXa9JKZpVju1I8nP541cPMg0uptjxItoLJZYKXRVc5y uat9CW3l8ZaOjtP7K7yFAgc0qx3akeTn88M0qx3akeTn88T3R2n9ld5Cjo7T+yu8 hQIHNKsd2pHk5/PDNKsd2pHk5/PE90dp/ZXeQo6O0/srvIUCBzSrHdqR5OfzwzSr HdqR5OfzxPdHaf2V3kKOjtP7K7yFAgc0qx3akeTn88M0qx3akeTn88T3R2n9ld5C jo7T+yu8hQIHNKsd2pHk5/PDNKsd2pHk5/PE90dp/ZXeQo6O0/srvIUD/9Hp+aVY 7tSPJz+eP1MJ1hL2rUhpSy/1a/Vr7N3kJ3o7T+yu8hR0dp/ZXeQoEDmlWO7Ujyc/ nhmlWO7Ujyc/nie6O0/srvIUdHaf2V3kKBA5pVju1I8nP54ZpVju1I8nP54nujtP 7K7yFHR2n9ld5CgQOaVY7tSPJz+eGaVY7tSPJz+eJ7o7T+yu8hR0dp/ZXeQoEDml WO7Ujyc/nhmlWO7Ujyc/nie6O0/srvIUdHaf2V3kKBA5pVju1I8nP54ZpVju1I8n P54nujtP7K7yFHR2n9ld5CgQOaVY7tSPJz+eGaVY7tSPJz+eJ7o7T+yu8hR0dp/Z XeQoEDmlWO7Ujyc/nhmlWO7Ujyc/nie6O0/srvIUdHaf2V3kKBA5pVju1I8nP54Z pVju1I8nP54nujtP7K7yFHR2n9ld5CgQOaVY7tSPJz+eGaVY7tSPJz+eJ7o7T+yu 8hR0dp/ZXeQoEDmlWO7Ujyc/nhmlWO7Ujyc/nie6O0/srvIUdHaf2V3kKBA5pVju 1I8nP54ZpVju1I8nP54nujtP7K7yFHR2n9ld5CgQOaVY7tSPJz+eGaVY7tSPJz+e J7o7T+yu8hR0dp/ZXeQoEDmlWO7Ujyc/nhmlWO7Ujyc/nie6O0/srvIUdHaf2V3k KBA5pVju1I8nP54ZpVju1I8nP54nujtP7K7yFHR2n9ld5CgQOaVY7tSPJz+eGaVY 7tSPJz+eJ7o7T+yu8hR0dp/ZXeQoEDmlWO7Ujyc/nhmlWO7Ujyc/nie6O0/srvIU dHaf2V3kKBA5pVju1I8nP54ZpVju1I8nP54nujtP7K7yFHR2n9ld5CgQOaVY7tSP Jz+eGaVY7tSPJz+eJ7o7T+yu8hR0dp/ZXeQoEDmlWO7Ujyc/nhmlWO7Ujyc/nie6 O0/srvIUdHaf2V3kKBA5pVju1I8nP54ZpVju1I8nP54nujtP7K7yFHR2n9ld5CgQ OaVY7tSPJz+eIqqyU3RnsbOV2nw0f8lXSKtRfHHLn0dp/ZXeQpVcT2rUzCSHK06Z l4TmxGLNxXtcj01KiJCciW4bgatMdEmIu1R4jYitmXwVeyHtaORIaORclXOst14d 4xpPwEiMhRHK2I6Gj16RclqLe13WsmpdamamQYsrFa+YWCr3zESM5sBznNam121u a3reA1uh0vFdDjRoXxzWQ0vou3IdlIiL9OvhAzJOSquRqTMFVVFVESImm17/AJV8 S8B8R5lXQoSSkaCsSNHgQWvVMtrUiRGtRyoipfQ6+tLmhmvTVZHa9sR6R2ZES7k0 pdF3k/dTTv797m1LUiBKxIO51SGm6paNEulktDiteqojU1qiLva7akAmJPD1SnpZ kxL1uTWE9Ltc6lRWXThRHRUW3fM+aVY7tSPJz+eNecoeGpuTgSqTM3LwoMOFDRIC IzKSGrlS/S7+W6/0rwqbEnT8PSFWbUYExMtiMiRIjYdrQ25aWVEajdCImr/MDFL4 bqM3AbHl6/TosJyqiPZT3Ki2Wy2XbuFFMuaVY7tSPJz+eJiWqtMlITocONEVFiPi dM1db3K5d7hcpm6O0/srvIUCBzSrHdqR5OfzwzSrHdqR5OfzxPdHaf2V3kKOjtP7 K7yFArE/QKpTpN81GrUjtbNLl6HuSycOmMRMnMRIs62Hu+Wm4LpeJFR0GXyLK18N tr7Y+/8ApF4NRa67VIc5THQJLaIsR7kRzZhzobcnf0ox197RYqdNpr5GOy0GnSsr BlIkCFBlIj3aXRIbtSw2oidIu/rUD6q0/FkHM2mW3Q+LEbDaxFVP9llbzV63vJpu qmpExFChz0WVWWj3hxMi9rZSbXlttffct2o3Wqoq8F6zF2XcMQ5mI2Kk4r2vtogJ oVEyeu7xjfsu4SiNc18Kcc13ykdLot9FtOng0AXCUr0pOrC2psVEi2Viuba6LdL8 KaWqnDfetpLBh7DNNqVFgzk3u18eI+JlObPx2poiORLI16ImhE1IcrgbKuDJZESB KzMOzspMmWall0pfXwKqfQpNUzZ4wrS6fCk4UvPvYxXLlOYl1VXK5d/hVQOm5l0T rJ7lKZ5wZl0TrJ7lKZ5w578IjDPak55v3j4RGGe1JzzfvA6FmXROsnuUpnnBmXRO snuUpnnDnvwiMM9qTnm/ePhEYZ7UnPN+8DoWZdE6ye5SmecGZdE6ye5SmecOe/CI wz2pOeb94+ERhntSc837wOhZl0TrJ7lKZ5wZl0TrJ7lKZ5w578IjDPak55v3j4RG Ge1JzzfvA6FmXROsnuUpnnBmXROsnuUpnnDnvwiMM9qTnm/ePhEYZ7UnPN+8DoWZ dE6ye5SmecGZdE6ye5SmecOe/CIwz2pOeb94+ERhntSc837wOhZl0TrJ7lKZ5wZl 0TrJ7lKZ5w578IjDPak55v3j4RGGe1JzzfvA6FmXROsnuUpnnBmXROsnuUpnnDnv wiMM9qTnm/ePhEYZ7UnPN+8DoWZdE6ye5SmecGZdE6ye5SmecOe/CIwz2pOeb94+ ERhntSc837wOhZl0TrJ7lKZ5wZl0TrJ7lKZ5w578IjDPak55v3j4RGGe1JzzfvA/ /9Lr+ZdE6ye5SmecGZdE6ye5SmecOe/CIwz2pOeb94+ERhntSc837wOhZl0TrJ7l KZ5wZl0TrJ7lKZ5w578IjDPak55v3j4RGGe1JzzfvA6FmXROsnuUpnnBmXROsnuU pnnDnvwiMM9qTnm/ePhEYZ7UnPN+8DoWZdE6ye5SmecGZdE6ye5SmecOe/CIwz2p Oeb94+ERhntSc837wOhZl0TrJ7lKZ5wZl0TrJ7lKZ5w578IjDPak55v3j4RGGe1J zzfvA6FmXROsnuUpnnBmXROsnuUpnnDnvwiMM9qTnm/ePhEYZ7UnPN+8DoWZdE6y e5SmecGZdE6ye5SmecOe/CIwz2pOeb94+ERhntSc837wOhZl0TrJ7lKZ5wZl0TrJ 7lKZ5w578IjDPak55v3j4RGGe1JzzfvA6FmXROsnuUpnnBmXROsnuUpnnDnvwiMM 9qTnm/ePhEYZ7UnPN+8DoWZdE6ye5SmecGZdE6ye5SmecOe/CIwz2pOeb94+ERhn tSc837wOhZl0TrJ7lKZ5wZl0TrJ7lKZ5w578IjDPak55v3kth7ZnpGJ6p0Op0pML H2t0T4xMlLNS66QLZmXROsnuUpnnBmXROsnuUpnnDa3fVu47vPs9ZTcUbL9MwfV0 pdWkphk1tTYuTDs9ERb2037wERW9xyb6tJS8rU2RpWViRmTKzcysPQi26ZYllW6a rb2qxZJtqMiTTWoiI16IneTbGocunNk/Cs9CmIUepYicyO1zYiJDl0ujtf8As++b 8xszYXjRIrkSeakR+UqLARbdMjrfK7wFmfXNpko81GlnJDhTKwOlyl6VImQr1u1E sidNove1kVVMbMTSq5KRIEwx7kiOycm+SjFXKRV3nIiI5W67KlrlWZstYQhq9WQJ pqvdlvyZZqZTtd106VMcXZTwXHitixZSYfEYt2udKtVU1rw8KqoF/kmS1bq1Pl3r HSXfFite2HGfCV2SxyppYqLbUustOZdE6ye5SmecORSezHhKTn4E2kKeV0Bz3Na2 CjUVXIqKq6e+q/STfwiMM9qTnm/eB0LMuidZPcpTPODMuidZPcpTPOHPfhEYZ7Un PN+8fCIwz2pOeb94HQsy6J1k9ylM84My6J1k9ylM84c9+ERhntSc837x8IjDPak5 5v3gdCzLonWT3KUzzhA4opFJw/T1nGStTjMb8pkGdmYjrcKNSJdSt/CIwz2pOeb9 5F1fZuw1V1h3jViVRn7MvChWd31y2u/CwFopqNbNxmsZGYzLlXJDjRnxHNVyuvpe 5ypqTQi20GKs1ptIWI50vEjJ8e5qQ+FrrNavAiqqJfUi2KZLbLGE5V7npFq8aJEi Q3PfHhQ1WzFWyIjEam+pkXZfwq5Xq9s45XOcq/0dNTluqfKAtU5iKVk0iXhRXLDV VfZNTEfkK7v6bpbWqpqtpPvd8GpshQIe6IWVNysKK1cqE9GvjMa5LoqKmjKS6d+y lOdsr4Oct3S0yq5Svusq35SpZV167H63ZZwe10G0Kda2FFhRUSHAa26w3I5qa9V2 on0AdJbJ4VgNRtTdMyca8W7eik09rWw3Oa56uykRrekct1siIl13z9bL4MWC6LEi VOCjXxmOSLNzjVRYSXeqplaERLLp3l+kp7tnjBj4sOK+kRHRIblexyy7VVrlXKVU XeW+n6TE3ZuwK17XtoVnNY5iOSUZdGu+Un0LdbpvgX2SpGF6jOMl5NKjFRYToixN 3zbWpbI0aXpdbPRdGrf1knmXROsnuUpnnDmkDZ4wZKxViy9IiQYityFfDl2tXJ0a LpvaE8Rs/CIwz2pOeb94HQsy6J1k9ylM84My6J1k9ylM84c9+ERhntSc837x8IjD Pak55v3gXSsYWpMhTIszCgz73w9KMSozCq7vJ8ZrKtSY0CZm4MeWl52XhRpKNE2u bixlddIsFEXJiPdbQ53BoUh6ps8Yaqknua9UlUVyOV8CHDyltvdOjkt9m8aFG2Rs Mz1elZaBM1mYnJtUkoKTLISMasSIzSuQxq62t3+EDg0/84TP1rvSprmxP/OEz9a7 0qa4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAH//T8/gAAAAAAAAAAAAA AAHQthnq+T+Dj/lOenQdhrq9/wCSj/lA9dZf7yHlf/8AIFb7Jl/+Bhelx6fylPL2 z9p2SU/gYPpcDLlwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAT2COr7DnhSW/VaQJPYI 6vsOeFJb9VoETP8AzhM/Wu9KmubE/wDOEz9a70qa4AAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAf//U8/gAAAAB0HYa6vP+Sj/lOfHQNhvq7/5K P+UD1ffvnmHZ9/8AEhP4GD6XHpfbE4DzNs9LfZGav/AwfS4HJzAAAAAAAAAAAABr AGxKycaceqQ0RETW5y2RDbk6WsS0SY6VutGalX6eAl2MyYbWw2WamhLJkp+Jr3L8 U8qV9uxNXOpWY0GJAiLDiNs5Px+gxlmmZZsxDyIzXJwK5NX2oQU3JRJVbrZ0NdT0 1ErV6K+U9WLlqaecdGsAC5SAAAAAAAAE9gjq+w54Ulv1WkCT2COr7DnhSW/VaBEz /wA4TP1rvSprmxP/ADhM/Wu9KmuAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAOgbDnV0v8FH/ACnPzoGw51dL/BR/ygeoL98827PH/iGz +Ag+lx6Pyu8eb9nfTshM/gIPpcDD/9Xz+AAAAAAAAAABN0yThsYyM9t3rpuu8Q8G GsWM1iJe6nQsI4WmMUVqBR5aK2A57HOWI/SjEal72+myfaa2oqnlTHe2LFMc6pfm HsNVmvxXMpVMizcXJc9Fu1jbJZF6ZyomtU0XuR8tCiNqb5edhKyK1qo5kRNR32sY 6oexssHDtLpaR40GyzDWv2lrVVqLlKuS7KcqKi6v8jUx3giVxdXqdW4M1uWHGkrR mpDRIiqqXYq6NK2cqLddGSljct3dnWNJcjWxFM4mYr55irujHhPTH+RjiXK7kbnw cIlIE5NT25KfAiTMVXWRrWqu+iaeBLqmldBKYlwzVcPxocvV6fuSNFYr2sWIx+Uy 9r3aqprO07Fex9mzUJ+pTMzCjx3q6DBYsNMprEdoflXVUyk1pZPtNyX2UMMYlq0T D01LPWTmXLBZGiIu1xlVURqKlkVt+/qNrXzsy5RRRoIiqmI9fM5mZ8e75fZhCi7d pqnifB5UqMo2WitdDRUhv0oi7xpHRdk3CT8NVybkUVHwk/pEBUaqfFuVbJ9llTRw HOjm2qpmnE9YLtMROY6SAAtVgAAAAAT2COr7DnhSW/VaQJPYI6vsOeFJb9VoETP/ ADhM/Wu9KmubE/8AOEz9a70qa4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAv+w71cu/gY/5SgF/2Hurh38DH/KB6W21eH8Dzts6LfZAh L/wEH0uPQlzz1s5dX0L+Ag+lwHNAAAAAAAAAAB//1uK0SXy4rozk6VqaP+vEd02B 2yrq3Vojot5tJZrYbcldMPK6db2smnI0XuungOVYdo0xUo0lS5JIe6Jt2S1Xusiq iar72m/4Ha8PbDlVpO0TLcVRJKOuS6NBlYGU1VRbo1VV1npfec2y8BpRvV3d+IzE Nurdpt7syo9Wwvi3E+I5+pdAp9u6ZhzkWNAWHktVelTpraESyfYdliwWy8RYDXK9 sJEho5d/JS3+RapiTgzkhEkptFjwYsNYcVH6NsaqWW9ra9+xoRqFDfEVYURITN5i M0J9Gk5v0g0N/V2KKbEZmJ5xyju9ssaS5RbqmakZTHK2oQbKqXdp75wOcwtiaVq8 eOyhVd21R3PSK6Vet7OvlK5qWXhumg9HOw3IzErFlp+G2bhRUVr4b0s1U0b32ErC hMgwWQobUbDY1Gtam8iaEQs2DoLuj0003uVUznHhGI70dVcpuV5pcP2aklp+m4br GlIszBc1zMhdLbNdpvqsrlSy6dPeU88TEJYExEhLpyXWvwoepcQ7E1ZxFHizE7jC JMvu58GBFlnJCYqpqRNsVGpoS9k+w864tpcWlVaJLTCw90QXugRch10y2LZdP4fY dOmaouzmOUsVRE2+U9FfABsKAAAAAAJ7BHV9hzwpLfqtIEnsEdX2HPCkt+q0CJn/ AJwmfrXelTXNif8AnCZ+td6VNcAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAX/Ye6uH/wMf8AKUAv2w/1bP8A4CY/KB6Ny/3kPP2zit8e wV/s+D6XHeMpTguzdpx1A8HwfS4GXNwAAAAAAAAAB1fYejrFxjRbRGscjojLuRFS +1PRLoq6emRujXwabF9rWy9iehz0xS5ykU2HPy78mI7p1Yu+iomUi2VFRU075xHB 1Xj0ipQpuXX46WjNjMS+tUW9voW1l+k9HYtwLI7IqU6u0SclYDYzFWLM7U68dvSo 1VTRpbZyadOpN7RRa9Gqqn2rbuZppqc1ntljGE6itbUWSzF1tl4LW799aoqp4yDf jDEz4roi4hqiOcunJm4ifgi6E06iaxRsa1qg1ZJSRlp2rQVhNibol5J+Siqqpkra 6XS3DvoVOdkJynTCy89KR5WOiIqw48NWOsupbLpLlCzSeydjGSsjK1EiNRUVWxob Il7b11S/iUsEls4YhgojZqSp8yiIvTI1zHKt9+y2/A5iSuHaBOYnrcGlSKw2x4qO VHxVVGNRrVVVVURVTVbVrVAZdVlNnCZnZiFKy+FXx5iIqNayFOKquXvJtZw/ZLmY cxj2rtgrDWEybjI3a0RG2y11W0arad/Wduw7gWJsdQqjiivPkpl8jAV8o2BHiN+M VFbkqqtROmykbpRflHmyozCzVRmI7lur4irfhIzzqhZGYpl//9fz+AAAAAAAAT2C Or7DnhSW/VaQJPYI6vsOeFJb9VoETP8AzhM/Wu9KmubE/wDOEz9a70qa4AAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAv2xB1bP/gJj8pQ S+7EHVrE/gJj8oHoK/fOEbNvVzA8HwfS47hticBw3ZrW+N5df7Pg+lwOTnIAAAAA AAAB+oiqqIiXVdSIBuUuZ3LPMcqKrXdKqIl1O+7EuNo1NZFp9XmJhaajESWerUcy AqXVU66y3TVe3eOP4ew+6NGR8W6Kmlyp+ynB9J0CAkKXgthQoeSxupEONrNdwrn7 LnLpafTb9GK+jurMb4ce9GpUmoq8MJ6J41aVjEdEwHimoPnp+qObMvYjMuDGtZE1 WRUVDmu3JwKfrYyIt9KGt2vf76Y+f5rZ2fa8Z/z3Op4Sk8G4NZNNp1XWK6ZVqvfM PRzrJeyJZqaNKk6uOMOIqp0R1cEGJ7JxLdH734DdH734GJ2vqO6mPn+bMbPs+M/J J7NWPmTUlL0ymRIjpJzViR4m12bEeipkN0pdLKl1+lDz0dlqcrAqco6DGRHKqdKt tSnKqvS4tLm3Q3p0ir0qnR0Gs4+Yr5VNTVafh43eiPAB0mkAAAAABPYI6vsOeFJb 9VpAk9gjq+w54Ulv1Wgf/9Dg8/8AOEz9a70qa5sT/wA4TP1rvSprgAAAAAAAAAAA AAA26dKNnJranK5EtfpVRDUJOg/OSabdKvpQhdmYomYTtxE1REt59BlWNRdsjaUv 8pPUfLKHLP8A242vrk9RLzPy2po1aTHL9LpV2pd5bnO41zHVu8KjwQ87SZaWTpXx b99UX/I+peiwIsPKc6Ki8CKnqN6oXiOWyrk9824KbXLtamu28Sm9XFEc+bMWqM9G tDwtJOl2vWNHylS9rpo/A0olElWRUakSNZb63J6ixw4qJLdMt7EJMxrzDdNum3jF F25M9WJtUeDTfSJZrbo+Kv2p6j7g0WViXVz4yJvWcnqNx13IiNVbLrUyQ9Trp8ld NjM3a8dThUeCHi0yXZFyWuiqnfVPUbjaDKrDytsjXte109Rmi9NGTJRNOm6LqLvR 9jrFdaknvlaY6C1qIiOnLwcq6XRWo5OmTvoX2aL2oqiiiceMzMREfbMoVxbojNUO fQ6LLOcxrnxbuWy2cnqPms0aXp0BHwnxVcq6nqi+hCUmZGfpc9BgVSQmZKM5EejJ iC6G5Wqqoi2VE0XRdPeMeKFvLaFvZUubWt0Or0F6mi/0q6TE5iY9kq6ZtXKJqo7l TABlrAAAAAAAAAAAAAAAAAAAAAAX3Yh6tIv8BMfkKEX3Yi6tIv8AATH5AO5375xT Zo6tJbwdB9LjtGV3ji2zPpxnK+DoPpcDDnYAAAAAAABvUqFtk3lbzEv9q6P8zRJ2 hwLM2x2p7r/YnvKr1W7RK2zTmuFzkX7RKsal03zb3U7rl8RBNmsmzbJf6TIk3p/a 8Z5+qzmcy7FNeIwmd1O678Bupev/AAIfdafvH7utOFxDgexniJfdTuu/Abqd1y+I h91pwvPzda/veMzwPYcRM7qd1y+Ir+KWbppyv/aZv75n3Wv73jNaaipHhvhL+03V fSW2LfDuRVHcruVb9M0yowPp7VZEcxdbVVD5PROKAAAAABPYI6vsOeFJb9VpAk9g jq+w54Ulv1WgRM/84TP1rvSprmxP/OEz9a70qa4AAAAAAAAH/9Hz+AAAAAEnQlRK jdesX0oRhK4f+cXLa9oar+KFV793Ky168LBHVjXo5V0poPmFZq6GX0n49UVdGpNH 2H0nydK2Sxy+50GOK1HqqvTf1CJFRiNY1L2Q+X2Zdyqq7xjynLHVERNCayURkb0N V2iy3TRqVCFiuV8wxUuiI+1/tJu6pAaiNtdt7oQuTeMqXXQ9dH2k7XWWJSDobukR FRFv9p9o1rHvai6dekyR2/FQ3Ob0qpY18u8R6W3tRXzllbtjOhy9dxzT4MwqtbAd um1ro/IVHZKou8trKdUxrsrOwvX30eRprIzpdrUiuirkturUcmTZdVlTXbScs2Ma zBomNqfMTDFWHHXc18pERixFRuUt95C248wJiPEeM6hVqRIMm5CPte1RmTMJEdkw 2tXW5F0K1U+w39NjdlpanO8tWOKFJ7JGEKbVJOIsrGVWxIG3MRHOarkRWuVL2smU qIm+cp2RMCS2H8JLPQ56NGeyJDh5L2ol76DsNHlI1Ow9S5CaRrZqVlkhRobXtfkP RVWyq1VS+lPGUvZk/wDD+L/EQvSpwNZt7WXtoWtBM4t0Vco+3GebYt2KKbM3O+Ye dAAeoaAAAAAAAAAAAAAAAAAAAAAAF82I+rOL4PmPyFDL5sR9WUbwfMfkA7Ttq8P4 HHdmRb4wlF/s6D6XHXbnIdmPqvlPB0H0uA56AAAAAAAAWyQl9qYyEujJREd9Otfx KrDcjYjXLpRFRVLrLMiuhzWTDc5WXRytRVslzT1c4iIbWmjq1YV41QVeGyJ9qkvO q2FDhprsnpI2lMc+ZV77aHr7jcqbk21Ub8lpp1dcNpFLGcj3dMtr8J9Qoj3Oddzt fCazFXLe1PGbEuzpojlWyaCyqIiGMsbIjspXKqrdLaVP1X3dDRdaLwmNjVbDRvAt z8Yu2TF1S1lRSWIE/T3I9ytctulybmjMN2uponDov9JuU5E21qO0I5UMNXh2mWRG LoRyIvjKKZ54ZVKpwVgzz0X9rpkNMl8QqnRDJ30S+q2giDq2pzREuddjFcgALEAA ACewR1fYc8KS36rSBJ7BHV9hzwpLfqtAiZ/5wmfrXelTXNif+cJn613pU1wAAAAA AAAAAAAAATGG1RKjEvf/AES6vpQhyVoDsmffov8AFL6UKr/7uVlr14TcK8SGrrXW 5miusxt7aPsPuVhqsFzlVqIms14z1VdNslNFzl9ZdDuf/9LlEZb5K3VE+gIirMuS 9ul3j5VcuKnTJbVpNlzVbMomTe7fWcqeXJ02VXO2piIq6t4ioLFfHioi/tX7+tTe 2xVhaFsjVtdeAwQGK2LEdZFRXaBTyiWZScSWmZt0rKSrI0aPEXJZChMVznL3kTSp fZbYmhSrXsxJiumUacct2Sz3Mcroe8+6vbv5Sav2dZBYMxTBwhiWBUJqU3TAfCWC 9EaivYiqjspt1Tpultr31O4Qca4HxFLwnTEzKbbHbte0zLE21t9GStr2XTvLvl1i i3MekovVVxPoqpKYE2MYMnBhTGIpONHZDa2JFbUobEe62lyNyltddNrrYt+HZvBm GJF0lT8TSSy6uymw49UZERnDkorulRVVVW2+po1PYfwpOSawpKViSEZXIqRmRokR UTgs5yoVCrbBk62LD6DVOXiQ8ldsWcVzFRe9ktXQbkUU084hqTXVPWXRI9WwbEbF WDW6HAixX7Y+JDmYSK92hFV1l0rZES68BzbZkmqLF2P4rJGvU+dj7ohWhQI7HOVL rdbI5VIOrbEWKaXChvZCl59XusrZNznK3vrlNboKbizCNfo1DdN1GlTEtLpEa1Yj 0S111IalzZ2mu6iNTXR6cY55nu9+Gab1yKdyJ5KCADeQAAAAAAAAAAAAAAAAAAAA AAvmxJ1YxvB8x+QoZe9iXqwj+Dpn8gHYcpeE5Jsw6cXSfg6D6XHUcrvHLNl7TiuS 8GwfS4GVAAAAAAAAAOnYQmMmfmnJqe3KTTqTRo/E5iX7DkdIc1Dd8nbYCWT7EU52 06d6zMN7Qzi4u0SnUyYi7dElWbYutWqrb/TbWa8xh2lzKuVyRWK7fa/V4wyZS2ky JMpwnmYm7T0ql2pponnMItcEU5qosKcmkdvq5Wu/yQPwVAX/AEc89qW1Oh39CoSy R++fW398n9Z1Ef7keDanuQ6YKl8jp56Krt9yMRLn03A9LbkuWanMpLXs9qIv+Elt u75+LH74+sajzM8G1HcwwsO0uC5FYkS6arvuZkpdLhxUjJKtdEat0V6q5L8Nl0Hw synXfifD5lLLZSGbs9ap+LO7bjnEOU4mjborsxFW6ZT3LZd7plIg3qs/LqMRd/Wv 26f8zRPZWY3bdMex5u7Oa5kABarAAAJ7BHV9hzwpLfqtIEnsEdX2HPCkt+q0CJn/ AJwmfrXelTXNif8AnCZ+td6VNcAAAAAAAAAAAAAAElRFRJ11+xr6UI0kKPpnHJa6 ZC38aFd71JWWvXhaoOmSy36jUcxr4iIjtCmZ8XJkmstv/QYmplPS0NeHShy/a6DA tki2S1tS98+4yt3Uy66ciy2+0xTi7U9Gt0Ku8ZmIqzDbIipk8H0k+7LD5lkh7W+2 Ve5+qxEVrrfSfcG7cvpUTpt4TH+iultfCRz6QmqK2XmJ/wDpUFkRqQVsjk0Xumks G5aTZf6FA069ClQlY6wdrVq3crbW+0zxKo6FlZV+l12U0b1iuuvNMy2bdymmnEws qSNHaqKkjARU1aFLDIYrnqZJQ5OSm3QJeHfIhs1JdVVfxVTm8KrrGVEYjrro1mWP PxZe+2IqW75X9WvRPrT8Upu0T1iH/9Pfz6rPdKL4ypbI+KKjVcJRJWZnHxYaxmOy V4UUra1m3D4yNr8+sxS3Q7L8tq6Tz2ns3ou0zNU4z4uxertzbnER8FTAB6FxwAAA AAAAAAAAAAAAAAAAAAL3sS9WEfwdM/kKIXrYm6r5jwdM/kA6rc5fsu9VUj4Ng+lx 0nbE4Dmmy2t8TyC/2bB9LgclCAAAAAAAALDh6oqx20qvxjEvDv8AtJvp/mV4+ocR 8KI2Ix2S9q3ReBSu7bi5TNMp265oq3odRgTyOYjkXQqXM6TSLvopVpCebGgtisVE R3ym9a7fQ30mE30PP3NNu1Ydmi/mMp1I6cB9JHbwqQSTCd9PoUyJM6PluKpsJ8ZM rHbwqfKzCcBDrMcLneM+FmE/6UzFg4yYWaRN9qGnUaqyTkokZzk6VNCcK7yGiswn AVevVBZmYSA1fi4eu2+psafSb9cRPRTe1M0U5RUWI6NFdEdrctz4APQRGHGAAAAA AnsEdX2HPCkt+q0gSewR1fYc8KS36rQImf8AnCZ+td6VNc2J/wCcJn613pU1wAAA AAAAAAAAAAASVE/11/1a+lCNJGiqjZuIqpe0JbeNCu96krLXrwnXvXIhMvbvGyjH OW6JZpoIiOfCtvJvksjVXeRW5Jy6uToIOoqm3JrVUXRc3YDk2691TpeDUaU85Gxv t3zellRGuVdGTo+gsq9SGH4vy0VdCH7GtueKuTqPuJdNqVFRL6dP2GN70WDMtvp4 fGQhltU2XizcWGyDBdEe1uU5G8H/AEqGxN0KpxHxlZIxe9oM+E3thTiuy+m2hU/x IW7df7xoajVXLVzdpiGzasU105mVEkMP1aHGa6LJRURFRdSG7U6NUYyuyJGK5LJq +gt26/3huv8AeKJ196ZziFv1WjxUBmHasrOnkY1/oQ1sQ0mbk6WsaNLPhtymorl1 XOkbr/eK1jqY2zDT23v8az0mxp9bdrvU0zEc5U39PRTbqmJ7nLgAelcMAAAAAf/U 8/gAAAAAAAAAAAAAAAF62J+q6Y8HTP5Cil62J+q2Y8HTP5AOjX75zvZY6paf4Mg+ lx0HK7xz3ZX04kp/gyD6XAwogAAAAAAAAAA+4UaJBej4b1a5N9Calq7DXJSZY5q7 7maiCBXXapr6p03KqeiydGZdVTJfr13RUsbsvMwpi+TGhaEut3oU4FNWkonoujU1 d61RKnLs/wBtDX6HIprpWoGnKdv6kRSugRpKI6sTqak5OVuG6BkSyPSIuhXroRPo IMAvot00RilTXXNU5kABNEAAAAACewR1fYc8KS36rSBJ7BHV9hzwpLfqtAiZ/wCc Jn613pU1zYn/AJwmfrXelTXAAAAAAAAAAAAAABI0e+6YtuxL6UI4lsPtypyMn+5X 8zSu96krLXrwk2dLGhIqb2tPtJdq5MsrkRFsl03iKR1o8HpkXveMkUiIsGKxE1X0 ocyt0FeqCq6da1OHQhJt+LgRUS28v4oRs4ipOQ3KqXvvElZFuutFSxbX6tLEP2Zc 7c8CyJ8ne+w/JWG6IyOvD3vpMzmosvCWy9Klj6lEVYcTRa6lWeWGWWjxNzzb1W3y FS2/rQm93J/0hV2RFgx4q3VbGysZyW0608Rr3bMV1b0raLs0xhP7uT/pBu5P+kIH bXZSJla98xxJtYSKq5S24CuNNEpceVi3cn/SEJiqaSLRHN/3jTDDmXRFajb9Mui5 qV9HtpzkcqL06ai2xp4pu0z7Vd69M25hVQAd5yAAAAAAAAAAAAAAAAH/1fP4AAAA AXnYo6rJnwbM/kKMXnYp6rJnwbM/kAvmWvCUTZVW+Iqcv9mQfS4utyk7KfVBTfBk H0uAowAAAAAAAAAAAAAAAAAAAAAAAAAAAAAT2COr7DnhSW/VaQJPYI6vsOeFJb9V oETP/OEz9a70qa5sT/zhM/Wu9KmuAAAAAAAAAAAAAADakZ10jGfEaxHK5mTZfpRf 8jVBiYiYxLMTMTmEitWesRr1hN6XeuZm1+I1FTc7FuvCpEArmzbnuT41fi3Zioum IqPWG1LbyKZ0rcVE/wBE1ftIsGZtUTGMHFr8UznDF2pGbnh2TvqGYhisZk7QxdN9 akMCPAt+DPGr8UktYiK57tqb02vSZej0W6LtLNGrSpEAzwLfgxxa/FLvr0Rzkdud l037qY4lZfEa5NoYl99FUjAOBb8DjV+KVhVyJDyfiWLk8KqfM9WYs9AdBfDa1quR dC6iMBmLNETmIJu1zGJkABYrAAAAAAAAAAAAAAAAAAAAAAvOxT1VzXg2Z/IUYvGx V1VTXg2a/IBc8vvlM2UVvXqb4Mg+lxasrvFT2TtNcpnguD6XAy//1vP4AAAAAAAA AAAAAAAAAAAAAAAAAAAAAT2COr7DnhSW/VaQJPYI6vsOeFJb9VoETP8AzhM/Wu9K mubE/wDOEz9a70qa4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAvGxX1Uzfgya/IUcu+xZ1UTfgya/IoFouVbZN+eqX4Lg+lxYtsTgK3s lresUpf7Lg+l4OSlgAAAAAAAAAD/1/P4AAAAAAAAAAAAAAAAAAE9gjq+w54Ulv1W kCT2COr7DnhSW/VaBEz/AM4TP1rvSprmxP8AzhM/Wu9KmuAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALvsWdVE54Mmv01KQXfYt6p5zw ZNfpqBNZS8JA7JOmrUnwVB9LyaykITZH01Wk+CoPpeDCmgAAAAAAAAAAAAAAAAAA AAP/0PP4AAAAAAABPYI6vsOeFJb9VpAk9gjq+w54Ulv1WgRM/wDOEz9a70qa5sT/ AM4TP1rvSprgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAC7bF3VNOeC5r9NSkl22LuqWd8FzX6agb+WvCReyKt6lSF/sqD6Xm/cj9kP5x o/gqD6XgU8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAJ7BHV9hzwpLfqtIEnsEdX2HPC kt+q0D//0eDz/wA4TP1rvSprmxP/ADhM/Wu9KmuAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALtsX9Us74Lmv01KSXXYw6pJ7wXNfpqBm y++aeyEt5+j+CoPpefeUhix/pnKL4Jg+l4yZVIAAAAAAAAAAAAAAAAAAAAAAAAAA AAAJ7BHV9hzwpLfqtIEnsEdX2HPCkt+q0CJn/nCZ+td6VNc2J/5wmfrXelTXAAAA AAAAA//S8/gAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAF12MOq Oe8FTf6alKLpsY9UU/4Km/01AxXPnHv+t0XwTB9LzFtid8yY7W8zRF/smD6Xg5Km AAAAAAAAAAAAAAAAAAAAAAAAAAAAAE9gjq+w54Ulv1WkCT2COr7DnhSW/VaBEz/z hM/Wu9KmubE/84TP1rvSprgAAAAAAAAAAAAAAAAAAB//0/P4AAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAXTYy6oZ/wAFTf6alLLpsZdUM/4Km/01AjMpeE2cc/6e h+CIHpeaWUhuY40xqH4Ig/meDCrAAAAAAAAAAAAAAAAAAAAAAAAAAAAABPYI6vsO eFJb9VpAk9gjq+w54Ulv1WgRM/8AOEz9a70qa5sT/wA4TP1rvSprgAAAAAAAAAAA AAAAAAAAAAAAAAAAAAH/1PP4AAAAAAAAAAAAAAAAAAAAAAAAAAFz2M+qCoeCZv8A TUphc9jT5/qHgmb/AE1AgcteEk8ard9CX+yIH5nkPcl8Z66D4IgfmeBWAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAnsEdX2HPCkt+q0gSewR1fYc8KS36rQImf+cJn613pU 1zYn/nCZ+td6VNcAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAD/9Xz+AAA AAAAAAAAAAAAAXPY1+fqj4Jm/wBNSmFy2Nfn2o+CZv8ATUCsZffJvGS36AeCIH5n lbykLFi/SzD/AIHgfmeMmVbAAAAAAAAAAAAAAAAAAAAAAAAAAAAACewR1fYc8KS3 6rSBJ7BHV9hzwpLfqtAiZ/5wmfrXelTXLJOYKxW+emHswzWXNdEcqOSQiqipf+6Y cyMW8V63yfF9kCBBPZkYt4r1vk+L7IzIxbxXrfJ8X2QIEE9mRi3ivW+T4vsjMjFv Fet8nxfZAgQT2ZGLeK9b5Pi+yMyMW8V63yfF9kCBBPZkYt4r1vk+L7IzIxbxXrfJ 8X2QIEE9mRi3ivW+T4vsjMjFvFet8nxfZAgQT2ZGLeK9b5Pi+yMyMW8V63yfF9kC BBPZkYt4r1vk+L7IzIxbxXrfJ8X2QIEE9mRi3ivW+T4vsjMjFvFet8nxfZAgQT2Z GLeK9b5Pi+yMyMW8V63yfF9kCBBPZkYt4r1vk+L7IzIxbxXrfJ8X2QIEE9mRi3iv W+T4vsjMjFvFet8nxfZAgQT2ZGLeK9b5Pi+yMyMW8V63yfF9kCBBPZkYt4r1vk+L 7IzIxbxXrfJ8X2QIEE9mRi3ivW+T4vsjMjFvFet8nxfZAgQT2ZGLeK9b5Pi+yMyM W8V63yfF9kCBBPZkYt4r1vk+L7IzIxbxXrfJ8X2QIEE9mRi3ivW+T4vsjMjFvFet 8nxfZAgQT2ZGLeK9b5Pi+yMyMW8V63yfF9kCBBPZkYt4r1vk+L7IzIxbxXrfJ8X2 QP/W8/gnsyMW8V63yfF9kZkYt4r1vk+L7IECCezIxbxXrfJ8X2RmRi3ivW+T4vsg QJ0DYclYU7jpZSMirCjyUeG9EWyq1zbL+CldzIxbxXrfJ8X2S+bEOGa9SseQ5qpU SpScsktFRY0xKxIbEVU65URAJOLhXY4g0ypVF1Oqe56dOJJx1252Vl3Yiqjdaoix E7+hbIui9L2VJSVkMRyMnJQ3Q5aBT4cOGx7lcqIj3ppVdJ3BkzEiUyfmXUaFuqFl PhSu7NEdzX2YqvvZFVGtVL6vsOUbJ2Hq5WsTQZqmUKoTMDcrWq6Vl4kZjXZb1VMp EXTpTf3wOWgnsyMW8V63yfF9kZkYt4r1vk+L7IECCezIxbxXrfJ8X2RmRi3ivW+T 4vsgQIJ7MjFvFet8nxfZGZGLeK9b5Pi+yBAgnsyMW8V63yfF9kZkYt4r1vk+L7IE CCezIxbxXrfJ8X2RmRi3ivW+T4vsgQIJ7MjFvFet8nxfZGZGLeK9b5Pi+yBAgnsy MW8V63yfF9kZkYt4r1vk+L7IECCezIxbxXrfJ8X2RmRi3ivW+T4vsgQIJ7MjFvFe t8nxfZGZGLeK9b5Pi+yBAgnsyMW8V63yfF9kZkYt4r1vk+L7IECCezIxbxXrfJ8X 2RmRi3ivW+T4vsgQJPYI6vsOeFJb9VozIxbxXrfJ8X2Sawdg7E8tjegR4+HKvCgw qlLviRIkjFa1jUiNVVVVbZERN8DH/X2dP/7LoXu39/aNpy/JyMn7LF8/qfN7/wAj tm5P3L3yPSVLM3EG5LZt1PK2vtGJe9v7po5l4l2i2bNWvk9oROD+6aNyZu45Yw6F nFnPOJy1v6LuL/Y32vvcBcf6r6B/+Ty9zfu3vklOzKxRtfUxWL27Qi+yaOZGLeK9 b5Pi+yegnae//sx3OZtjTfXuH6W7u+Hf0W9cG7pVY/R57Nt6fJ3R8m+m2o2E2Lt3 puzozk7o+NydzZVsrTa+Wl9euxJpgOtuRHbknUvptud+j8DehbH9TfCY90Oba5zU VWrKO0Lwaym5s+K+l3d92fd1dDSa7ZuZ4nL3VT/xCjxsAbTHiQuid8hytvtGuy/3 jYhbHWXDa7ora6dr/wAxfG7Hs/kN0zOrtR3rNuHgCcSG1FfH1dqr6yurQUY/ffh/ VizprNVczOu5d0cKeSgM2MctiO6L2v8A8N/OS8tsd5MpCh9GplmQip8UzJRdKre1 ++TM1sTTc3MPjrOxmZVul3Eq2sluuM8tsRzDIWStRi6+019ojVs63jP1n8H6qqJv 8WaM71MZxPKM+E47s9cdyCjbGe6oMNvRqKuQ5y3iwctdNv3k4D5hbEeWi/15b/lP 5ydjbG87KPSHDizEZFTKymyjtHe1qZZbAM9kuylmG6d+Vd6yqrZWYzGp/D+qVO1d Fbu8G9VOY6+jVPziMfNVZ/Yw3Dtf9cZeXf8A8ta1rfv98wQNjnbnKnRW1k7X/mL7 BwDN9NeLGT6ZZfWbcDAcwjlvHipo35ZfWb0XdXRo/qX1n9n4bkeOevXr7WpXZ0+o 1fHtazcpnu4UzjljrPxUunbHG54kb+uIibZDybw4OQqdMi68peA3k2OdthRoPRua XbGonxjcpEs5F1XTgLLObHEaehJCWdiQ7Oyr7lVf/t3zXltiaIyLlLVX6u1P5zl9 nUzGZ1GJ/g/Vi7Xqbd6KLNziU+bEU/KeauM2I7vROjn/AMT+czN2H8pyJ0d1/wDC fzlmi7GkWWhLGZUHxXN1MbKrdd7rjBCwTN7a27o6JfWssvrKuy5qjNOo/B+pc2rb 01yLepqmJnnypmeX20xMIONsO7TBiRejt8hqutuTXZP75Hy2x/tM1Bi9E75D2utt Guy/3i9twTHy2/HxNfa6+s2kwTFyk/pT9fYF9ZGNnTT61/P8v6q9VqqNTVE6fVTb iOscOas/GFUzC/tue8fvPiPsX7dMRIvRjJy3q625r2ut+vLzmY7txfM+8if+yle7 P/xf5yuNnRPrX8fyZ/qr1d7VWcfV7/Fz19CKceHXrn5YV9NiO6IvRz/4n85lTYeu iL0d/wDifzlrbsZNRqJ0aTV2t/Oc+qT8RU+qTclAwnVJuDLxnwocwyBEyYrWuVEe lmKllRL6116za0extVqKpjTajnHXNMR/5TC2L2omP2s/8f0TjdhXKajs4LX/AOD/ AP8AQ5di+BmpiicomVurc2R8dbIyspjX/J02+VbXvF4hT2JNqbfB1VRbalgxPYNu HPYh2tL4RqiL9VE9g39H9G9VYuzXqaouRMdM00889cxV8va61veuUxEV4crgVLbI eVtNtPXe42Icztjb5FtPCdXg1GvJDsuE6kn/APOJ7BqzkOuT8ZIq4cqMOzcm20vX /wCvfN/si3M4mzEfzxP9W1dtXLdmK7VMXKvDein35mcOdQnZaLosZobMq+mx0CVk 61Da5FoNQ0rvwH+yfseNXpLJ2vC9Sj5d75MJ/S2/9C8JXOxLc1Yptxn+OPzRjU37 Fni6jSRFMdf2sT7OkZlRoMvlKvTW+wxT67hgNi/Lu7Jtq3l9Rf5aqYhynZWD6o3R vw4nsG7Bqldy1vhSopo34b/YIzsSaaszaj78f3E7T02oszTbsbtU9J3pnHumHJoV R25+RtVu/le42ocTKiIljrMGq1tIl1wvUE0dY/2DJMz9Zm5d0BcNz7Mq3TZD1tZb 9YQr2RTVVzsR9+PzU0UXqbU1RVvVRnEcozPdGe7Pi5U1uU5G3tczNlbuRMvf4DoU GXq7YrXLRZ3QvYX+ybr31aEx0RtDnXq1MpGpDfptvfJIzsimnlTbj70fmqtanaE0 zVd0ccv+7T09zm6SV1RNs/wmboV/vv8AD7y8trVdyk/7pVLX1j/YN/o1WeK8/wCS /wBghXse7H/Tj78fmafbmmric6b8U/k5Bun9z8Tday7UW+tDrnRqr8Wp3yX+wbiV 2qWT/u7OeJ3sFU7Lmn1bEffj81GnnUzM793Puhx9spdqLl604DYZT8piLtv+H3nR YqVKNGfF6ETbctyuttbtF/sNuC6oNhNatKmtCdY71EZ2TFPOLcfej81VrW7Wqrmm rSxMR0niURlzVtJymou3/wCD3mZlCy233Tb/ANHvL9FrNXloqwWYbnorW6nta+y7 /WGxL1+rbV02GZ1q31Kj/YIXNj3qqf3cY/ij82bW34ouzbuabnHKfSnrHtiMfByu elNxR2w8vLu3Kva2+vqPmXg7a1y5VrLwHYYOIKnkLfDs2mnfyvYNuBiKoo1b0CaT Tvq72THZ92ijdizH34/NTOo1V+/NdNW7TPSnETj39XHoUhl3+Mtb902IdK2xVTbr W/d95adkHDs9j7odeXmZDcW2/wCwdFy8vI/u2tkd/WVGV2HJyG5yrPR9Kb8ivtG7 Z+j+ivWouX69yuesc5x74nHTm6Ni7qd6KZnMePJ//9fFDol3f6xvdZ7zYhUDKfbd P/t+80Y+xZPybEiQ40zHVVyclsk7R3/lKfEvse1PbemhTjUtrWTd6zdn6LaGqM03 o+E/3OrVtTS2LsWtRXir7Jn5xEwkpqi7klnx90ZeTbpci17rbhI+E3LiNbe11NuH se1DbEvulE/hHes2oex9OpEaqvmNfarvWVx9GdBTGKrkT8f7kNRqLOpuxXp9Zw6e mOHNXPxzP+cmu2Tu5E2zf4DZbTumT43f633meLsezcaC+Ft0ZuW1W33Kui/2kY3Y emUci9EouvtJfaIR9GdnT613Humf/ZVqr2otVRGnv8WJ6zuxTj49Uv0K/wB9/h95 s9Cv99/h95H/APZPH7pRPua+0amYNQ4Jn7q71lX+ldBX6t35T/cxqNrRpcfWa8Z6 YiZ6dfVifmv0ONkQmNyb2aiazmdVw3umrzsfdeTtkeI/J2u9ruVbaydbgGbyU+Mj 6u1V9ZtNwDM5CfHxdXay+saL6OaTQ1TVau859k/1mVeq19jU0xGm1M2pjrPDmrPx jkrkHCGVBau7t7sP8xuwsG3hp/T/AP2f5iww8CRkhtRZqJq7XX1mlM7FkWamHRlq b2ZVul3Iq2sluuNrs+3VPO/j+X9S9rdXp7UVafV8WrpjhxTy8czHy9rBAwZ8X/r+ /wBh/mNeb2Nt3xUi9Fsizcm25r//AG75LS2xU5kGy1dde/K/znxH2P48m9IcOaiR 0VMrKbLLo73yl4CEbNpir0NRz/h/VTrdram5pYp2hV6HLuiefd6sZR8psWZDHf1z fT2r/Ofk5gPobkf1ltm2X/2FrW/9XfJaWwTM5LsqLFbp35dfWbkHBMXprzL0+mAv rI1bOqirNV/Mfwx+bRjWaK5Y3NPdm3V3VblU45+Ex3xyVyUwrlPd/TbaOxe834GE Mp6pu7e7F/MT0DBb0ct5xyaN+B7z8nMALPwUhLUtrs7Kvue//wBu+U1bPpmrnexH 8P6rKL2ptWN63rd+qOkcLGffPKEdAwd8Z/r+92H+YyTOBd2S7oHRLIyrdNtF7WW/ Xd4ja3gOaoNOWek4sapxkcjUl4MsqOVF39Cu1fQV+Vg198yxr8NVJjVvdywIlk0f 3SurZduKs06j8H6pWtp7UvWZtXqvRqzExinpPKekLNB2KrRmL0a3+1f5z7rGAOg1 En6p0T27cUtEmNr2jJy8hqutfKW17WvZSMgSNXdHYjqNPNRV0qsF+j8CVhUqoOjM RZGaaiuRFVYLtH4EfqU78TVfzHhumn0li3GOnxckbj670/qzf7P/ACkjnx/Z3/v/ AMp16HQJhYjUVIqIqpdVhLoJ3NJndFvmv5jr1xsueln8VTq6bg0RO/c+Uv/Z ------------k13hhMHZSZvV30HfFHdb1w--